MicroRNAs are small non-coding RNA molecules that regulate gene expression post-transcriptionally. They are involved in many biological processes. The document discusses microRNA biogenesis, classification, nomenclature, genomic organization, and roles in ovarian function and follicular development. It specifically examines how microRNA-424 and microRNA-503 are highly expressed in dominant follicles and predicted to target SMAD7 and ACVR2A, genes important for follicular growth. Experiments were designed to validate these targets using luciferase assays and overexpression/inhibition of the microRNAs in bovine granulosa cells.
MiRaGE: Inference of gene expression regulation via microRNA transfection IIY-h Taguchi
This document describes the MiRaGE method for inferring gene expression regulation via microRNA transfection. MiRaGE ranks microRNAs based on the expression levels of their predicted target genes after transfection. It compares target gene expression between control and treated samples and calculates significance values and false discovery rates. The method was tested on human lung cancer cells transfected with miR-107, miR-185, and let-7a, correctly identifying the transfected microRNAs as the top regulators after 1 and 3 days. A MiRaGE web server and database are now available to perform and collect miRNA regulation inferences.
MicroRNAs (miRNAs) are small non-coding RNA molecules involved in post-transcriptional gene silencing. They are 21-24 nucleotides long and regulate gene expression by binding to target mRNAs. The first miRNA, lin-4, was discovered in C. elegans in 1993. Currently over 24,000 miRNAs have been discovered across species. MiRNAs are important regulators of gene expression under stress conditions in plants. For example, miR399 is strongly induced during phosphate starvation and targets the PHO2 gene for downregulation.
Mir193b–365 is essential for brown fat differentiation by regulating genes involved in adipogenesis. The study identified Mir193b-365 as a microRNA complex necessary for brown adipose tissue differentiation. Blocking Mir193b expression inhibited brown fat marker genes, pointing to its critical role in brown fat development. Mir193b-365 associates closely with mRNAs like Prdm16 and Pparα that help upregulate it during differentiation, inducing adipogenic factors while suppressing myogenic factors.
- The document discusses the role of miRNAs in diabetes, focusing on miRNA-375. It states that miRNA-375 negatively regulates glucose stimulated insulin secretion and that inhibiting it leads to increased insulin secretion while overexpression leads to decreased secretion.
- It also mentions several other miRNAs - miR-9, miR-96, miR-124a - that regulate insulin secretion and discusses how their functions relate to diabetes. Additionally, it discusses how hyperglycemia and inflammatory cytokines influence miRNA expression and how specific miRNAs like miR-30d, miR-15a, and miR-335 impact insulin production and secretion.
- The role of miRNAs in insulin target tissues like the liver and heart is also covered, focusing on miR-122,
MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate gene expression. The document summarizes miRNA biogenesis, function, relevance to human health, and future directions for miRNA research. Specifically, it describes how miRNAs are transcribed from DNA and processed through several steps by protein complexes into mature miRNAs that bind to messenger RNAs to inhibit translation or promote degradation. Hundreds of miRNAs have been found in humans, and each may target hundreds of mRNAs. Dysregulation of miRNAs has been linked to diseases like cancer, heart disease, and neurological disorders. Continued research on miRNAs may reveal new insights into gene regulation and disease pathways.
MicroRNAs are small non-coding RNA molecules that regulate gene expression. The first miRNA, lin-4, was discovered in C. elegans in 1993. miRNAs are produced through a biogenesis pathway where they are processed from pri-miRNAs into pre-miRNAs and finally mature miRNAs that incorporate into the RNA-induced silencing complex and bind to target mRNAs to repress translation or promote degradation. Given their regulatory roles, miRNAs are a promising therapeutic target and several approaches are being explored to deliver miRNA mimics or inhibitors (antimiRs) to cells including various chemical modifications to oligonucleotides and viral/non-viral vectors. Several miRNAs such as miR-122, miR-155 and miR-21 are already in
The document provides an overview of microRNAs (miRNAs) and their roles in root development in plants. It defines miRNAs as 21-24 nucleotide non-coding RNAs that regulate gene expression through controlling transcription factors, stress response proteins, and developmental proteins. The biogenesis of miRNAs is described, from transcription of miRNA genes to processing by Dicer and incorporation into Argonaute complexes. Specific miRNAs, such as miR160, miR164, and miR167, are implicated in root cap formation, lateral root development, and adventitious rooting. The roles of miRNAs in symbiosis, taproot thickening, and responses to stresses like phosphate starvation are also summarized.
microRNA in Plant Defence and Pathogen Counter-defenceMahtab Rashid
The presentation is about the role of microRNA in plant defence and the pathogen counter-defences which they adopt to escape or evade the plant defence mechanism.
MiRaGE: Inference of gene expression regulation via microRNA transfection IIY-h Taguchi
This document describes the MiRaGE method for inferring gene expression regulation via microRNA transfection. MiRaGE ranks microRNAs based on the expression levels of their predicted target genes after transfection. It compares target gene expression between control and treated samples and calculates significance values and false discovery rates. The method was tested on human lung cancer cells transfected with miR-107, miR-185, and let-7a, correctly identifying the transfected microRNAs as the top regulators after 1 and 3 days. A MiRaGE web server and database are now available to perform and collect miRNA regulation inferences.
MicroRNAs (miRNAs) are small non-coding RNA molecules involved in post-transcriptional gene silencing. They are 21-24 nucleotides long and regulate gene expression by binding to target mRNAs. The first miRNA, lin-4, was discovered in C. elegans in 1993. Currently over 24,000 miRNAs have been discovered across species. MiRNAs are important regulators of gene expression under stress conditions in plants. For example, miR399 is strongly induced during phosphate starvation and targets the PHO2 gene for downregulation.
Mir193b–365 is essential for brown fat differentiation by regulating genes involved in adipogenesis. The study identified Mir193b-365 as a microRNA complex necessary for brown adipose tissue differentiation. Blocking Mir193b expression inhibited brown fat marker genes, pointing to its critical role in brown fat development. Mir193b-365 associates closely with mRNAs like Prdm16 and Pparα that help upregulate it during differentiation, inducing adipogenic factors while suppressing myogenic factors.
- The document discusses the role of miRNAs in diabetes, focusing on miRNA-375. It states that miRNA-375 negatively regulates glucose stimulated insulin secretion and that inhibiting it leads to increased insulin secretion while overexpression leads to decreased secretion.
- It also mentions several other miRNAs - miR-9, miR-96, miR-124a - that regulate insulin secretion and discusses how their functions relate to diabetes. Additionally, it discusses how hyperglycemia and inflammatory cytokines influence miRNA expression and how specific miRNAs like miR-30d, miR-15a, and miR-335 impact insulin production and secretion.
