Final year project

i | P a g e A n d r e a s P a n a y i
Table of Contents
Page
Abstract 1
1. Introduction 2
1.1 Staphylococcus aureus 2
1.2 Methicillin Resistant Staphylococcus aureus 2
1.3 Bacteriophages 3
2. Methods 4
2.1 Induction of the Phage 4
2.2 Bacterial DNA preparation and extraction 5
2.2.1 Preparation of working solutions 5
2.2.2 Lysis and DNA binding of MRSA 252 mutations and wild type 5
2.2.3 Washing and Elution of the DNA of MRSA 252 6
2.3 Prophage Screening 6
2.4 Bacteriophage Isolation 8
2.5 Spot tests on MRSA 252 host mutants and wild type 9
3. Results 10
3.1 Mutant MRSA 252 strain 10
3.2 Prophage Screening 10
3.3 Susceptibility of MRSA 252 host mutants to phage infection 13
4. Discussion 16
4.1 Virulence factors of MRSA 252 16
4.2 Induction and Screening of the Prophages 17
4.3 Spot assay of the mutant MRSA 252 strains with phages 18
5. Conclusion 19
6. References 19

ii | P a g e A n d r e a s P a n a y i
Index of Tables and Figures
Tables Pages
Table 1 - Quantity of contents added in each PCR tube (25μl) and in the 7
Master Mix (Primers concentration: 10μΜ)
Table 1.1 - Bromophenol blue and ficoll 400 mixed to make a loading 8
buffer for the agarose gel electrophoresis
Table 1.2 - Distribution of the phages on each MRSA 252 (wild type 9
and mutant strain) overlay agar plate from the spot assay.
Table 2 - 31 MRSA 252 mutants along with the MRSA 252 wild 15
type were spotted with 16 different phages in normal dilutions and
in 1:1000 dilutions of the phages.
Figures
Figure 1 - Overnight cultures of dilutions (1:104 and 1:105) of MRSA 252 10
wild type inoculated with Mitomycin C that were spread on Tryptic Soya
Agar (TSA). Mutant MRSA 252 strains grew overnight, were distinguished
from there difference in size.
Figure 1.1 - Agarose gel electrophoresis (0.5% agarose gel) of a DNA 11
ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal DNA of
MRSA 252 wild type and 31 mutations of MRSA 252.
ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal DNA of
MRSA 252 wild type, 31 mutations of MRSA 252 and negative control
screened against ΦSa2.
ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal DNA
of MRSA 252 wild type, 31 mutations of MRSA 252 and negative control
screened against ΦSa3.
Figure 1.4 – Agarose gel electrophoresis (0.5% agarose gel) of a DNA 13
ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal DNA
of MRSA 252 wild type, mutations 7 and 8 of the MRSA 252 and a
negative control screened for EAP gene.
Figure 1.5 - Spot tests of the MRSA 252 mutation 14 with 16 14
(1:1000 dilution) different phages
Figure 2 - Schematic circular diagrams of the MRSA252 chromosome 16

1| P a g e A n d r e a s P a n a y i
Abstract
Staphylococcus aureus is a pathogen that can infect the general public and the
patients in hospitals with a suppressed immune system. This strain had become
resistant to certain antibiotics due to its mobile genetic elements, such as phages
and pathogenicity islands. The mobile genetic elements have given the ability to
new strains of S. aureus to emerge via horizontal gene transfer of their virulence
genes by insertion sequences, plasmids, phages and transposons. The methicillin-
resistant S. aureus 252 (MRSA 252) belongs to the EMRSA-16 clone. The resistance
of the MRSA 252 to methicillin is due to the SCCmec chromosome which contains
the mecA gene and mobile elements that carry virulence and drug-resistant
determinants. The ΦSa2 and ΦSa3 are the two 43 kb bacteriophages that are
present in the MRSA 252 strain. These two phages belong to the Siphoviruses
category. ΦSa2 and ΦSa3 can be mobilized and transferred to other strains and
can also carry the stimulation and the transfer of the genomic islands along with
the chromosomal markers. These temperate phages can be characterized based on
their lytic activity, their serological properties and their morphology and can also
be screened with the use of Multiplex PCR. Lytic bacteriophages can be used for
the treatment of antibiotic resistant strains and they can be acquired by induction
of the bacteriophage and transform it from its lysogenic state to its lytic state with
the use of a DNA damaging agent called mitomycin C.
Aims: To construct a ‘safe’ host strain that will be prophage-free and will be able to
propagate a diverse range of lytic phages.
Methods: The bacteriophages in the strains have been induced by inoculation of
mitomycin C, to create 31 different host mutant MRSA 252 strains. Bacterial DNA
preparation and extraction was performed to extract the DNA from the 31
different mutant MRSA 252 strains with a DNA preparation kit. Prophage screening
was performed with the Multiplex PCR in order to identify if the Sa2 and Sa3
prophages have been mobilized from the mitomycin C treated cultures. The
bacteriophages that were used in the spot tests performed on the pure cultures of
the 1-31 MRSA 252 host mutant strains have been acquired from the Davenhulme
Sewage Treatment Works Manchester and a bacterial enrichment protocol was
followed in order to increase the number of the phages. These 16 phages have
been used during the spot tests, in order to characterize the susceptibility of the
MRSA 252 host mutant strains to phage infection.
Results: The prophage screening (multiplex PCR and 0.5% agarose gel
electrophoresis) showed that the φSa2 and φSa3 were not present in MRSA 252
mutations 7 and 8. Most of the mutant host strains were sensitive to lytic phages.
The mutant host strains were resistant to phages φ9, φ11 and φ146 and to the 103
dilutions of the phages φ7 and φ8. Lastly, MRSA 252 mutations 7 and 8 were
resistant to all the phages.
Conclusion: The attempt of mobilizing the prophages from the MRSA 252 strain
was unsuccessful since the phages were not able to infect the mutations 7 and 8 of
the MRSA 252. Further investigation needs to be conducted for the better
understanding of the bacteria, the phages and the mammalian host.

