The document describes research on expressing the matrix protein of Nipah virus (NiV) in Escherichia coli. Key findings include: 1) The NiV matrix protein gene was cloned and expressed as a fusion protein in E. coli, producing a protein of about 43 kDa. 2) About 50% of the expressed matrix protein was soluble and localized in the bacterial cytoplasm. 3) Purification using nickel affinity chromatography and sucrose gradient centrifugation yielded spherical virus-like particles ranging from 20-50 nm in diameter. 4) The purified matrix protein reacted significantly with sera from pigs infected during the 1998 NiV outbreak, demonstrating potential for diagnostic applications.

1. Journal of Virological Methods 162 (2009) 179–183
Contents lists available at ScienceDirect
Journal of Virological Methods
journal homepage: www.elsevier.com/locate/jviromet
Production of the matrix protein of Nipah virus in Escherichia coli: Virus-like
particles and possible application for diagnosis
Senthil Kumar Subramaniana
, Beng Ti Teyb,c
, Muhajir Hamida
, Wen Siang Tana,c,∗
a
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
b
Department of Chemical and Environmental Engineering, Faculty of Engineering, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
c
Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
Article history:
Received 10 June 2009
Received in revised form 28 July 2009
Accepted 30 July 2009
Available online 8 August 2009
Keywords:
Matrix protein
Virus-like particles
Escherichia coli
Nipah virus
Paramyxovirus
a b s t r a c t
The broad species tropism of Nipah virus (NiV) coupled with its high pathogenicity demand a rapid search
for a new biomarker candidate for diagnosis. The matrix (M) protein was expressed in Escherichia coli and
purified using a Ni-NTA affinity column chromatography and sucrose density gradient centrifugation. The
recombinant M protein with the molecular mass (Mr) of about 43 kDa was detected by anti-NiV serum and
anti-myc antibody. About 50% of the M protein was found to be soluble and localized in cytoplasm when
the cells were grown at 30 ◦
C. Electron microscopic analysis showed that the purified M protein assembled
into spherical particles of different sizes with diameters ranging from 20 to 50 nm. The purified M protein
showed significant reactivity with the swine sera collected during the NiV outbreak, demonstrating its
potential as a diagnostic reagent.
© 2009 Elsevier B.V. All rights reserved.
1. Introduction
Nipah virus (NiV) is a zoonotic paramyxovirus that causes fatal
encephalitic and respiratory illness in humans and livestock (Chua
et al., 2000; Paton et al., 1999). The outbreak in Peninsular Malaysia
in 1998 claimed 105 human lives and resulted in massive culling
of about 1.1 million infected swine with encephalitis and respi-
ratory diseases (Chua et al., 2000; Paton et al., 1999). Fruit bats
(flying foxes) are believed to be the natural reservoir for NiV and
may be introduced into pig farms through their secretions (Chua
et al., 2002; Field et al., 2001). Other animals such as dogs, cats
and horses can also be infected by the virus when they come in
close contact with infected pigs (Chua et al., 1999, 2000, 2002).
NiV outbreaks have occurred in Malaysia, Singapore, India and
Bangladesh following various chains of transmission including
intermediate host species (Chua et al., 2000), vehicle borne trans-
mission (Luby et al., 2006), bat to human transmission (Hsu et al.,
2004) and human-to-human transmission (ICDDRB, 2004). Iden-
tification of the spillover into human population has now been
extended to Indonesia, India and Bangladesh (Chua et al., 2000;
∗ Corresponding author at: Faculty of Biotechnology and Biomolecular Sciences,
Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.
Tel.: +60 3 89466715; fax: +60 3 89430913.
E-mail addresses: wstan@biotech.upm.edu.my, wensiangtan@yahoo.com
(W.S. Tan).
Hsu et al., 2004; ICDDRB, 2004; Luby et al., 2006). It is prob-
ably much more extensive due to undiagnosed cases in many
countries. The ability of NiV to infect a variety of species along
with its mode of transmission coupled with its high pathogenic-
ity demand a rapid search for possible tools for diagnosis of early
infection.