- The role of miRNAs in insulin target tissues like the liver and heart is also covered, focusing on miR-122,
MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate gene expression. The document summarizes miRNA biogenesis, function, relevance to human health, and future directions for miRNA research. Specifically, it describes how miRNAs are transcribed from DNA and processed through several steps by protein complexes into mature miRNAs that bind to messenger RNAs to inhibit translation or promote degradation. Hundreds of miRNAs have been found in humans, and each may target hundreds of mRNAs. Dysregulation of miRNAs has been linked to diseases like cancer, heart disease, and neurological disorders. Continued research on miRNAs may reveal new insights into gene regulation and disease pathways.
MicroRNAs are small non-coding RNA molecules that regulate gene expression. The first miRNA, lin-4, was discovered in C. elegans in 1993. miRNAs are produced through a biogenesis pathway where they are processed from pri-miRNAs into pre-miRNAs and finally mature miRNAs that incorporate into the RNA-induced silencing complex and bind to target mRNAs to repress translation or promote degradation. Given their regulatory roles, miRNAs are a promising therapeutic target and several approaches are being explored to deliver miRNA mimics or inhibitors (antimiRs) to cells including various chemical modifications to oligonucleotides and viral/non-viral vectors. Several miRNAs such as miR-122, miR-155 and miR-21 are already in
The document provides an overview of microRNAs (miRNAs) and their roles in root development in plants. It defines miRNAs as 21-24 nucleotide non-coding RNAs that regulate gene expression through controlling transcription factors, stress response proteins, and developmental proteins. The biogenesis of miRNAs is described, from transcription of miRNA genes to processing by Dicer and incorporation into Argonaute complexes. Specific miRNAs, such as miR160, miR164, and miR167, are implicated in root cap formation, lateral root development, and adventitious rooting. The roles of miRNAs in symbiosis, taproot thickening, and responses to stresses like phosphate starvation are also summarized.
microRNA in Plant Defence and Pathogen Counter-defenceMahtab Rashid
The presentation is about the role of microRNA in plant defence and the pathogen counter-defences which they adopt to escape or evade the plant defence mechanism.
This document summarizes the role of microRNAs (miRNAs) in host-virus interactions. It discusses that miRNAs are small non-coding RNAs encoded by both hosts and viruses that regulate gene expression. Viruses like herpesviruses encode miRNAs that can regulate viral latency, prevent apoptosis, evade the immune system, and alter the cell cycle. Cellular miRNAs can also impact viral replication by restricting or enhancing viruses. The applications of viral and cellular miRNAs include attenuated vaccines, oncolytic virotherapy, determining cell tropism, and antiviral drug development. While progress has been made, further research is still needed to fully understand viral and host miRNA functions in their complex interactions.
1. The study found that the protein Ago2 helps generate microRNAs like miR-451 by directly loading the immature hairpin form into Ago2, skipping the Dicer step of maturation.
2. Mice with inactive Ago2 suffered from anemia due to impaired maturation of miR-451, which protects red blood cells from oxidative stress.
3. Under oxidative stress, mice lacking miR-451 had profound anemia, showing that miR-451 plays an important protective role for red blood cells during times of stress.
Presentation on host virus interaction(2008432018)Jahed Ahmed
The presentation discusses the role of microRNAs (miRNAs) in host-virus interactions and their implications. Human miRNAs can target conserved regions in viral genes, while some viruses encode miRNAs that may influence cellular processes and lead to oncogenesis. Analysis of miRNA levels in humans may serve as molecular markers for disease susceptibility and prognosis. The development of artificial miRNAs could provide a therapeutic approach for modulating viral infections.
microRNA discovery and biomarker development in clinical samplesexiqon
The webinar discussed microRNA discovery and biomarker development in clinical samples using LNATM technology. It covered how LNATM probes can overcome challenges in analyzing microRNAs due to their short length and sequence variations. The webinar also presented a case study using LNATM PCR to detect microRNAs in blood plasma as potential biomarkers for early detection of colorectal cancer. Finally, it discussed challenges in normalizing microRNA qPCR data from serum/plasma samples.
DNA and RNA Structure
Central Dogma of Life
Protein Engineering (Brief)
Introduction to microRNA (miRNA)
History of miRNA
Biogenesis of miRNA
Conservation of miRNA
Impact of miRNA
miRNA Therapy
Conclusion
1) The document discusses microRNAs (miRNAs) and their role in cancer, including how they regulate key cellular processes and pathways involved in cancer development.
2) miRNAs are generally downregulated in cancer and can be deregulated through various mechanisms that allow cancer cells to escape miRNA-mediated repression.
3) The document explores using circulating miRNAs as biomarkers for cancer diagnosis and monitoring treatment response, though more research is still needed to understand their biological functions outside of cells.
microRNA for Clinical Research and Tumor AnalysisBioGenex
The discovery of microRNAs [miRNAs] has been one of the defining developments in cancer biology over the past decade. miRNAs are short, single stranded 20-22 nucleotide long, non-coding RNAs that regulate gene expression and have fundamental roles in Cancer growth and metastasis. miRNAs exert their function via base pairing with complementary mRNA molecules, resulting in gene silencing via transcriptional repression or target degradation. BioGenex solved the inherent difficulties in visualizing miRNAs in spatial context by using a propriety technology to synthesize modified, high-affinity oligonucleotides, labelling miRNA probes with multiple reporter molecules and developing a fully-integrated miRNA-ISH workflow solution allowing high throughput analysis of miRNA in the spatial context.
This document discusses microRNAs (miRNAs), which are small non-coding RNAs that regulate gene expression. It describes several strategies to inhibit oncogenic miRNAs that are overexpressed in tumors, including anti-miRNA oligonucleotides, miRNA antagomirs, and miRNA sponges. Lentiviral vectors derived from HIV-1 can be used to deliver short hairpin RNAs, miRNAs, or genes into cells. Several tumor suppressor miRNAs (miR-145, miR-34a, miR-29b, Let-7a, miR-340, miR495) and oncogenic miRNAs (miR155, miR-21) are described along with their gene targets and the results of in
2016 micro rna in control of gene expression an overview of nuclear functionsAntar
This document summarizes recent research on the nuclear functions of microRNAs (miRNAs). It discusses how miRNAs and miRNA-induced silencing complexes (miRISCs) can shuttle between the cytoplasm and nucleus. While miRNAs primarily regulate gene expression post-transcriptionally in the cytoplasm, growing evidence indicates they also have specific nuclear functions, particularly in transcriptionally controlling gene expression. However, the specific mechanisms by which miRNAs identify and target genes for transcriptional control in the nucleus are still being debated.