1. Introduction
Staphylococcus aureus (S. aureus) is an opportunistic pathogen that is part of the
normal flora of the human organism (Doyle et al, 2009). Colonization of S. aureus can
be found in an organism without the appearance of any symptoms. However,
hospitalized and immunocompromised patients can suffer from serious S.aureus
infections that can be caused by different strains of that particular pathogen.
Methicillin-resistant Staphylococcus aureus 52 (MRSA252) is a clinically significant
and globally spread strain which is responsible for infections caused by S. aureus in
United Kingdom. MRSA252 is a strain that is resistant to certain antibiotics, either
due to its structure or its genetic diversity.
Bacteriophages are viruses that infect bacteria by often colonizing them
asymptomatically (lysogenic cycle). Alternatively, bacteriophages undergo the lytic
cycle and during this cycle, they infect a bacterium, replicate, induce lysis to the
bacterium and spread to adjacent bacteria of the same strain.
1.1 Staphylococcus aureus
Many S. aureus infections present as moderately severe infections of the skin or
respiratory tract, but S. aureus may rarely cause more dramatic forms of disease that
may be life-threatening, such as necrotizing fasciitis or necrotizing pneumonia (Otto,
2012). Considerable efforts have been undertaken to decipher the importance that
specific molecular determinants have in defining S. aureus virulence and interaction
with the host. The appearance of new S. aureus strains seems to be caused by
horizontal gene transfer of virulence genes by insertion sequences, plasmids,
transposons and bacteriophages (Rahimi et al, 2012).
1.2 MRSA 252
The genome sequence of MRSA252 strain was produced by The Sanger Institute
Pathogen Sequencing Unit and the MRSA252 chromosome is 2,902,619 bp in size
(Holden et al, 2004). This particular strain belongs to the epidemic EMRSA-16 which

is regarded as an endemic in UK and is also a serious contributor of Staphylococcus
aureus infections in the US.
MRSA 252 is resistant to penicillin, ciproflaxacin, erythromycin and methicillin
(Holden et al, 2004). A reason for the resistance of the MRSA strains to methicillin is
the staphylococcal cassette chromosome mec (SCCmec) which is a DNA fragment
ranging from 21 to 67 kb in size. This SCCmec chromosome contains the mecA gene,
which codes for a low-affinity penicillin binding protein, and is a factor for the
methicillin resistance (Lowy, 2003). Furthermore, resistance of MRSA 252 is due to
genetic elements carrying resistance genes with chromosomally encoded
determinants.
1.3 Bacteriophages
Phages are a major contributor to the large diversity of the Staphylococcus aureus
species. MRSA 252 genome contains two prophages that belong in the Siphoviruses
category, which contains six functional modules: lysogeny, DNA replication,
packaging, head, tail and lysis (Xia et al, 2014). The first prophage is φSa2; it is 43kb
in size and does not contain the Panton-Valentine leukocidin toxin or any other
determinants. The second prophage of MRSA 252 is φSa3 which is 43kb in size and is
integrated into the hlb (β-hemolysin) gene.
ΦSa2 and ΦSa3 prophages are mobilized and transferred to other strains. These
prophages also, carry the stimulation and transfer of genomic islands. Lastly,
prophages transfer the chromosomal markers. Both φSa2 and φSa3 contain well-
characterized virulence factors, such as staphylokinase and pyrogenic toxin
superantigen proteins. These staphylococcal temperate phages can be categorized
based on their lytic activity, their serological properties and their morphology.
Multiplex PCR is a method that can be used to identify the phages of S. aureus by
observing differences between viral genes which code for the surface-exposed
determinants (Goerke et al, 2009).

Bacteriophages can be used for the treatment of different bacteria, due to their
ability to infect various strains and their host range (Kazmierczak, 2014). Lytic phages
can be acquired by causing stress to the bacterium that harbors the phages.
Mitomycin-C, for example, can be used to induce stress response and thus the
bacteriophage transforms from its lysogenic state to a lytic state. This stress
response is caused by the induction of a random mutation with Mitomycin C to the
genes involved in the repression of lysis.
Finally, the purpose of this project was to mutate MRSA 252 colonies and observe
how the mutants will respond to infection caused by 16 different phages. The
hypothesis was that if the MRSA 252 harbored prophages could be mobilized from
the MRSA 252 by mitomycin-C, the mutants would be prophage-free and thus, get
infected by a broad spectrum of obligately lytic phages.
2. Methods
2.1 Induction of the Phage
Initially, 0.5 ml of the selected Methicillin Resistant Staphylococcus aureus 252
(MRSA 252) strain was added to the universal sterile tubes containing 20 ml of Oxoid
Tryptic Soy Broth (CM 0129) and vortexed. After the vortexing, the tube was
incubated for 30 minutes at 37o
C. The next step was the removal of the tube from
the incubator, the addition of 20μL of Mytomycin C and its return in the 37o
C
incubator for 30 more minutes. When the culture was removed from the incubator,
it had to be transferred to the centrifuge (Sigma 3-16L) at 4200 rpm for 20 minutes.
After the completion of the centrifugation, pellets were formed and the supernatant
had to be poured into a beaker. The pellets then had to be washed, suspended in
PBS (phosphate-buffered saline) and centrifuged for 10 more minutes at 4200 rpm.
The suspended culture had to be diluted in 10-10
, in tubes containing 900 μL of PBS.
Finally, 100μl from each diluted tube (10-1
– 10-10
) was pipetted and spread with
sterile spreaders on plates containing Oxoid Trypticase Soy Agar (CM 031). The