NiV has pleomorphic structure ranging from 50 nm to greater
than 600 nm in diameter (Hyatt et al., 2001). The virus contains two
envelope glycoproteins: the G protein is responsible for binding to
the cellular receptors, Ephrin B2 and B3 (Bonaparte et al., 2005;
Negrete et al., 2005) and the F protein mediates membrane fusion
(Bossart et al., 2002). Lying beneath the viral envelope is the matrix
(M) protein, which interacts with both the glycoproteins and the
nucleocapsid (N) or ribonucleoprotein (RNP) complex (Lamb and
Parks, 2007; Schmitt and Lamb, 2004).
The M protein is one of the abundant proteins in the virion and
it is important in determining the virion architecture. The M gene
is predicted to be 1359 nucleotides (nt) in length, with an ORF of
1059 nt, encoding the M protein (352 amino acids) with a predicted
molecular mass (Mr) about 39.93 kDa. The first available AUG codon
is predicted to have more probabilities to be the initiator rather than
the other in-frame initiation codon at nucleotide 36 downstream of
the first codon. Its high hydrophobic nature coupled with high net
positive charge attribute to its property of association with mem-
branes (Harcourt et al., 2000; Takimoto and Portner, 2004). The M
protein is localized in the cytoplasm, predominantly at the plasma
membrane when it was expressed in mammalian cells (Ciancanelli
0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.jviromet.2009.07.034

2. 180 S.K. Subramanian et al. / Journal of Virological Methods 162 (2009) 179–183
and Basler, 2006). However, there is no information available on the
production of the M protein in bacteria. Therefore, the objectives
of the study were: (i) to express the M protein in Escherichia coli;
(ii) to purify and characterize the M protein and; (iii) to develop an
ELISA for detecting anti-M antibody in swine serum samples.
2. Materials and methods
2.1. Serum samples
Swine anti-NiV serum samples, with known serum neutral-
ization titer (SNT), were obtained from the Veterinary Research
Institute, Ipoh, Malaysia. The serum samples were collected during
the 1998–1999 NiV outbreaks in Malaysia.
2.2. Construction of recombinant plasmids
Total RNA was extracted from NiV infected cell culture medium
(250 ␮l) using the TRI-REAGENT (Sigma, Missouri, USA) as recom-
mended by the manufacturer. The extracted total RNA was used
as a template for cDNA synthesis using the M-MLV Reverse Tran-
scriptase (Promega, Madison, USA). The NiV M gene was amplified
by using primers NiV-M-6 FD (CCATGGCCATGGAGCCGGACATC)
and NiV-M-5 RV (GTAAGCTTCGCCCTTTAGAATTCTCCCTGT). The
underlined nucleotides represent NcoI and HindIII restriction sites,
respectively. The PCR products were digested with NcoI and HindIII
and subsequently cloned into the corresponding restriction sites of
the pTrcHis2 vector (Invitrogen, Carlsbad, USA) to produce recom-
binant plasmid, pTrcNiVM. The insert of the recombinant plasmid
was confirmed to be in frame by DNA sequencing.
2.3. Expression of the M protein in E. coli
Shake flask cultures (50 ml) of transformed E. coli BL21(DE3)
cells were grown in Luria Bertani (LB) medium containing ampi-
cillin (50 ␮g/ml) at 25, 30 and 37 ◦C to an A600 of about 0.6–0.8 and
protein expression was induced with IPTG (0.5 mM). The cultures
(1 ml) were centrifuged at 11,500 × g for 30 s and cells were lysed
using lysis buffer [50 mM Tris–HCl, pH7.4, 100 ␮g/ml lysozyme,
5 mM EDTA, pH 8, 1 mM phenyl methane sulfonyl fluoride (PMSF)].
Protein concentration was determined with the Bradford assay
(Bradford, 1976).
2.4. Localization and solubility analyses
Localization and solubility analyses of the recombinant M pro-
tein produced in E. coli cells were carried out according to Coligan
et al. (2000). The percentage of soluble M protein was measured
with the Quantity One Quantitation Software (Bio-Rad, Hercules,
USA) as described by Tan et al. (2004).
2.5. SDS-PAGE and Western blotting
Proteins were separated by SDS-PAGE and were either stained
with Commassie Brilliant Blue or transferred onto nitrocellu-
lose membranes using a semidry transfer cell (Bio-Rad, Hercules,
USA) for Western blotting. The membranes were blocked with 5%
skimmed milk in TBS (50 mM Tris–HCl, 150 mM NaCl; pH 7.5) for
1 h at room temperature (RT). Swine anti-NiV sera (1:200 dilution)
or anti-His monoclonal antibody (GE healthcare, Pittsburg, USA) or
anti-myc monoclonal antibody (1:5000 dilution; Invitrogen, Carls-
bad, USA) was added to the membranes and shaken for overnight.