RNA is emerging as an important molecule for medical treatment. It has three main types - DNA, proteins, and RNA. Recent research has uncovered new functions of RNA, including small RNAs that can silence genes. This has led to over 4,300 publications and 200 clinical trials on microRNAs (miRNAs) and small interfering RNAs (siRNAs) in the past 8 years. Researchers are now working to develop RNA-based therapies and several startups have received large investments to pursue promising new treatments.
Mirna biogenesis, mechanism of action, isolation protocol, and quantification...SAIMA BARKI
The document discusses miRNA biogenesis, isolation, quantification, and applications. It describes how miRNAs are noncoding RNAs that regulate gene expression post-transcriptionally through imperfect base pairing. Several methods are discussed for isolating miRNAs from different sample types like plasma, urine, and cells using specific kits or a single optimized protocol. Quantitative PCR methods for miRNA quantification and their advantages are also summarized, including using stem-loop primers and S-poly(T) primers which provide accurate, specific and sensitive results. In conclusion, the choice of sample and isolation/quantification method depends on the research needs and available protocols/kits, and miRNAs have potential as novel diagnostic and therapeutic targets.
MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and affect multiple cellular processes. Dysregulation of miRNAs is common in cancer and can impact cancer hallmarks like sustained proliferation, evading growth suppression, resisting cell death, and activating invasion and metastasis. Certain miRNAs are considered oncogenes when their expression is increased in tumors, while others act as tumor suppressors when their expression is decreased. Altered miRNA expression and biogenesis machinery defects contribute to cancer development and progression. miRNAs also show potential as cancer biomarkers and therapeutic targets.
MicroRNAs (miRNAs) are small non-coding RNAs that play important gene regulatory roles in eukaryotic cells. They are approximately 22 nucleotides in length and are transcribed from independent genes or introns, then processed through a biogenesis pathway before targeting mRNAs for silencing or degradation. MiRNAs regulate genes involved in development, metabolism, and diseases like cancer. Their expression and function is tightly controlled through transcriptional and post-transcriptional mechanisms in order to influence protein expression levels. While much progress has been made in understanding miRNAs, further study is still needed to elucidate their complex regulatory networks and roles in development and disease.
The document discusses the importance of microRNAs and their role in various biological processes and diseases. It notes that microRNAs are involved in processes like cell cycle control, apoptosis, stem cell differentiation, and development. They also serve as diagnostic biomarkers for diseases like cancer and heart disease. Extracellular microRNAs can be transported between cells via exosomes, microvesicles, apoptotic bodies, and through binding to proteins. Dysregulation of microRNAs is related to several human diseases, including inherited diseases, cancer, heart disease, and kidney disease. MicroRNAs have potential roles as diagnostic markers, in influencing disease progression, and as targets for new treatment approaches.
This document discusses methods for detecting microRNAs (miRNAs) and recognizing their targets. It describes using random forests trained on structural features to identify novel miRNAs in Drosophila. Comparative genomics was also used to find conserved miRNAs. The document also examines how secondary structure at miRNA binding sites affects target recognition, and presents a model using free energy changes to predict targets based on site accessibility.
This document is an agenda for a webinar on profiling miRNA expression in cells, formalin-fixed paraffin-embedded (FFPE) tissue samples, and serum. The webinar will provide an introduction to miRNAs and disease, discuss sample preparation options for different sample types, and describe the miScript PCR System for profiling miRNA expression. The speaker, Jonathan Shaffer, will summarize the miScript PCR System and take questions at the end of the webinar.
miR-155 is a microRNA that plays an important role in regulating immune cell development and function. It is highly expressed in lymphocytes like B cells and T cells. miR-155 regulates lymphocyte immune responses by targeting various molecules and pathways. It controls B cell and T cell differentiation, antibody production, and cytokine secretion. Dysregulation of miR-155 has been implicated in several diseases like cancers and autoimmune disorders. Due to its role in diseases, miR-155 is a potential therapeutic target for developing new treatments.
The document discusses microRNAs (miRNAs) and their dysregulation in cancer. It summarizes a study that identified a miRNA signature associated with prognostic factors and disease progression in chronic lymphocytic leukemia (CLL) patients. The signature included upregulated miRNAs such as miR-15a, miR-16-1, and miR-155, and downregulated miRNAs such as miR-29b-2. Genetic variations were also found in miRNA genes of CLL patients.
This document provides information about microRNAs (miRNAs) and their applications. It begins with an introduction to miRNAs, including that they are small noncoding RNA molecules that regulate genes. It then discusses the history of miRNA discovery, including the first two miRNAs discovered: lin-4 and let-7. The document proceeds to explain the biogenesis of miRNAs in detail through multiple steps from transcription to incorporation into the RNA-induced silencing complex. It also discusses applications of miRNAs as biomarkers for various diseases and their role in cancer and diabetes.
1. miRNAs are small non-coding RNA molecules that regulate gene expression through base-pairing with mRNA.
2. The first miRNA, lin-4, was discovered in C. elegans in 1993. miRNAs are processed from hairpin pre-miRNAs by the enzymes Drosha and Dicer.
3. Mature miRNAs are incorporated into the RISC complex and silence genes by degrading or inhibiting the translation of mRNA.
This document summarizes the role of microRNAs (miRNAs) in host-virus interactions. It discusses that miRNAs are small non-coding RNAs encoded by both hosts and viruses that regulate gene expression. Viruses like herpesviruses encode miRNAs that can regulate viral latency, prevent apoptosis, evade the immune system, and alter the cell cycle. Cellular miRNAs can also impact viral replication by restricting or enhancing viruses. The applications of viral and cellular miRNAs include attenuated vaccines, oncolytic virotherapy, determining cell tropism, and antiviral drug development. While progress has been made, further research is still needed to fully understand viral and host miRNA functions in their complex interactions.
1. The study found that the protein Ago2 helps generate microRNAs like miR-451 by directly loading the immature hairpin form into Ago2, skipping the Dicer step of maturation.
2. Mice with inactive Ago2 suffered from anemia due to impaired maturation of miR-451, which protects red blood cells from oxidative stress.
3. Under oxidative stress, mice lacking miR-451 had profound anemia, showing that miR-451 plays an important protective role for red blood cells during times of stress.