inoculated MRSA 252 TSA plates were kept overnight in the 37o
C incubator to
examine the growth of the MRSA 252 dilutions with the Mitomycin C in the streak
plates.
The next day, 31 different mutant colonies were retrieved from the overnight
inoculated streak plates. These mutant colonies were then transferred on separate
TSA plates in order to create pure cultures of each mutation. These mutations show
that the genes involved in the repression of lysis (i.e. genes keeping prophage in the
chromosome of the host) have been randomly mutated.
2.2 Bacterial DNA preparation and extraction
A swab from each TSA plate inoculated with MRSA 252 1-31 mutants and the wild
type, was taken with a sterile loop and dipped in 32 different PCR tubes containing
250 μl of PBS. DNA preparation – extraction was performed using the Roche High
Pure PCR Template preparation kit.
2.2.1 Preparation of working solutions
Firstly, according to the instructions of the PCR preparation kit, the working solutions
had to be prepared. Proteinase K was dissolved in 4.5 ml of distilled water, 20 ml of
ethanol was added in the Inhibitor Removal Buffer and 80 ml of ethanol was added
in the Wash Buffer. The elution buffer of the DNA preparation Kit was also
transferred in the water bath which was set on 70o
C
2.2.2 Lysis and DNA Binding of MRSA 252 mutations and wild type
200 μl of MRSA 252 (10-9
) and mutant MRSA 252 were added to a nuclease free 1.5
ml microcentrifuge tube and then centrifuged for 5 minutes at 5000 x g. After the
centrifugation, the pellet of the MRSA 252 wild type and mutants were resuspended
in 200μl PBS. 5 μl lysozyme (10mg/ml in 10 mM Tris-Hcl, pH 8.0) was added in the
microcentrifuge tube and then it was incubated for 15min at +37 o
C. 200μl of Binding
buffer and 40μl reconstituted proteinase K were added, mixed and incubated for 10
minutes at 70o
C. 100 μl of Isopropanol were also added and mixed. Once the High
Pure Filter Tube was assembled into one collection tube, the liquid sample was

pipetted to the upper buffer reservoir of the filter tube. The High Pure Filter tube
was transferred to a centrifuge where it was centrifuged for 1 min at 8000 x g.
2.2.3 Washing and Elution of the DNA of MRSA 252
After centrifugation of the sample, the filter tube was removed from the collection
tube, and the collection tube was discarded along with the flow through liquid. The
filter tube was assembled with a new collection tube. 500 μl of Inhibitor Removal
Buffer were added to the upper reservoir of the filter tube which was centrifuged for
1 min at 8000 x g. This step was repeated two more times.
The entire High Pure assembly was then centrifuged after discarding the flow
through liquid for 10s at full speed and the collection tube was discarded. For the
elution of the DNA of MRSA 252 wild type and mutants, a filter tube was inserted
into a clean, sterile 1.5 ml microcentrifuge tube. 200 μl of pre-warmed Elution buffer
were added to the upper reservoir of the filter tube. Then the tube was centrifuged
for 1 min at 8000 x g and the eluted DNA of MRSA 252 wild type and mutants, was
ready to be used.
2.3 Prophage Screening
The primers used for the screening of the prophages were as described in Goerke et
al, 2009, Sa2-Forward (TCAAGTAACCCGTCAACTC) and Sa2-Reverse
(ATGTCTAAATGTGTGCGTG) for the Sa2 prophage and Sa3-Forward
(TTATTGACTCTACAGGCTGA) and Sa3-Reverse (TTATTGACTCTACAGGCTGA) for the
Sa3 prophage. These primers were added to the DNA that was extracted from the 1-
31 MRSA 252 mutations and MRSA 252 wild type with the Roche High Pure PCR
preparation kit. Moreover, for the detection of the φSa2 and φSa3 prophages
Multiplex PCR had to be performed using the Q-Cycler 96. The chromosomal DNA of
MRSA 252 wild type and 1-31 mutants that were extracted with the Roche High Pure
PCR Template preparation kit were added in 2 sets of 32 different PCR tubes. In the
first set 32 tubes Sa2-Forward and Sa2-Reverse primers were added and in the

second set Sa3-Forward and Sa3-Reverse primers were added. In both sets, 2 x
BioMix (BIOLINE) were added along with distilled sterile water (Table 2), also another
tube without any DNA was used as a negative control. The total amount of the mix in
each tube was 25 μl. After the completion of the 32 cycles of PCR (1st
step: 1 cycle at
95o
C for 5 minutes, 2nd
step: 30 cycles of amplification in 95o
C for 30 seconds, 55o
C
for 1 minute, 72 o
C for 45 seconds and 3rd
step: 1 cycle at 72 o
C for 10 minutes) PCR
products were transferred in microtitre plates where 10 μl of ficoll 400 –
bromophenol blue loading buffer (Table 2.1) was added in 1:1 ratio with each PCR
product (10 μl). The EAP gene was also screened with PCR for the mutations 7 and 8
of MRSA 252 with the MRSA 252 wild type and a negative control, to confirm that
the Sa2 and Sa3 prophages were indeed mobilized from these two mutations.
2 x 0.5% agarose gels were also prepared (150ml of 0.5xTBE and 1.5g of standard
agarose powder) for the loading of each of the prophages that was screened and
10μl of the samples from each microtitre well was transferred to the wells of the
0.5% agarose gels. 5 μl of DNA ladder (HypperLadder 1 kb – BIOLINE) and a negative
control were also pippetted in the wells. After the end of the electrophoresis (60
min) the gels were taken to the UV transilluminator where Sa2 and Sa3 bands were
identified and the agarose gels were photographed.
Contents PCR tube - 25
μl
x 36 (Master Mix)
Forward
Primer
5 μl 180 μl
Reverse
Primer
5 μl 180 μl
2 x BioMix 12.5 μl 450 μl
DNA 1.0 μl (added separately in each
tube)
H2O 1.5 μl 54 μl
Table 1 – Quantity of contents added in each PCR tube (25μl) and in the Master Mix (Primers
concentration: 10μΜ) `