The membranes were then washed with TBS-T (TBS + 0.01% Tween
20). Secondary antibody either anti-swine or anti-mouse antibody
conjugated to alkaline phosphatase (1:5000 dilution; Kirkegard
and Perry Laboratories, Gaithersburg, USA) was then added and
incubated for another 1 h. After washing, the colour development
was performed by adding 5-bromo-4-chloro-3 -indolyl phosphate
p-toluidine salt (BCIP; Fermentas, Glen Burnie, USA) and nitro-
blue tetrazolium chloride (NBT; Fermentas, Glen Burnie, USA)
substrate.
2.6. Purification of NiV M protein and VLPs
Protein synthesis in E. coli was induced with IPTG (0.5 mM)
for 2 h at 37 ◦C. The cells were centrifuged at 3440 × g for 10 min
and the pellets were resuspended in lysis buffer (20 mM Na3PO4,
150 mM NaCl; pH 7.5) containing lysozyme (100 ␮g/ml) and incu-
bated on ice for 30 min. The cell suspension was then lysed by
sonication after adding PMSF (1 mM) and DNase (7 ␮g/ml) and
incubated on ice for 15 min. The lysate, obtained after centrifuga-
tion at 39,200 × g for 30 min, was loaded onto a pre-equilibrated
Ni-NTA agarose (Amersham biosciences, Pittsburg, USA) column
and was incubated for 1 h at room temperature. The protein-bound
resin was first washed with buffer A (20 mM Na3PO4, 150 mM NaCl;
pH 7.5) followed by washing with buffer B (20 mM Na3PO4, 500 mM
NaCl; pH 6). The bound recombinant M protein was eluted with elu-
tion buffer (20 mM Na3PO4, 500 mM NaCl, 500 mM imidazole; pH
7.4) and elute was analysed by SDS-PAGE and Western blotting.
The purified recombinant protein was dialyzed against dialy-
sis buffer (50 mM Tris–HCl; pH 7.5, 150 mM NaCl). The dialyzed
protein was concentrated with a 30 kDa cut-off polyethersulfone
membrane (VIVASPIN6; Vivascience, Stonehouse, UK) at 4500 × g,
4 ◦C. The concentrated protein was layered on a step sucrose gradi-
ent 10, 20, 30, 40 and 60% (w/v) and centrifuged (rotor SW40Ti, at
36,000 rpm) for 5 h at 4 ◦C. Fractions (0.5 ml) were collected and
analysed on SDS-PAGE. Positive fractions were then pooled and
dialyzed against dialysis buffer.
2.7. Electron microscopy
The purified M protein (15 ␮l) was absorbed to carbon-coated
grids (200 meshes) and stained with uranyl acetate (2%). The grids
were viewed under a TEM (HITACHI-T-700) and micrographs were
taken at appropriate magnifications (Tan et al., 2004).
2.8. ELISA
All washing steps were carried out five times with TBS-T buffer
(TBS + 0.05% Tween 20). All antigens were diluted in TBS whereas
antibodies were diluted in TBS-T buffer. U-shape polysterene
microtiter plates were used as the solid-phase adsorbents. Sucrose
gradient fractions (50 ␮l) or the purified recombinant M protein
(100 ng/well; 100 ␮l) was added to the wells. After incubating for
18 h at 4 ◦C, the plates were washed and then blocked with 10% BSA
(200 ␮l) in TBS and incubated for 2 h at RT. Subsequently, the plates
were washed and incubated for 1 h at RT with either anti-myc mon-
oclonal antibody (1:5000) or with the appropriate dilution (1:20)
of the swine sera from infected and non-infected animals. After
washing with TBS-T, either anti-mouse antibody (1:5000 dilution)
or anti-swine immunoglobin IgG (1:3000 dilution) conjugated to
alkaline phosphatase (KPL, Gaithersburg, USA) was added and the
plates were incubated further for 1 h at RT. Following another wash-
ing step, the enzyme substrate solution containing p-nitrophenyl
phosphate (0.1%; Sigma) in diethanolamine (1 M; Sigma), pH 9.5,
was added. The reaction was stopped after 30 min incubation at RT,
and the A405 values were measured with a microtiter plate reader
(Bio-Tek, ELX 800, Winooski, USA). The significance of the readings
between positive and negative sera was calculated using the T-Test
statistical analysis.