Presentation on host virus interaction(2008432018)Jahed Ahmed
The presentation discusses the role of microRNAs (miRNAs) in host-virus interactions and their implications. Human miRNAs can target conserved regions in viral genes, while some viruses encode miRNAs that may influence cellular processes and lead to oncogenesis. Analysis of miRNA levels in humans may serve as molecular markers for disease susceptibility and prognosis. The development of artificial miRNAs could provide a therapeutic approach for modulating viral infections.
microRNA discovery and biomarker development in clinical samplesexiqon
The webinar discussed microRNA discovery and biomarker development in clinical samples using LNATM technology. It covered how LNATM probes can overcome challenges in analyzing microRNAs due to their short length and sequence variations. The webinar also presented a case study using LNATM PCR to detect microRNAs in blood plasma as potential biomarkers for early detection of colorectal cancer. Finally, it discussed challenges in normalizing microRNA qPCR data from serum/plasma samples.
DNA and RNA Structure
Central Dogma of Life
Protein Engineering (Brief)
Introduction to microRNA (miRNA)
History of miRNA
Biogenesis of miRNA
Conservation of miRNA
Impact of miRNA
miRNA Therapy
Conclusion
1) The document discusses microRNAs (miRNAs) and their role in cancer, including how they regulate key cellular processes and pathways involved in cancer development.
2) miRNAs are generally downregulated in cancer and can be deregulated through various mechanisms that allow cancer cells to escape miRNA-mediated repression.
3) The document explores using circulating miRNAs as biomarkers for cancer diagnosis and monitoring treatment response, though more research is still needed to understand their biological functions outside of cells.
microRNA for Clinical Research and Tumor AnalysisBioGenex
The discovery of microRNAs [miRNAs] has been one of the defining developments in cancer biology over the past decade. miRNAs are short, single stranded 20-22 nucleotide long, non-coding RNAs that regulate gene expression and have fundamental roles in Cancer growth and metastasis. miRNAs exert their function via base pairing with complementary mRNA molecules, resulting in gene silencing via transcriptional repression or target degradation. BioGenex solved the inherent difficulties in visualizing miRNAs in spatial context by using a propriety technology to synthesize modified, high-affinity oligonucleotides, labelling miRNA probes with multiple reporter molecules and developing a fully-integrated miRNA-ISH workflow solution allowing high throughput analysis of miRNA in the spatial context.
This document discusses microRNAs (miRNAs), which are small non-coding RNAs that regulate gene expression. It describes several strategies to inhibit oncogenic miRNAs that are overexpressed in tumors, including anti-miRNA oligonucleotides, miRNA antagomirs, and miRNA sponges. Lentiviral vectors derived from HIV-1 can be used to deliver short hairpin RNAs, miRNAs, or genes into cells. Several tumor suppressor miRNAs (miR-145, miR-34a, miR-29b, Let-7a, miR-340, miR495) and oncogenic miRNAs (miR155, miR-21) are described along with their gene targets and the results of in
2016 micro rna in control of gene expression an overview of nuclear functionsAntar
This document summarizes recent research on the nuclear functions of microRNAs (miRNAs). It discusses how miRNAs and miRNA-induced silencing complexes (miRISCs) can shuttle between the cytoplasm and nucleus. While miRNAs primarily regulate gene expression post-transcriptionally in the cytoplasm, growing evidence indicates they also have specific nuclear functions, particularly in transcriptionally controlling gene expression. However, the specific mechanisms by which miRNAs identify and target genes for transcriptional control in the nucleus are still being debated.
RNA is emerging as an important molecule for medical treatment. It has three main types - DNA, proteins, and RNA. Recent research has uncovered new functions of RNA, including small RNAs that can silence genes. This has led to over 4,300 publications and 200 clinical trials on microRNAs (miRNAs) and small interfering RNAs (siRNAs) in the past 8 years. Researchers are now working to develop RNA-based therapies and several startups have received large investments to pursue promising new treatments.
Mirna biogenesis, mechanism of action, isolation protocol, and quantification...SAIMA BARKI
The document discusses miRNA biogenesis, isolation, quantification, and applications. It describes how miRNAs are noncoding RNAs that regulate gene expression post-transcriptionally through imperfect base pairing. Several methods are discussed for isolating miRNAs from different sample types like plasma, urine, and cells using specific kits or a single optimized protocol. Quantitative PCR methods for miRNA quantification and their advantages are also summarized, including using stem-loop primers and S-poly(T) primers which provide accurate, specific and sensitive results. In conclusion, the choice of sample and isolation/quantification method depends on the research needs and available protocols/kits, and miRNAs have potential as novel diagnostic and therapeutic targets.
MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and affect multiple cellular processes. Dysregulation of miRNAs is common in cancer and can impact cancer hallmarks like sustained proliferation, evading growth suppression, resisting cell death, and activating invasion and metastasis. Certain miRNAs are considered oncogenes when their expression is increased in tumors, while others act as tumor suppressors when their expression is decreased. Altered miRNA expression and biogenesis machinery defects contribute to cancer development and progression. miRNAs also show potential as cancer biomarkers and therapeutic targets.
MicroRNAs (miRNAs) are small non-coding RNAs that play important gene regulatory roles in eukaryotic cells. They are approximately 22 nucleotides in length and are transcribed from independent genes or introns, then processed through a biogenesis pathway before targeting mRNAs for silencing or degradation. MiRNAs regulate genes involved in development, metabolism, and diseases like cancer. Their expression and function is tightly controlled through transcriptional and post-transcriptional mechanisms in order to influence protein expression levels. While much progress has been made in understanding miRNAs, further study is still needed to elucidate their complex regulatory networks and roles in development and disease.
The document discusses the importance of microRNAs and their role in various biological processes and diseases. It notes that microRNAs are involved in processes like cell cycle control, apoptosis, stem cell differentiation, and development. They also serve as diagnostic biomarkers for diseases like cancer and heart disease. Extracellular microRNAs can be transported between cells via exosomes, microvesicles, apoptotic bodies, and through binding to proteins. Dysregulation of microRNAs is related to several human diseases, including inherited diseases, cancer, heart disease, and kidney disease. MicroRNAs have potential roles as diagnostic markers, in influencing disease progression, and as targets for new treatment approaches.
This document discusses methods for detecting microRNAs (miRNAs) and recognizing their targets. It describes using random forests trained on structural features to identify novel miRNAs in Drosophila. Comparative genomics was also used to find conserved miRNAs. The document also examines how secondary structure at miRNA binding sites affects target recognition, and presents a model using free energy changes to predict targets based on site accessibility.