2.4 Bacteriophage isolation
The phages that were used for the spot tests were isolated from raw sewage from
Davenhulme Sewage Treatment Works Manchester in 2015/16. A bacterial
enrichment protocol was followed in order to multiply the phages’ numbers. The
first step was to add 5 ml of overnight incubated in TSB actively growing S. aureus
cells in another TSB medium with 1 mM MgSO4 and 1 mM CaCl2 and re-incubate
overnight at 37°C. A 10-ml aliquot was taken from the overnight culture, and 1 M
NaCl and 0.2% chloroform were added. Centrifugation of the culture has later
followed at 3000 g of 30 minutes in order to remove the bacteria and the
supernatant was filtered-sterilized (0.22-m pore size; Millipore filter). The
supernatant, which was a lysate, was used to check if any lytic phages were present
using the double layer method. Isolated single plaques were picked into SM buffer
(5 M NaCl, 1 M MgSO4, 1 M Tris-HCl [pH 7.5], 0.01% (wt/vol) gelatin in distilled water
[dH2O]), and in order to obtain purified plaques, successive rounds of single plaque
purification have been performed until single plaques were formed. The purified
phages were stored in 50% (vol/vol) glycerol at 80°C for long-term use. Short-term
stock preparations were maintained at 4°C (Alves et al, 2014). The phages were
originally isolated on Staphylococcus aureus strain D390 which was isolated from the
nasal cavity of a healthy donor in Oxford, United Kingdom in 1998.
Loading buffer
Bromophenol blue
25mg
Ficoll 400 1.5mg
20μl dsH2O
Table 1.1 – Bromophenol blue and ficoll 400 mixed to make a
loading buffer for the agarose gel electrophoresis

2.5 Spot tests on MRSA 252 host mutants and wild type
16 different lytic phages were selected for testing whether or not they were able to
infect the mutant MRSA 252 colonies. From the 16 phages in stock, 10 μl of each
phage solution was added in 990 μl of PBS creating a 1:1000 phage dilution and a set
of undiluted phages.
32 culture tubes have been added in assorted racks where 100μl of the 31 mutant
MRSA 252 strains have been pipetted along with the MRSA 252 wild type as a
positive control. 3ml of soft agar (containing 6g TSB – CM 019 and 1.3 g
Bacteriological agar – LP 0011 added in 200 ml of distilled sterile water) were
pipetted in the culture tubes containing the 31 MRSA 252 mutants (including the
W.T.) that were inoculated in overnight TSB, and the content of the culture tubes
was poured immediately on the plates where the gridlines have been drawn. Each
plate was labeled according to the MRSA 252 mutation that was going to be
inoculated.
Two sets of 32 overlay agar plates containing MRSA 252 mutants and wild type were
created for the spot assay and each set was used for the diluted and undiluted phage
inoculation
Distribution 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Phages (5 μl) Φ2 Φ3 Φ4 Φ5 Φ6 Φ7 Φ8 Φ9 Φ11 Φ12 Φ88 Φ145 Φ146 Φ189 ΦΚ ΦΑW
After the soft agar overlay was dry, 5 μl of each phage (diluted/non-diluted) were
pippeted on all the MRSA 252 plates according to Table 2.2. The plates were then
transferred in the incubator (37 °C) where they were kept overnight in order to be
able to observe the ability of each phage to induce lysis on each of the MRSA 252
host mutant strain (Manzana thesis). The overnight incubated plates were removed
from the incubator and were observed for induction of lysis or resistance of the
Table 1.2 – Distribution of the phages on each MRSA 252 (wild type and mutant strain) overlay agar plate from the spot
assay.

MRSA 252 host mutant from each labeled phage
(Table 2.2).
3. Results
3.1 Mutant MRSA 252 strains
Figure 3.1 is an example of the mutations induced from the inoculation of Mitomycin
C to the 10 – 10-10
dilutions. The Figure 3.1 shows particularly the mutations induced
in the 10-4
and 10-5
dilutions. The mutant colonies have been distinguished by their
difference in shape and size. Lastly, 31 different MRSA 252 single mutant colonies
have been selected and were transferred to new TSA plates to create pure cultures.
The streak plates from which the mutant single colonies have been acquired were
the plates labelled as dilution MRSA 252
10-4
, 10-5
and 10-6
.
3.2 Prophage Screening
Each of the 31 MRSA 252 mutations was screened for the presence of the ΦSa2 and
ΦSa3 genes. Two MRSA 252 mutants (7 and 8) appeared to lack both prophages
(Figure 2 and Figure 3) but when they were screened on another agarose gel
electrophoresis for the EAP gene, EAP was present in both (Figure 4). However, the
rest of the MRSA 252 mutations were positive for the prophages Sa2 and Sa3. The 31
MRSA 252 mutants were chosen from the random mutations that have been
Figure 1– Overnight cultures of dilutions (1:104
and 1:105
) of MRSA 252 wild type inoculated with Mitomycin
C that were spread on Tryptic Soya Agar (TSA). Mutant MRSA 252 strains that grew overnight, were
distinguished from their difference in size and shape.