3. S.K. Subramanian et al. / Journal of Virological Methods 162 (2009) 179–183 181
3. Results
3.1. Expression and purification of the M protein
Expression of the M protein was achieved in E. coli cells trans-
formed with the recombinant plasmid pTrcNiVM. The M protein
was expressed as a fusion protein harbouring both the myc and
His-tag at its C-terminus. The calculated Mr of the full length
NiV M protein including the tags is about 43 kDa. The expected
protein band of 43 kDa could not be detected in the cell lysate
when analysed with a polyacrylamide gel stained with coomassie
blue (Fig. 1A, lane 1), but the band was observed after purifying
with Ni-NTA column and sucrose density gradient (Fig. 1A, lanes
2 and 3). A contaminating band of about 60 kDa was observed
to be co-purified with the M protein (Fig. 1A), but it was not
Fig. 1. Expression and purification of the NiV M protein expressed in E. coli BL21
(DE3) cells. SDS-PAGE and coomassie blue staining (A), Western blot analysis [with
anti-myc monoclonal antibody (B) and with swine anti-NiV serum (C)] of the M
protein. Lane M, molecular weight markers in kDa; lane 1, E. coli cells harbouring
pTrcNiVM plasmid (IPTG induced bacterial cell lysate); lane 2, the M protein purified
with Ni-NTA column; lane 3, the M protein purified with sucrose density gradient
centrifugation. Arrows indicate the position of the expected protein bands.
Fig. 2. A Western blot of the localization study of the M protein expressed in E. coli
BL21 (DE3) cells. Protein samples were separated on a 12% polyacrylamide gel, elec-
trotransferred to a nitrocellulose membrane and probed with the anti-His antibody.
T: total cell lysate, P: periplasmic fractions; and C: cytoplasmic fractions. The growth
temperatures are indicated on top of the lanes.
detected by the anti-myc antibody and swine anti-NiV serum in
the Western blots (Fig. 1B and C). The unpurified and purified
M protein with the Mr of about 43 kDa was detected by both
the anti-myc antibody and swine anti-NiV serum (Fig. 1B and
C).
3.2. Solubility and localization of the M protein in E. coli
To study the distribution and extent of solubility of the M pro-
tein produced in E. coli, protein expression was induced at various
temperatures. An immunoblot of the localization study is shown
in Fig. 2. The presence of the M protein in cellular fraction and
its complete absence in periplasm suggest that irrespective of the
difference in the culture growth temperature, the M protein was
localized in cytoplasm and did not appear in periplasmic space.
The solubility of the M protein produced in E. coli was found to be
48.8 ± 2.2% and 39.6 ± 3.8% at 30 and 37 ◦C, respectively.
3.3. The M protein assembles into VLPs
To determine whether the NiV M protein expressed in E. coli
can form particles, the Ni-NTA column purified M protein was sep-
arated on sucrose density gradient centrifugation. The fractions
collected were analysed by Western blotting and ELISA (Fig. 3).
Analysis of the fractions revealed that the M protein migrated into
the gradient forming a bell shape peak from fractions 2 to 10.
Electron microscopic examination of the fractionated M protein
showed that it assembled into spherical particles with sizes rang-
ing from 20 to 50 nm in diameter (Fig. 4). These results demonstrate
that the M protein produced in E. coli assembles into VLPs.
Fig. 3. Separation of the M protein with sucrose density gradient centrifugation.
The M protein purified with the Ni-NTA affinity column was separated on a sucrose
gradient. Western blot (A) and ELISA (B) results of the gradient fractions detected
with anti-myc antibody (1:5000). For ELISA, 50 ␮l of each fraction was used to coat
the wells. Fractions correspond to the theoretical percentage of sucrose are indicated
on top of the bars.

4. 182 S.K. Subramanian et al. / Journal of Virological Methods 162 (2009) 179–183
Fig. 4. Transmission electron micrograph showing the formation of spherical struc-
tures in the purified NiV M protein. Bar represents 200 nm.