This document is an agenda for a webinar on profiling miRNA expression in cells, formalin-fixed paraffin-embedded (FFPE) tissue samples, and serum. The webinar will provide an introduction to miRNAs and disease, discuss sample preparation options for different sample types, and describe the miScript PCR System for profiling miRNA expression. The speaker, Jonathan Shaffer, will summarize the miScript PCR System and take questions at the end of the webinar.
miR-155 is a microRNA that plays an important role in regulating immune cell development and function. It is highly expressed in lymphocytes like B cells and T cells. miR-155 regulates lymphocyte immune responses by targeting various molecules and pathways. It controls B cell and T cell differentiation, antibody production, and cytokine secretion. Dysregulation of miR-155 has been implicated in several diseases like cancers and autoimmune disorders. Due to its role in diseases, miR-155 is a potential therapeutic target for developing new treatments.
The document discusses microRNAs (miRNAs) and their dysregulation in cancer. It summarizes a study that identified a miRNA signature associated with prognostic factors and disease progression in chronic lymphocytic leukemia (CLL) patients. The signature included upregulated miRNAs such as miR-15a, miR-16-1, and miR-155, and downregulated miRNAs such as miR-29b-2. Genetic variations were also found in miRNA genes of CLL patients.
This document provides information about microRNAs (miRNAs) and their applications. It begins with an introduction to miRNAs, including that they are small noncoding RNA molecules that regulate genes. It then discusses the history of miRNA discovery, including the first two miRNAs discovered: lin-4 and let-7. The document proceeds to explain the biogenesis of miRNAs in detail through multiple steps from transcription to incorporation into the RNA-induced silencing complex. It also discusses applications of miRNAs as biomarkers for various diseases and their role in cancer and diabetes.
1. miRNAs are small non-coding RNA molecules that regulate gene expression through base-pairing with mRNA.
2. The first miRNA, lin-4, was discovered in C. elegans in 1993. miRNAs are processed from hairpin pre-miRNAs by the enzymes Drosha and Dicer.
3. Mature miRNAs are incorporated into the RISC complex and silence genes by degrading or inhibiting the translation of mRNA.
MicroRNAs are small non-coding RNAs that regulate gene expression. They were first discovered in 1993 in C. elegans. Since then, thousands have been identified in humans. MicroRNAs play roles in many diseases including cancer, where they can act as oncogenes or tumor suppressors. They have also been linked to other diseases like cardiovascular disease and neurodegenerative disorders. Circulating microRNAs in blood plasma/serum show potential as non-invasive biomarkers for diseases since they are stable in microparticles and exosomes and can be easily detected using sensitive PCR methods.
This document provides an overview of microRNAs (miRNAs) in insects. It discusses the biogenesis and evolution of miRNAs, and provides several case studies examining the roles of specific miRNAs in regulating development and physiology in various insect species. Some key points covered include how plant miRNAs in larval food can regulate caste development in honey bees, the differential expression of miRNA pathway genes during development in Helicoverpa armigera, and studies on the effects of depleting particular miRNAs in Drosophila and Blattella germanica. The document concludes with a discussion of the roles of miRNAs in insect development, physiology and evolution.
- MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression through base pairing with messenger RNA (mRNA) molecules. They are encoded in the genome and are abundant in many human cell types.
- miRNAs play a vital role in genetic regulation and are involved in most biological processes. Aberrant miRNA expression has been implicated in many diseases.
- miRNAs are initially transcribed as long primary transcripts that are processed in the nucleus by the Drosha enzyme into hairpin-shaped precursor miRNAs. These are then exported into the cytoplasm and further processed by the Dicer enzyme into mature miRNAs that can regulate gene expression through pairing with mRNAs.
This document discusses microRNAs (miRNAs), which are 22 nucleotide non-coding RNAs that play important regulatory roles in plants. miRNAs are processed from stem-loop precursors by the enzyme Dicer and mediate post-transcriptional gene silencing by guiding mRNA cleavage or translational repression. Bioinformatic and genetic studies have identified many conserved miRNA families in plants and shown that miRNAs regulate key transcription factors to control developmental processes.
MicroRNAs are small non-coding RNAs that are transcribed from DNA and processed through several steps to regulate gene expression. They are first transcribed into primary miRNAs which are then cleaved into precursor miRNAs in the nucleus by the Drosha complex. The pre-miRNAs are exported from the nucleus and further cleaved by the Dicer complex into mature miRNA duplexes. One strand of the duplex is incorporated into the RISC complex which uses the miRNA to regulate mRNAs through degradation or translational repression. Dysregulation of miRNA expression has been shown to contribute to cancer development by altering the expression of oncogenes and tumor suppressor genes.
This document discusses microRNAs (miRNAs), which are small non-coding RNA molecules that regulate gene expression. It provides a brief history of miRNA discovery and defines miRNAs and how they differ from siRNAs. The document highlights that miRNAs are encoded in genomes and bind to mRNAs to repress translation or promote degradation. It notes miRNAs play key roles in processes like cell differentiation and growth. The document also summarizes some of the main functions of miRNAs in controlling gene expression and development.
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Computational analysis on microRNA in malariaGregorio Rangel
This document discusses predicting host microRNAs (miRNAs) that modulate genes associated with malaria pathogenesis as potential biomarkers. It describes using bioinformatics tools miRanda and TargetScan to predict miRNAs that regulate genes related to severe malaria (CD36, IFN-γ, TLR4, PRR15). The results showed several miRNAs predicted to regulate these genes, including miR-203a-3p.1, miR-146, miR-155-5p, which may serve as biomarkers for disease progression. The document concludes that further study of circulating miRNAs associated with significant host genes is needed.
Prediction of mi rna that modulate significant host response genes as potenti...Gregorio Rangel
This document describes a study that aimed to predict microRNAs (miRNAs) that modulate host response genes associated with cerebral malaria pathogenesis. The study used bioinformatics tools TargetScan and miRanda to predict interactions between host genes CD36, IFN-γ, TLR4, and PRR15 with miRNAs. The tools identified several miRNAs, including miR-146, miR-155-5p and miR-203a-3p, that could regulate the host genes and have potential as biomarkers for severe malaria and cerebral malaria. Further investigation of circulating miRNAs associated with these host response genes is needed.
This document describes a webinar on meeting the challenges of microRNA (miRNA) research. The webinar is part of a three-part series on miRNAs and their role in human disease. Webinar 1 focuses on an introduction to miRNA biogenesis, function, and analysis, and is presented by Jonathan Shaffer from QIAGEN. The webinar agenda covers topics on miRNA background, genomics, involvement in disease, isolation technologies, quantification technologies, profiling technologies, and functionalization technologies.