produced from inoculation of Mitomycin C to the dilutions of the MRSA 252 wild
type. The presence of ΦSa2 and ΦSa3 in all the MRSA 252 mutants, except from
mutation 7 and 8, was an indication of the presence of prophages in the 29 rest
mutant MRSA 252 strains. Moreover, the PCR and agarose gel electrophoresis was
performed for the screening of the chromosomal DNA of the mutant MRSA 252
strains, which showed that DNA was present in all of the mutant strains.
Figure 1.1– Agarose gel electrophoresis (0.5% agarose gel) of a DNA ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal DNA
of MRSA 252 wild type and 31 mutations of MRSA 252. Below there are annotations of the above figure: 1. DNA ladder (Hyperladder), 2.
MRSA 252 mutation 1, 3. MRSA 252 mutation 2, 4. MRSA 252 mutation 3, 5. MRSA 252 mutation 4, 6. MRSA 252 mutation 5, 7. MRSA
252 mutation 6, 8. MRSA 252 mutation 7, 9. MRSA 252 mutation 8, 10. MRSA 252 mutation 9, 11. MRSA 252 mutation 10, 12. MRSA 252
mutation 11, 13. MRSA 252 mutation 12, 14. MRSA 252 mutation 13, 15. MRSA 252 mutation 14, 16. MRSA 252 mutation 15, 17. MRSA
252 mutation 16, 18. DNA ladder, 19. DNA ladder, 20. MRSA 252 mutation 17, 21. MRSA252 mutation 18, 22. MRSA 252 mutation 19,
23. MRSA 252 mutation 20, 24. MRSA 252 mutation 21, 25. MRSA 252 mutation 22, 26. MRSA 252 mutation 23, 27. MRSA 252 mutation
24, 28. MRSA 252 mutation 25, 29. MRSA 252 mutation 26, 30. MRSA 252 mutation 27, 31. MRSA 252 mutation 28, 32. MRSA 252
mutation 29, 33. MRSA 252 mutation 30, 34. MRSA 252 mutation 31, 35. MRSA 252 wild type, 36. DNA ladder.

Figure 1.3 - Agarose gel electrophoresis (0.5% agarose gel) of a DNA ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal
DNA of MRSA 252 wild type, 31 mutations of MRSA 252 and negative control screened against ΦSa3. Below there are annotations of
the above figure: 1. DNA ladder (Hyperladder), 2. MRSA 252 mutation 1, 3. MRSA 252 mutation 2, 4. MRSA 252 mutation 3, 5. MRSA
mutation 9, 11. MRSA 252 mutation 10, 12. MRSA 252 mutation 11, 13. MRSA 252 mutation 12, 14. MRSA 252 mutation 13, 15.
MRSA 252 mutation 14, 16. MRSA 252 mutation 15, 17. MRSA 252 mutation 16, 18. DNA ladder, 19. DNA ladder, 20. MRSA 252
mutation 17, 21. MRSA252 mutation 18, 22. MRSA 252 mutation 19, 23. MRSA 252 mutation 20, 24. MRSA 252 mutation 21, 25.
MRSA 252 mutation 22, 26. MRSA 252 mutation 23, 27. MRSA 252 mutation 24, 28. MRSA 252 mutation 25, 29. MRSA 252 mutation
mutation 31, 35. MRSA 252 wild type, 36. Negative control, 37. DNA ladder.
Figure 1.2 - Agarose gel electrophoresis (0.5% agarose gel) of a DNA ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal
DNA of MRSA 252 wild type, 31 mutations of MRSA 252 and negative control screened against ΦSa2. Below there are annotations of
the above figure: 1. DNA ladder (Hyperladder), 2. MRSA 252 mutation 1, 3. MRSA 252 mutation 2, 4. MRSA 252 mutation 3, 5. MRSA
mutation 9, 11. MRSA 252 mutation 10, 12. MRSA 252 mutation 11, 13. MRSA 252 mutation 12, 14. MRSA 252 mutation 13, 15.
MRSA 252 mutation 14, 16. MRSA 252 mutation 15, 17. MRSA 252 mutation 16, 18. DNA ladder, 19. DNA ladder, 20. MRSA 252
mutation 17, 21. MRSA252 mutation 18, 22. MRSA 252 mutation 19, 23. MRSA 252 mutation 20, 24. MRSA 252 mutation 21, 25.
MRSA 252 mutation 22, 26. MRSA 252 mutation 23, 27. MRSA 252 mutation 24, 28. MRSA 252 mutation 25, 29. MRSA 252 mutation
mutation 31, 35. MRSA 252 wild type, 36. Negative control, 37. DNA ladder.

3.3 Susceptibility of MRSA 252 host mutants to phage infection
After the overnight incubation of the 31 MRSA 252 (and the MRSA 252 wild type)
host mutants in TSB, each host mutant strainwas cultured on TSA plates with Soft
Agar Overlay and 16 different phages have been spotted on each of the host mutant
strain where zones were observed (Table 1). These zones were described as
sensitive, indicative of formation of clear spot and lysis of the host strain; resistant,
indicating no lytic activity on the mutant host strain; and intermediate, representing
partial lysis of the host strain from the lytic phages.
All the MRSA 252 mutations that were tested against the phages Φ2, Φ3, Φ4, Φ5,
Φ6, Φ88 and Φ145 were sensitive except from the mutations 7 and 8. Most of the
MRSA252 strains were resistant or not completely lysed from phages Φ9, Φ11, Φ146
(Table 1). Mutant strains 7 and 8 were resistant in all of the phages. There were
several MRSA252 mutations that were sensitive to the undiluted phages Φ7 and Φ8
but when spot test was performed with 10-3
phage dilutions on the same host strain,
Figure 1.4 – Agarose gel electrophoresis (0.5% agarose gel) of a DNA ladder (HyperLadder - BIOLINE) 1kb in size, the chromosomal
DNA of MRSA 252 wild type, mutations 7 and 8 of the MRSA 252 and a negative control screened for EAP gene. Below there are
annotations of the above figure: 1. DNA ladder (HyperLadder), 2. MRSA 252 mutation 7, 3. MRSA 252 mutation 8, 4. MRSA 252 wild
type, 5. Negative control, 6. DNA ladder (HyperLadder).