3.4. ELISA
To evaluate the antigenicity of the M protein and its possible
application as a diagnostic antigen, a total of 18 predefined sera (15
positives and 3 negatives) were analysed using the purified M pro-
tein for the detection of anti-M antibody in the swine sera obtained
during the outbreak. All the positive serum samples showed higher
readings when compared to the negative samples with the P value
less than 0.05 (Fig. 5), demonstrating the potential of the M protein
as a diagnostic reagent.
4. Discussion
The M proteins of paramyxoviruses are moderately hydropho-
bic and contain many basic residues (Takimoto and Portner, 2004;
Yusoff and Tan, 2001). Many studies have shown that these proteins
can be produced in animal cell lines, but there is little information
available on their expression in bacteria. Like other members in the
family of Paramyxoviridae, the M protein of NiV is non-glycosylated,
Fig. 5. Immunoreactivity of a panel of 18 sera against NiV M protein purified with
sucrose density gradient centrifugation. 1–3: negative sera and 4–18: positive sera.
The error bars represent standard deviations from the means. The assay was per-
formed in triplicates. The P value of the readings between positive and negative sera
is less than 0.05.
therefore bacteria would provide an alternative means for the pro-
duction of this protein. In this study, the NiV M gene was amplified
successfully from the viral RNA and cloned into pTrcHis2 vector. The
recombinant M protein was expressed in E. coli and purified using
a His-tag based affinity chromatography. The Mr of the expressed
M protein was as predicted demonstrating that the full length M
protein can be expressed in E. coli. The purified M protein showed
reactivity towards the swine anti-NiV positive serum in Western
blotting revealing its antigenic nature.
The M protein produced in E. coli is mainly found in insoluble
form. The solubility of the M protein increased from 39% to about
50% by lowering the growth temperature. This could be due to the
fact that when the protein synthesis rate is reduced at a lower tem-
perature, it can be folded efficiently as the protein folding rate of a
soluble protein is a slow process (Chalmers et al., 1990; Slabaugh
et al., 1993; Thomas and Baneyx, 1996).
A nickel affinity chromatography was employed to purify the
M protein from the cell lysate. The binding and washing of lysate
was done without imidazole as it was found that the presence of
10–20 mM imidazole reduced dramatically the binding of the target
protein (data not shown). Hence, large volume of wash buffer with-
out imidazole was used to improve the purity of the target protein.
However, the elute still contained some host proteins (Fig. 1A, lane
2). The M proteins of paramyxoviruses are rich in basic residues
and have tendency to bind to membrane (Bellini et al., 1998; Lamb
and Kolakofsky, 1996; Sanderson et al., 1994; Stricker et al., 1994;
Takimoto and Portner, 2004; Yu et al., 1992). When the protein
was purified further using sucrose density gradient centrifuga-
tion, a band of approximately 60 kDa comigrated along with the
M protein (Fig. 1A, lane 3). However, it did not react with the anti-
myc monoclonal antibody and swine anti-NiV serum (Fig. 1B and
C).
The M protein purified by a nickel affinity chromatography gave
rise to spherical VLPs with diameters ranging from 20 to 50 nm as
determined by electron microscopy. The size of the VLPs produced
in E. coli is smaller than those produced from cell culture system
(100–700 nm) (Ciancanelli and Basler, 2006; Patch et al., 2007) and
authentic NiV virion (40–1900 nm) (Hyatt et al., 2001). It is unclear
at this stage whether the NiV M protein had assembled to form
spherical particles inside the bacteria or during the preparation and
purification of the protein. Theoretically, ultra thin sectioning of E.
coli cells expressing the M protein followed by immunolabelling-
electron microscopic analysis may provide a clearer picture of this
process. To the best of our knowledge, this study is the first to
demonstrate that a paramyxovirus M protein can be expressed in
E. coli and the purified M protein can assemble into VLPs.
The potential diagnostic application of the sucrose gradient
purified M protein has been explored and it is clear that the antigen
facilitates the detection of anti-M antibodies in swine infected nat-
urally with NiV. However, further studies are needed to assess the
use of the M protein based ELISA in routine diagnosis, since proper
standardization of the ELISA requires sera from experimentally
infected animals followed by testing a more significant number of
field serum samples. Nevertheless, based on this study, it should
be possible to develop an immunoassay for detecting NiV anti-M
antibody.
In conclusion, this is the first report to demonstrate that the NiV
M protein can be expressed as a full length soluble protein in E. coli
and the purified M protein can assemble into spherical VLPs. The
purified M protein is antigenic and it is a potential candidate for
serodiagnosis.