This document describes a study that identified microRNAs (miRNAs) in paprika (Capsicum annuum) through analysis of expressed sequence tags (ESTs). The researchers obtained 33,311 paprika ESTs from databases, removed redundancy, and used bioinformatics tools to predict 85 miRNAs. Thirteen of these miRNAs showed similarity to known plant miRNAs. Most predicted miRNAs targeted genes involved in plant growth, development, and environmental stress responses. The study provides evidence that miRNAs are conserved across plants and play important roles in paprika development and stress response.
This document summarizes the inter-regulatory role of microRNAs (miRNAs) in the interaction between viruses and stem cells. It discusses how miRNAs are involved in key biological processes like development and stem cell maintenance. Viruses also encode their own miRNAs that regulate viral and host gene expression. The document reviews how viral miRNAs are identified and their functions. It explores how miRNAs control stem cell properties like self-renewal and differentiation. The interplay between viral and cellular miRNAs during infection is also examined.
MicroRNAs, in common, play the similar roles as transcription factors by specifically binding the seed sequence within 3’UTR of target genes, by activating their degradation or inhibiting their translation of the target genes mRNAs or inhibit their translation, which result in variety of cell activities changing at different levels.
https://www.creative-biogene.com/Product/miRNA-Clones.html
MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression in eukaryotes by binding to messenger RNA (mRNA) transcripts. MiRNAs undergo a complex biogenesis process, where they are processed from pri-miRNA to pre-miRNA and finally to a mature miRNA incorporated into an RNA-induced silencing complex (RISC). As part of RISC, miRNAs guide mRNA cleavage or translational repression of target genes by binding to partially complementary sites. This miRNA-mediated gene silencing plays important roles in diverse biological processes such as development, differentiation, and metabolism.
Inference of gene expression regulation by miRNA using MiRaGE methodY-h Taguchi
This document describes a method called MiRaGE for inferring gene expression regulation by miRNAs. It discusses three applications of the MiRaGE method: 1) Inferring transfection of miRNAs into human lung cancer cells, 2) Inferring gene regulation via miRNA in murine medulloblastoma, and 3) Identifying critical miRNAs for embryonic stem cell differentiation into neuronal cells. For each application, the document outlines the experimental materials and methods used, such as transfection of specific miRNAs, gene expression profiling via microarray, and comparing expression of miRNA target genes. The results show that MiRaGE successfully identifies biologically important miRNAs regulating gene expression in different cellular contexts.
Inference of gene expression regulation by miRNA using MiRaGE methodY-h Taguchi
The document describes a method called MiRaGE for inferring gene expression regulation by miRNA. It discusses three applications of the MiRaGE method: 1) Inferring transfection of miRNAs into human lung cancer cells, 2) Inferring gene regulation via miRNA in murine medulloblastoma, and 3) Identifying critical miRNAs for maintaining embryonic stem cell stemness during differentiation into neuronal cells. The MiRaGE method combines miRNA expression profiling with prediction of miRNA target genes to generate rankings of miRNAs likely to be regulating gene expression in each biological system analyzed.
This document discusses cervical cancer, its causes, symptoms, diagnosis, and treatment. Some key points:
- Cervical cancer is the fourth most common cancer in women worldwide and is caused by human papillomavirus (HPV) infection in over 90% of cases.
- Other risk factors include multiple sexual partners, young age of first intercourse, smoking, and a weakened immune system.
- Symptoms can include abnormal bleeding or discharge. Diagnosis involves exams, Pap tests, HPV tests, biopsies and assessing the cancer stage.
- Cervical cancer is typically treated through surgery, radiation therapy, chemotherapy, or a combination depending on the cancer stage and grade. Vaccines can
Analysis of gene expression regulation by miRNA using MiRaGE methodY-h Taguchi
The document analyzes gene expression regulation using the MiRaGE method. It discusses three topics: 1) Inferring transfection of miRNAs into human lung cancer cells, finding the transfected miRNAs are correctly identified. 2) Inferring gene regulation via miRNA in murine medulloblastoma, finding miR-17~92 cluster members are highly ranked. 3) Identifying critical miRNAs for mouse ES stemness during differentiation to neuronal cells, finding miR-200b/c are highly expressed in ES cells.
Similar to miRNAs endogenous regulator of gene expression (20)
Record keeping in dairy farm management.pdfHari Om Pandey
Presentation tries to explain role of record keeping in sound planning of breeding, feeding and heeding and health management of dairy farm
in order to efficiently and effectively manage growth, production and reproduction. It assists in livestock management decisions and evaluates overall activities of the dairy farm.
Livestock farm Data Acquisition-Processing and management ..pdfHari Om Pandey
Livestock data acquisition essentially used in Smart Farming where a large amount of connected technologies produces a huge amount of data in order to maximize productions by reducing: human efforts, environment impact and wasting natural resources. It helps in improving livestock production, animals’ welfare, and farming processes, allowing to ease monitoring operations that can help farmers.
Neuro-endocrine basis of Behavioural Disorders in Farm AnimalsHari Om Pandey
1. The document discusses the neuroendocrine basis of behavioural disorders in farm animals. It explores how behaviours are influenced by both innate and acquired factors, as well as hormones and stress.
2. Specific behavioural disorders that are mentioned include stereotypic disorders, aggression, anxiety disorders, and eating disorders. Stereotypies can involve repetitive motions with no function.
3. Factors like genetics, environment, hormones, and stress are discussed in influencing the development of behavioural disorders. The hypothalamic-pituitary-adrenal axis is particularly important in the stress response.
The document discusses livestock farming zones and production systems in India. It divides India into 15 agro-climatic zones based on factors like climate and cropping patterns. The major zones discussed are tropical, temperate, dry northern, northeastern, southern, coastal, and those in extreme climates. It provides details on the dominant livestock species, feed and fodder situation, and livestock products in each zone. The document also categorizes livestock production systems in India into solely livestock systems and mixed farming systems.