host strains appeared to be resistant in those two particular phages. Most of the
MRSA 252 mutations were also sensitive to Φ12 apart from MRSA252 mutant 1, 5,
22 and 27. These 4 host mutants were sensitive to non-diluted phage infection but
were resistant to the 10-3
diluted Φ12. The MRSA 252 host mutants were either
resistant or intermediately infected from Phage Φ189. Finally, MRSA 252 mutants 1,
5, 22 and 27 were also resistant to the 10-3
dilution of the phages ΦΚ and ΦΑW
whereas mutant 20 was resistant in both ΦΚ and ΦΑW dilutions and the rest of the
mutants were either sensitive or intermediate.
Figure 1.5 – Spot tests of the MRSA 252 mutation 14 with 16 (1:1000 dilution) different phages that were annotated
in the above figure. The zones of inhibition are clear (Φ2, Φ3, Φ12 etc), as well as the zones where the mutant strain
is resistant to the phages (Φ8, Φ9 etc) and the intermediate zones (Φ189, ΦΚ, ΦΑW).
Φ2 Φ3 Φ4 Φ5
Φ6 Φ7 Φ8 Φ9
Φ11 Φ12 Φ88 Φ145
Φ146 Φ189 ΦΚ ΦΑW

Strain Phages 1 - 16 (5 μl)
MRSA 252 φ2 φ3 φ4 φ5 φ6 φ7 φ8 φ9 φ11 φ12 φ88 φ145 φ146 φ189 φK φAW
Wild Type S S S S S S S R R S S S R R S S
TD/1000 S S S S S R R R R S S S R R I I
Mut 1 (TD) S S S S S S S R R S S S R R S S
TD/1000 S S S I S R R R R R I S R R R R
Mut 3(TD) S S S S S S S R R S S S R R S S
TD/1000 S S S S S R R R R S S S R R S S
TD/1000 S S S S S R R R R R I S R R R R
Mut 7 (TD) R R R R R R R R R R R R R R R R
TD/1000 R R R R R R R R R R R R R R R R
Mut 8 (TD) R R R R R R R R R R R R R R R R
TD/1000 R R R R R R R R R R R R R R R R
Mut 9 (TD) S S S S S S S R R S S S R R S I
Mut 10 (TD) S S S S S S S R I S S S R R S I
TD/1000 S S S S S R R R R S S S R R S I
Mut 16 (TD) S S S S S R R R R S S S R I I I
TD/1000 S S S S S R R R R S S S R I I I
Mut 17 (TD) S S S S S R R R R S S S R I S S
TD/1000 S S S S S R R R R S S S R I S S
Mut 19 (TD) S S S S S R R R R S S S R I I I
Mut 20 (TD) S S S S S R R R R I S S R R R R
TD/1000 S S S S S R R R R I S S R R R R
Mut 21 (TD) S S S S S R R R R S S S R R S S
Mut 22 (TD) I I I S I S S R R I S S R I S I
TD/1000 S S S S S R R R R R S S R R R R
Mut 23 (TD) I I I I I I I R R I I I R R I I
Mut 24 (TD) I I I I I I I R R I S I R R S I
Mut 26 (TD) I I I I I I I R R I I I R R I I
Mut 27 (TD) I I I I I I I R R I S S R R S I
TD/1000 S S S S S R R R R R S S R R R R
Mut 28 (TD) I I I I I I I R R I S S R R S I
Table 2 – 31 MRSA 252 mutants along with the MRSA 252 wild type were spotted with 16 different phages in normal
dilutions and in 1:1000 dilutions of the phages and the zones that were formed were described as: R –Resistant, S –
Sensitive and I – Intermediate (TD = Test Dilution and Mut=Mutation).

4. Discussion
4.1 Virulence factors of MRSA252
Staphylococcus aureus can commonly result in skin infections, respiratory diseases,
and food-poisoning, and the resistance that have emerged against antibiotics, such
as vancomycin and methicillin, becomes an issue in clinical medicine (Lim et al,
2015). The S. aureus isolates have several virulence factors and toxins such as
superantigens, Panton-Valentine leukocidins (PVL), exfoliative toxin type A,
staphylokinase, pathogenicity islands (SaPIs), genomic islands, chromosome
cassettes (SCC), transposons and conjugative plasmids. The MRSA 252, which is the
focus of this research, contains as showed in Figure 4.1 (Holden et al, 2004) below
some of those virulent factors, including SCC element, an integrated plasmid,
prophages Sa2 and Sa3. It also contains 4 genomic islands (νSaα, νSaβ, SaPI4 and
Tn916-like) and two transposons (Tn 554 and Tn552).
Figure 2 - Schematic circular diagrams of the MRSA252 chromosome. Where appropriate, categories are shown as pairs of
concentric circles representing the MRSA 252 strand. The outer colored segments on the gray outer ring represent genomic
islands and horizontally acquired DNA (see figure for key). Inside the gray outer ring, the rings from outside to inside
represent scale in Mbp, annotated CDS (colored according to predicted function), tRNA and rRNA (green), additional DNA
compared to the other S. aureus strain described here (MRSA252 where appropriate; red), additional DNA compared to other
sequenced S. aureus strains [N315 (5), Mu50 (5), and MW2 (6); blue], percentage of G + C content, and G + C deviation (>0%,
olive; <0%, purple). Color coding for CDSs is as follows: dark blue, pathogenicity/adaptation; black, energy metabolism; red,
information transfer; dark green, surface-associated; cyan, degradation of large molecules; magenta, degradation of small
molecules; yellow, central/intermediary metabolism; pale green, unknown; pale blue, regulators; orange, conserved
hypothetical; brown, pseudogenes; pink, phage plus insertion sequence elements; gray, miscellaneous (Holden et al, 2004).