Acknowledgements
We thank the Veterinary Research Institute (Ipoh, Malaysia) for
providing the swine anti-NiV sera. The technical assistance from

5. S.K. Subramanian et al. / Journal of Virological Methods 162 (2009) 179–183 183
Lip Nam Loh is greatly appreciated. This study was supported by
the Ministry of Science, Technology and Innovation, Malaysia.
References
Bellini, W.J., Rota, P.A., Anderson, L.J., 1998. Paramyxoviruses. In: Collier, L., Balows,
A., Sussman, M. (Eds.), Microbiology and Microbial Infections, vol. 1. Arnold,
London, pp. 435–461.
Bonaparte, M.J., Dimitrov, A.S., Bossart, K.N., Crameri, G., Mungall, B.A., Bishop, K.A.,
Choudhry, V., Dimitrov, D.S., Wang, L.F., Eaton, B.T., Broder, C.C., 2005. Ephrin-B2
ligand is a functional receptor for Hendra virus and Nipah virus. Proc. Natl. Acad.
Sci. U.S.A. 102, 10652–10657.
Bossart, K.N., Wang, L.F., Flora, M.N., Chua, K.B., Lam, S.K., Eaton, B.T., Broder,
C.C., 2002. Membrane fusion tropism and heterotypic functional activities of
the Nipah virus and Hendra virus envelope glycoproteins. J. Virol. 76, 11186–
11198.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein–dye binding. Anal.
Biochem. 72, 248–254.
Chalmers, J.J., Kim, E., Telford, J.N., Wong, E.Y., Tacon, W.C., Shuler, M.L., Wilson,
D.B., 1990. Effects of temperature on Escherichia coli overproducing ␤-
lactamase or human epidermal growth factor. Appl. Environ. Microbiol. 56, 104–
111.
Chua, K.B., Goh, K.J., Wong, K.T., Kamarulzaman, A., Tan, P.S., Ksiazek, T.G., Zaki, S.R.,
Paul, G., Lam, S.K., Tan, C.T., 1999. Fatal encephalitis due to Nipah virus among
pig-farmers in Malaysia. Lancet 354, 1257–1259.
Chua, K.B., Bellini, W.J., Rota, P.A., Harcourt, B.A., Tamin, A., Lam, S.K., Ksiazek, T.G.,
Rollin, P.E., Zaki, S.R., Shieh, W.J., Goldsmith, C.S., Gubler, D.J., Roehrig, J.T., Eaton,
B., Gould, A.R., Olson, J., Field, H., Daniels, P., Ling, A.E., Peters, C.J., Anderson,
L.J., Mahy, W.J., 2000. Nipah virus: a recently emergent deadly paramyxovirus.
Science 288, 1432–1435.
Chua, K.B., Koh, C.L., Hooi, P.S., Wee, K.F., Khong, J.H., Chua, B.H., Chan, T.P., Lim,
M.E., Lam, S.K., 2002. Isolation of Nipah virus from Malaysian island flying-foxes.
Microbes Infect. 4, 145–151.
Ciancanelli, M.J., Basler, C.F., 2006. Mutation of YMYL in the Nipah virus matrix
protein abrogates budding and alters subcellular localization. J. Virol. 80,
12070–12078.
Coligan, J.E., Dunn, B.M., Plooegh, H.L., Speicheir, D.W., Wingfield, P.T., 2000. Cur-
rent Protocols in Protein Science. John Wiley & Sons, Inc., New York, pp. 5.2.10–
5.2.11.
Field, H.E., Young, P., Yob, J.M., Mills, J., Hall, L., Mackenzie, J., 2001. The natural
history of Hendra and Nipah viruses. Microbes Infect. 3, 307–314.
Harcourt, B.H., Tamin, A., Ksiazek, T.G., Rollin, P.E., Anderson, L.J., Bellini, W.J.,
Rota, P.A., 2000. Molecular characterization of Nipah virus, a newly emergent
paramyxovirus. Virology 271, 334–349.
Hsu, V.P., Hossain, M.J., Parashar, U.D., Ali, M.M., Ksiazek, T.G., Kuzmin, I., Niez-
goda, M., Rupprecht, C., Bresee, J., Breiman, R.F., 2004. Nipah virus encephalitis
reemergence, Bangladesh. Emerg. Infect. Dis. 10, 2082–2087.