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
1. MicroRNAs: endogenous regulators of gene
expression
Hari Om Pandey
hariomvet@gmail.com
ICAR-IVRI, IZATNAGAR, UTTAR PRADESH, INDIA
2. miRNAs as post-transcriptional regulator of
genes
Involved in a range of
biological functions
Regulate genes by
targeting at 3´
untranslated region
Regulates around 30 %
of all protein coding
genes
miRNAs
miRNAs: MicroRNAs
nts: Nucleotides
1Ambros 2004; 2Bartel 2004; 3Lim et al. 2003; 4Rajewsky 2006
Small, 20-22 nts, single stranded, non coding and endogenous1,2
1, 2
2
3, 4
4. miRNAs are encoded by the host
genome, whereas siRNAs in most
cases originate from outer source
siRNA is most commonly a
response to foreign RNA (usually
viral) and is often 100%
complementary to the target
miRNA regulates post-
transcriptional gene expression and
is often not 100% complementary to
the target
siRNA vs miRNA
5. The first described microRNA, lin-4 was characterised as a
translational repressor of developmental timing from
Caenorhabditis elegans that was involved in silencing of
another gene, lin-14, at appropriate time in the development of
the worm (Lee et al. 1993 and Wightman et al. 1993)
The transcript of this gene was highly unusual as it was non-
coding, and produced extremely small transcripts (22nt) from
hairpin structured RNA precursors
Second microRNA, let-7 was also cloned from C. elegans
(Reinhart et al, 2000)
MicroRNAs
6. Very little is known about functional role of miRNAs
Total 38589 mature miRNAs are known in 271 species
Species Mature miRNA Precursor
miRNA
Human (Homo sapiens) 2654 1917
Bovine (Bos taurus) 1025 1064
Goat (Capra hircus) 436 267
Sheep (Ovis aries) 153 106
Pig (Sus scrofa) 457 408
There is a major challenge to decipher the functional role of
miRNAs in bio-physiology
http://www.mirbase.org/ Pandey et al. 2018
7. Nomenclature of miRNA
The nomenclature guidelines require that novel miRNA
genes should be experimentally verified by cloning or
with evidence of expression and processing
hsa-mir-20a
The “hsa” tells us it is a human miRNA
The “20″ tells us that was discovered early — it’s only
the 20th family that was named
“20b” tells us that it is related to another miRNA that we
can guess is probably called hsa-mir-20a
8. Nomenclature of miRNA
The mature sequences are designated ‘miR’ in the
database, whereas the precursor hairpins are labelled
‘mir’
Paralogous sequences - mature miRNAs differ at only
one or two positions are given lettered suffixes—for
example, mmu-miR-10a and mmu-miR-10b
9. Nomenclature of miRNA
hsa-mir-17; it has two mature products, named hsa-miR-
17 and hsa-miR-17*
In this case miR-17 arises from the 5′ arm of the mir-17
hairpin, and miR-17* arises from the 3′ arm
The ‘*’ tells us that miR-17* is considered a ‘minor’
product
Such mature sequences are currently named of the form
miR-17-5p (5′ arm) and miR-17-3p (3′ arm)
10. miRBase
The miRBase database is a searchable database of published
miRNA sequences and annotation
All sequence and annotation data are available for download
The miRBase Registry provides miRNA gene hunters with
unique names for novel miRNA genes prior to publication of
results
To date, Release 22 of the database contains 38589 entries
representing hairpin precursor miRNAs, expressing 48885
mature miRNA products, in 271 species
(http://www.mirbase.org/)
12. Genomic context of miRNAs
The majority of miRNAs are located in intergenic regions,
while few corresponds to intronic regions
Approximately half of all known miRNAs are found in
close proximity to other miRNAs, clustered miRNAs,
and are expressed as poly-cistronic primary transcripts
Whereas some miRNAs can be transcribed from their
own promoter as mono-cistronic primary transcripts
14. miRNAs in ovarian function
1Bernstein et al. 2003; 2 Zhang et al. 2014; 3Hossain et al. 2009
Dicer1 knockout
mice
Embryonic lethal1
Dicer is one of key enzyme used in miRNA biogenesis
miRNAs are implicated in primordial follicle formation2
Expression profilling and next generation sequencing have
identified the spatiotemporal expression of miRNAs in ovarian
tissue3
Function of miRNAs in Animals
15. Roe of miRNA in follicular growth and development
The initiation of primordial follicle development is essential to
achieve successful reproduction in mammalian females
miR-145 by targeting TGFBR2 regulated the initiation of
primordial follicle development and maintains primordial follicle
quiescence, whereas down-regulation of miR-145 using an
antagomir (AT) decreased primordial follicles and increased
number of the growing follicles by increasing TGFBR2
expression and activation of SMAD signalling (Yang et al. 2013)
In another study miR-376a was found to be negatively correlated
with PCNA mRNA expression by directly binding to the 3’UTR of
PCNA in fetal and neonatal mouse
16. miRNA in steroidogenesis
miR-17-92 cluster increased the progesterone level in the spent
media of obtained from bovine granulosa cell culture (Andreas et al.
2016)
Overexpression of miR-378 decreased ovarian estradiol production
by post-transcriptionally regulating aromatase whereas
overexpression of the aromatase 3'-UTR enhanced aromatase
expression (Xu et al. 2011)
miR-133b was involved in follicle-stimulating hormone (FSH)-
induced estrogen production by inhibiting the Foxl2-mediated
transcriptional repression of STAR and CYP19A1 to promote
estradiol production (Dai et al. 2013)
These miRNAs could be potential miRNA to further study the
disorders of granulosa cells in relation to steroidogenic capacity
17. The roles of miRNAs in oocyte maturation, identification
and characterization of miRNA populations were done in
pools of bovine germinal vesicle (GV) oocytes,
metaphase II (MII) oocytes, and presumptive zygotes
(PZ); pri-miR-155 was present in MII oocytes, indicating
transcription during maturation; however, levels of pri-let-
7d decreased during maturation (Gilchrist et al. 2016)
Changes in miRNAs expression were observed in the
cumulus cells matured with or without the oocyte
cytoplasm (Abd El Naby, W S et al. 2013)
MicroRNAs in regulation of cumulus-oocyte
communication and oocyte maturation
18. Identification of important protein involved in miRNA
biogenesis in villous of trophoblast such as Drosha,
Exportin 5 Argonaute 2 (Ago2), DP103, and miR-378a-5p,
miR-376c and miR-141 implicated in promoting
proliferation, migration and invasion of trophoblast cells
(Tefaye et al. 2016)
Placenta specific miRNAs, the C19MC, miR-371-3 and the