This virulence factors expressed from the MRSA 252 need to be absent in the phage
preparations especially when the contributions of the prophages in the pathogenesis
are already demonstrated (Kumar et al, 2012). In this study, induction of the Sa2 and
Sa3 prophages has been attempted in order to mobilize both prophages and create a
‘safe’ host strain.
4.2 Induction and Screening of the Prophages
The inoculation of Mitomycin C to the MRSA 252 and the overnight incubation of the
MRSA 252 with the Mitomycin C 10-1
– 10-10
dilutions resulted in mutant single
colonies of the MRSA 252. This was a result of the 31 random mutations that were
induced from inoculation of Mitomycin C, which is a DNA-damaging agent, and were
transferred to new TSA plates to create pure cultures. The DNA-damage induced
from Mitomycin C has evidently mobilized the prophages Sa2 and Sa3 in the
mutations 7 and 8 of the MRSA 252. The Sa2 and Sa3 prophages were absent when
the prophage screening was performed in both 7 and 8 MRSA 252 mutations via
Muliplex PCR. An explanation for the absence of both prophages on both mutations
is that both of them have been mobilized from the stress response induced by the
inoculation of Mitomycin C. The stable lysogenic state of the MRSA 252 prophages is
maintained by an integrase protein called CI repressor which is bound at the oL and
oR operators and blocks the gene from inducing lysis. During the inoculation with
Mitomycin C, the MRSA 252 activated a DNA repair system response called SOS. This
response results in inactivation of the CI integrase protein and the activation of the
Cro regulator protein leading to the switch of the prophages Sa2 and Sa3 from
lysogenic state to lytic phages not able to be distinguished with the Multiplex PCR.
The PCR on the 29 host mutant MRSA 252 that have been screened for the Sa2 and
Sa3 prophages showed that both of the prophages were present. Therefore,
mobilization of the prophages in these mutant strains was not achieved (Figures 3.3
and 3.4). The induction of the prophages in mutations 7 and 8 meant that the
attempt for production of a prophage-free MRSA 252 mutant host strain seemed to
be successful (Rockney et al, 2008).

4.3 Spot assay of the mutant MRSA 252 strains with phages
During the spot test, the lytic ability of 16 phages was tested against 31 mutant
MRSA 252 strains on phage-treated bacterial cultures. Two different dilutions of
phages have been created and one set of phage-treated cultures have been
prepared with each phage dilution. The first set contained non-diluted phages and
the second set contained 10-3
diluted phages. The reason for the creation of those
two sets was to avoid infection of the bacterium cultures through the toxins or
enzymes that might have been contained in the phages and could have led in false
positive results. Therefore, the phages had to be diluted in 10-3
. The results of the
sets of diluted and undiluted phages were in agreement in some of the mutant
bacterial strains; whereas, in other strains the diluted phages were not able to infect
the strain (Jensen et al, 2015). The conclusion was that the majority of the host
mutant strains were indeed sensitive to the lytic phages (Table 3.1). However, some
strains were resistant in certain phages and this could have been the result of phage
receptors that might have not been present in the bacterial cells for these particular
phages. Other reasons could be the restriction modification system of the host,
superinfection immunity or even abortive infection (Kumar et al, 2012). Moreover,
the resistance of the strains to some of the phages could be attributed to the fact
that some of the phages were induced from a lysogenic state and had low lytic
activity when they entered the lytic state. (Manzana, 2012).
An unexpected result was the resistance of the 7 and 8 mutant MRSA252 strains in
all phages. These two strains appeared to be prophage-free during the Prophage
Screening from the Sa2 and Sa3 prophages and one would have expected that these
two phages would have been infected from all the lytic phages during the spot test.
This may have still been attributed to the absence of phage receptors or the other
factors stated above. The only absolute fact is that the attempt of creating a
prophage-free host strain with mobilization of the prophages Sa2 and Sa3 from the
mutant MRSA 252 strains was unsuccessful.

This study could have been investigated further through the phenotypical
characterization of the MRSA 252 host mutant strains and by the growth of phage-
treated bacteria in liquid culture and construction of one-step growth curves that
would have shown how the bacteria would grow and how they would respond to
phage infection.
The results that have been retrieved from this study can be applied in further
research examining the construction of a ‘safe’ host strain that will not harbor any
contamination-causing phages and will be able to propagate a diverse range of lytic
phages. These results have also contributed to the understanding of the phage
dynamics and the MRSA 252 as a host.
Moreover, future research could investigate the methods that the MRSA 252 and all
the S. aureus strains gain resistance to phages. The investigation of the interactions
of the phages with the bacteria can possibly lead to a better understanding and
production of highly lytic phages. Furthermore, parameters such as the temperature
or the pH can also be examined for their role in the activity of the phages. Future
research could also investigate the sensitivity of a broader spectrum of host strains
to lytic phages. The investigation of the MRSA 252 and antimicrobial resistant S.
aureus against different bacteriophages could result in an effective treatment
against antibiotic resistant bacteria.
5. Conclusion
The prophages ΦSa2 and ΦSa3 that were induced from their MRSA 252 host strain
with the inoculation of Mitomycin C appeared initially to be mobilized from their
host mutant strains when the Prophage screening had been performed. Eventually,
the host mutant strains that appeared to be prophage-free were unexpectedly
resistant to all the 16 lytic phages. Hence, the attempt of creating a prophage-free
mutant strain was unsuccessful.
Phages can contribute a substantial share of their bacterial hosts’ mobile DNA and
seem to influence the short-term evolution of pathogenic bacteria (Canchaya, 2003).