Hyatt, A.D., Zaki, S.R., Goldsmith, C.S., Wise, T.G., Hengstberger, S.G., 2001. Ultra
structure of Hendra virus and Nipah virus within cultured cells and host animals.
Microbes Infect. 3, 297–306.
ICDDRB, 2004. Nipah encephalitis outbreak over wide area of Western Bangladesh.
Health Sci. Bull. 2, 7–11.
Lamb, R.A., Kolakofsky, D., 1996. Paramyxoviridae: the viruses and their replication.
In: Fields, B.N., Knipe, D.M., Howley, P.M., Chanock, R.M., Melnick, J.L., Monath,
T.P., Roizman, B., Straus, S.E. (Eds.), Fields Virology, third ed. Lippincott-Raven,
Philadelphia, pp. 1177–1204.
Lamb, R.A., Parks, G.D., 2007. Paramyxoviridae: the viruses and their replication. In:
Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B.,
Straus, S.E. (Eds.), Fields virology. Lippincott Williams & Wilkins, Philadelphia,
pp. 1449–1496.
Luby, S.P., Rahman, M., Hossain, M.J., Blum, L.S., Husain, M.M., Gurley, E., Khan,
R., Ahmed, B.N., Rahman, S., Nahar, N., Kenah, E., Comer, J.A., Ksiazek, T.G.,
2006. Foodborne transmission of Nipah virus. Bangladesh. Emerg. Infect. Dis.
12, 1888–1894.
Negrete, O.A., Levroney, E.L., Aguilar, H.C., Bertolotti-Ciarlet, A., Nazarian, R., Tajyar,
S., Lee, B., 2005. Ephrin B2 is the entry receptor for Nipah virus, an emergent
deadly paramyxovirus. Nature 436, 401–405.
Patch, J.R., Crameri, G., Wang, L.F., Eaton, B.T., Broder, C.C., 2007. Quantitative analysis
of Nipah virus proteins released as virus-like particles reveals central role for the
matrix protein. Virol. J. 4, 1.
Paton, N.I., Leo, Y.S., Zaki, S.R., Auchus, A.P., Lee, K.E., Ling, A.E., Chew, S.K., Ang, B.,
Rollin, P.E., Umapathi, T.S., Sng, I., Lee, C.C., Lim, E., Ksiazek, T.G., 1999. Out-
break of Nipah virus infection among abattoir workers in Singapore. Lancet 354,
1253–1257.
Sanderson, C.M., Wu, H.H., Nayak, D.P., 1994. Sendai virus M protein binds indepen-
dently to either the F or the HN glycoprotein in vivo. J. Virol. 68, 69–76.
Schmitt, A.P., Lamb, R.A., 2004. Escaping from the cell: assembly and budding of
negative-strand RNA viruses. Curr. Top. Microbiol. Immunol. 283, 145–196.
Slabaugh, M.B., Davis, R.E., Roseman, N.A., Mathews, C.K., 1993. Vaccinia virus
ribonucleotide reductase expression and isolation of the recombinant large sub-
unit. J. Biol. Chem. 268, 17803–17810.
Stricker, R., Mottet, G., Roux, L., 1994. The Sendai virus matrix protein appears to be
recruited in the cytoplasm by the viral nucleocapsid to function in viral assembly
and budding. J. Gen. Virol. 75, 1031–1042.
Takimoto, T., Portner, A., 2004. Molecular mechanism of paramyxovirus budding.
Virus Res. 106, 133–145.
Tan, W.S., Ong, S.T., Eshagi, M., Foo, S.S., Yusoff, K., 2004. Solubility, immunogenicity
and physical properties of the nucleocapsid protein of Nipah virus produced in
Escherichia coli. J. Med. Virol. 73, 105–112.
Thomas, J.G., Baneyx, F., 1996. Protein misfolding and inclusion body formation in
recombinant Escherichia coli. J. Biol. Chem. 271, 11141–11147.
Yu, Q., Davis, P.J., Li, J., Cavanagh, D., 1992. Cloning and sequencing of the matrix
protein (M) gene of turkey rhinotracheitis virus reveal a gene order different
from that of Respiratory Syncytial Virus. Virology 186, 426–434.
Yusoff, K., Tan, W.S., 2001. Newcastle disease virus: macromolecules and opportu-
nities. Avian Pathology 30, 439–455.