C14MC clusters are found to be pregnancy-associated
miRNAs during placental development and
pregnancy establishment
19. Expression profiling was done in bovine endometrium affected
by subclinical or clinical endometritis
Several miRNAs including let-7 family members were
dysregulated in animals affected by subclinical endometritis,
while 35 miRNAs including let-7e, let-7f, miR1265 and miR-608
were altered in animals with clinical endometritis
Both clinical and subclinical endometritis were found to show
dysregulation of the let-7 family members which are known to
regulate genes involved in various developmental processes and
immune mechanisms by regulating the expression of cytokines
such as TLR4, IL6, IL13, IL10 associated with host - immune
functions (Salilew-Wondim et al. 2016)
MicroRNAs in uterine infection
20. MiRNA expression in bovine granulosa cells
miRNA enriched Total RNA
Granulosa cells
SF (n=43)
(n= 6)
DF (n=9)
Day 3
Granulosa cells
SF (n=58) DF (n=3)
(n= 7)
Day 7
Granulosa cells
Day 19
SF (n=76) PDF (n=5)
(n= 7)
miRNA expression profiling using NGS
21. Role of miRNA in follicular growth and developement
(Gebremdhn et al. 2015; Reviewed in Tesfaye et al. 2018 Reproduction) 9
miRNA-424/503 cluster members were highly enriched in bovine
granulosa cells of preovulatory dominant follicle at day 19 of
estrous cycle compared to their subordinate counterpart1
MiRNA-424: bta-microRNA-424-5p
MiRNA-503: bta-microRNA-503-5p
miR-183-96-182
miR-132-212
miR-20a-92a
miR-23a-27a-24
miR-222-221
miR-214-199a
miR-424-503-450a
miR-665-127
miR-452-224-3431
1, 2
22. Experimental strategies
1. MicroRNA target gene validation using luciferase assay
2. Overexpression of miRNAs using miRNA mimics
3. Inhibiton of miRNAs activity using miRNA inhibitors
4. Knockdown of the target genes using siRNAs
miRNA: MicroRNA
siRNA: Small interfering RNA
23. Genomic context of miRNA-424/503 cluster members
miRNA Accession no. Sequence
bta-miR-424-5p MIMAT0013593 CAGCAGCAAUUCAUGUUUUGA
bta-miR-503-5p MIMAT0025557 UAGCAGCGGGAACAGUACUG
https://www.ncbi.nlm.nih.gov/nuccore/563320293
http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0022315
MiRNA-424: bta-microRNA-424-5p
MiRNA-503: bta-microRNA-503-5p
miR-424 and miR-503 are evolutionary conserved among mammals
miRNA Genomic position
bta-mir-424 chrX:18185439-18185534[-]
bta-mir-503 chrX:18185095-18185177[-]
25. Target gene mRNA-miRNA binding sites
ACVR2A: Activin receptor type II A
SMAD7: Mothers against decapentaplegic homolog family 7
miRNAs
SMAD7 and ACVR2A were identified as potential putative targets for
miR-424/503 cluster members
Pandey et al. 2018
26. Wild type and mutant plasmid vector construction
Wild type SMAD7 3´ UTR
Mutant SMAD7 3 ´ UTR
Wild type ACVR2A 3´ UTR
Mutant ACVR2A 3´ UTR
Pandey et al. 2018
27. Generation of target
fragment
Cell lysate
Measured luciferase
activity
Wild type SMAD7
Cloning into pmirGLO
vector
Plasmid isolation
Mutant Wild type ACVR2A Mutant
Plasmid co-transfection
with miR-424 mimic
miR-503 mimic or
mimic NC into bGCs
bGCs: bovine granulosa cells; NC: Negative control
Target gene validation using luciferase assay
29. Overexpression of miRNA-424/503 cluster members
enhanced granulosa cell proliferation
Mean ± SEM; **p<0.01; ***p<0.001
PCNA: Proliferating cell nuclear antigen
PCNA
Granulosa cell proliferation is necessary for follicular growth and
creation of unique micro-environment for oocyte maturation (Maruo
1995)
Cell proliferation assay
PCNA
β -ACTIN
mimic inhibitor
Pandey et al. 2018
30. Functional analysis of miR-424/503 cluster members in
granulosa cells
Bovine granulosa cells were
collected from Ø 3-5 mm
follicles
Cultured in DMEM/F12
supplemented with 10% FBS
Sub-confluent bovine granulosa cells
were transfected
Harvested 48 h post-transfection
DMEM/F12:Dulbecco's modified eagle's medium/nutrient F12 Ham
FBS: Fetal bovine serum
mR-424 mimic mR-503 mimic Inhibitor NC
Mimic NC
miR-424
Inhibitor
miR-503
Inhibitor
Cell proliferation
assay
Gene expression
SMAD7, ACVR2A,
PCNA and STAR
Protein analysis
SMAD7, ACVR2A,
PCNA and STAR
Cell cycle analysis
31. NC siRNA SMAD7 siRNA NC siRNA ACVR2A siRNA
Knockdown of miR-424/503 cluster members target genes
using siRNA
Bovine granulosa cells were
collected from Ø 3-5 mm
follicles
Cultured in DMEM/F12 HAM
supplemented with 10% FBS
Sub-confluent bovine granulosa cells
transfected with
Harvested 48 h post-transfection
Gene expression
SMAD7, ACVR2A,
PCNA and STAR
Protein expression
SMAD7, ACVR2A and
PCNA
Cell proliferation
assay
Cell cell cycle analysis
32.
33.
34. Knockdown of SMAD7 enhanced granulosa cell
proliferation
SMAD7 siRNA
Cell proliferation
assay
Mean ± SEM; *p<0.05; **p<0.01
Pandey et al. 2018
35. Expression pattern of miR-424 in cumulus cell and oocyte
during in vitro oocyte maturation
In vitro maturation
39 °C for 22 h, 5% CO2
miR-424 expression
analysis
COCs: Cumulus-oocyte complexes
GV: Germinal vesicle, MII: Metaphase II
COCs collection from Ø 2-8
mm follicle
Cumulus
cells
Oocytes
Cumulus cell-oocyte
separation
1% hyaluronidase
GV stage
COCs
MII stage COCs
Oocytes
Expanded
cumulus
cells
Pandey et al. 2018
36. miR-424 expression is increased in cumulus cells and oocytes
during in vitro maturation
GV: Germinal vesicle
MII: Metaphase II
Mean ± SEM; ***p<0.001
The miR-424 expression is increased from GV
to MII stage in both cumulus cells and oocytes
Pandey et al. 2018
37. Future Perspective
Potential biomolecule, which could be utilized as
therapeutic and diagnostic molecules
Indeed the misregulation of several miRNAs has already
been linked to the development of several disease
‘miRNA replacement therapy,’ which involves introducing
synthetic miRNAs or miRNA mimic into diseased tissues
This again comes with various other challenges such as drug
delivery to the right organs or tissues and choosing the
appropriate technology to modulate the miRNA expression
Editor's Notes
From the wide range of noncoding RNA species,
miRNAs have drawn the attention of researchers in various fields including development and disease due to potential role they play in regulating those physiological conditions.
Specially the potential miRNAs as biomarkers of various human diseases and also their potential as therapeutic tools has fueled up the efforts being done to understand the role of miRNAs in various traits of interest.
Moreover, miRNAs are one of the research focus of the Institute of Animal Sciences and my presenstation will emphasize on the role of microRNA in bovine follicular development
erest.