The phage dynamics are only partially understood and more genomic and
phenotypic research will give rise to a greater understanding of the evolution of the
bacteria in the environment. Finally, for the further understanding of the bacteria
and phages, the mammalian host should also be investigated. If these steps are
followed, the appearance of new bacterial strains can be predicted and treatments,
using phage therapy, can be applied in the future.
6. References
1. Alves, D. R. Gaudion, A. Bean, J. E. Esteban, P. P. Arnot, C. T. Harper, D. R. Kot, W.
Hansen, H. L. Enright, C. M. Jenkins, A. T. A. Scottel, L. J. (2014) ‘Combined Use of
Bacteriophage K and a Novel Bacteriophage to Reduce Staphylococcus aureus
Biofilm Formation.’ Applied Environmental Microbiology, 80 (21), pp. 6694-6703.
2. Canchaya, C. Fournous, G. Chibani, C. S. Dillmann, M. L. Brüssow, H. (2003) ‘Phage as
agents of lateral gene transfer.’ Current opinion in microbiology, 6 (4), pp. 417-424
3. Doyle, M. Feuerbaum, E. Fox, K. Hinds, J. Thurston D. E. & Taylor P.W. (2009)
‘Response of Staphylococcus aureus to subinhibitory concentrations of a
sequence-selective, DNA minor groove cross-linking pyrrolobenzodiazepine
dimer.’ Journal of Antimicrobial Chemotherapy, 64 (1), pp. 949-959.
4. Goerke, C. Pantucek, R. Schulte, B. Zink, M. Grumann, D. Broker, B. M. Doskar, J. &
Wolz, C. (2009) ‘Diversity of Prophages in Dominant Staphylococcus aureus Clonal
Lineages.’ Journal of Bacteriology, 191 (11), pp. 3462-3468.
5. Holden, M. T. G. Feil, E.J. Lindsay, J. A. Day, N. P. J. Enright, M. C. Foster, T.J.
Moore, C. E. Atkin, R. Barron, A. Bason, N. Bentley, S. D. et al. (2004) ‘Complete
genomes of two clinical Staphylococcus aureus strains: Evidence for the rapid
evolution of virulence and drug resistance.’ Proceedings of the National Academy
of Science Journal, 101 (26), pp. 9786-9791.
6. Jensen, C. K. Hair, B. B. Wienclaw, M. T. Murdock, H. M. Hatch, B. J. Trent, T. A.
White, D. T. Haskell, J. K. Berges, K. B. (2015) ‘Isolation and Host Range of
Bacteriophage with LyticActivity against Methicillin-Resistant Staphylococcus aureus and

Potential Use as a Fomite Decontaminant.’ PLoS ONE. [Online] 10 (7). Available at:
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0131714
[Accessed: 11 March 2016].
7. Kazmierczak, Z. Gorski, A. Dabrowska, K. (2014) ‘Facing Antibiotic Resistance:
Staphylococcus aureus Phages as a Medical Tool.’ Viruses, 6 (7), pp. 2551-2570.
8. Kumar, N. G. P. Sundarrajan, S. Paul, D. V. Nandini, S. Saravanan, S. R. Harihanan,
S. Sriram, B. Padmanabhan, S. (2012) ‘Use of prophage free host for achieving
homogenous population of bacteriophages: New findings.’ Virus Research, 169
(1), pp. 182-187.
9. Lim, S. Lee, D. H. Kwak, W. Shin, H. Ku, H. J. Lee, J. E. Lee, G. E. Kim, H. Choi, S. H.
Ryu, S. Lee, J. H. (2015) ‘Comparative genomic analysis of Staphylococcus aureus
FORC_001 and S. aureus MRSA252 reveals the characteristics of antibiotic
resistance and virulence factors for human infection.’ Journal of Microbiology and
Biotechnology, 25 (1), pp. 90-108.
10. Lowy, F. D. (2003) ‘Antimicrobial resistance: the example of Staphylococcus
aureus.’ The Journal of Clinical Investigation, 111 (9), pp.1265-1273.
11. Manzana, C. (2012) ‘The induction, purification and host range of four lysogenic
staphylococcus aureus bacteriophages.’ Ph.D thesis, Baylor University, Texas.
12. Otto, M. (2012) ‘MRSA virulence and spread.’ Cellular microbiology, 14 (10), pp.
1513-1521.
13. Rahimi, F. Bouzari, M. Katouli, M. Pourshafie R. M. (2012) ‘Prophage and
antibiotic resistance profiles of methicillin-resistant Staphylococcus aureus strains
in Iran.’ Archives of Virology, 157 (9), pp. 1807-1811.
14. Rockney, A. Kobller, O. Amir, A. Court, L. D. Stavans, J. Adhya, S. Oppenhelm, B. A.
(2008) ‘Host responses influence on the induction of lambda prophage.’
Molecular Microbiology, 68 (1), pp. 29-36
15. Xia, G. Wolz, C. (2014) ‘Phages of Staphylococcus aureus and their impact on host
evolution.’ Infection, Genetics and Evolution: Journal of molecular epidemiology
and evolutionary genetics in infectious diseases, 21 (1), pp.593-601.

Final year project

More Related Content

What's hot

Viewers also liked

Similar to Final year project

Final year project