This document summarizes a study on the instability of DNA constructs in bacteria used for Agrobacterium-mediated plant transformation. The researchers evaluated the stability of a plasmid (p8114) carrying genes for a transcription factor and antibiotic resistance in E. coli and different Agrobacterium strains. They found 16-100% instability in E. coli colonies stored at -80°C, with rearrangements observed. When transformed into Agrobacterium strains, p8114 showed 50-100% instability. Specifically, LBA4404 had 25-30% instability, EHA105 was 100% unstable, and AGL1 was 50% unstable. The results demonstrate plasmid and DNA construct instability in bacteria, which could compromise
Strain improvement studies on L-aspaginase producing bacteriaSriramNagarajan17
This document summarizes strain improvement studies done on Bacillus cereus MS-6 to increase its production of L-asparaginase enzyme. The wild strain was subjected to UV radiation, yielding mutant MUV-9 with a 7.84-fold increase in enzyme activity. Further mutagenesis with NTG produced mutant MNTG-7 with a 12.04-fold increase versus the wild strain. EMS mutagenesis of MNTG-7 did not significantly improve enzyme activity beyond the parent strain. The strain improvement program resulted in a mutant strain producing over 12 times more L-asparaginase than the original wild strain.
Rice is the principal food crop for more than half of the
world's population. Rice, as a staple food, supports more
than three billion people and comprises 50%–80% of their
daily calorie intake [1]. Adverse environmental factors
such as excessive cold, heat, drought, and salinity stresses
result in a considerable yield loss of crop plants all over
the world. Plant adaptations to environmental stresses
depend on the activation of cascades of molecularnetworks involved in signal transduction, stress perception,
and expressions of stress‐related genes. These
abiotic stresses elicit complex cellular responses in the
plant system, resulting in the production of excessive
reactive oxygen species (ROS) such as hydrogen peroxide
(H2O2), hydroxyperoxyl (HO2·), superoxide (O2
−), and
singlet oxygen (1O2) radicals. To protect themselves from
adverse conditions, plants have evolved a number of
cellular defense mechanisms including antioxidants such
as ascorbate, glutathione, and tocopherols as well as
ROS‐detoxifying enzymes such as superoxide dismutases
(SODs), peroxidases, and catalases (CATs) [2,3].
Successful colonization of roots and Plant growth promotion of sorghum (Sorgh...Premier Publishers
Pseudomonas putida (P29) and Azotobacter chroococcum (Azb19) are the efficient promising strains selected from in vitro plant growth promoting studies. These two strains were tested for their ability to promote growth of sorghum and colonize sorghum roots. Seed bacterization with P29 and Azb19 resulted in increased plant height, shoot height, root volume, leaf area and total plant dry mass. Further, bacterial inoculation also significantly increased macro-and micro-nutrient uptake by sorghum plants. Using electroporation method, pure cultures of P29 and Azb19 were transformed with pHC 60 plasmid containing gfp gene. Transformants detected by colony PCR were used to study the colonization pattern on roots of sorghum. Confocal fluorescence scanning microscope (CLSM) was used to locate the inoculants on or inside roots. Root colonization in sorghum by P29 was internal whereas Azb19 was detected on root surface. GFP-tagged Pseudomonas was predominantly detected at the root differentiation zone. In case of Azb19 small aggregates of micro-colonies were observed on the surface of the roots. The efficient sorghum root colonization by these inoculants clearly demonstrated that the introduced strains could successfully inhabit the rhizosphere and thus resulting in increased nutrient uptake. Inoculation with P29 resulted in increased uptake of P (288.5%), K (179.1%), Fe (242.7%), and Zn (168.1%) as compared to Azb19 where the uptake of P, K, Fe, Mn, and Zn increased by 142.6%, 161.6%, 199.5%, and 121.9%, respectively. On the other hand, inoculation with Azb19 could enhance better uptake of N (163.6%) as compared to P29 (133.3%). The strains also differed in their mode of root colonization.
Purification of G-Protein Coupled Receptor from Membrane Cell of Local Strain...iosrjce
The aim of this study to purify GPCR from a local strain of S. cerevisiae using gel filtration
chromatography techniques , by packing materials for columns which will be chosen of low cost comparing to
the already used in published researches, which depend on the costly affinity chromatography and other
expensive methods of purification. Local strain of S. cerevisiae chosen for extraction and purification of Gprotein
coupled receptor (GPCR) .The strains were obtained from biology department in Al- Mosul University,
Iraq. The isolated colony was activated on Yeast Extract Pepton Dextrose Broth (YEPDB) and incubated at 30
C˚ for 24 h .Loop fully of the yeast culture was transferred to (10ml) of yeast extract peptone glucose agar
(YEPGA) slant , then incubated at 30C˚for 24h , after that it was stored at 4C˚ ,the yeast cultures were
reactivated and persevered after each two weeks period. S.cerevisiae was identified by morphological,
microscopic characterization and biochemical test . The GPCR that extract from membrane of S.cerevisiae was
purified by gel filtration chromatography in two steps using Sepharose 6B. The optical density for each fraction
was measured at 280 nm by UV-VS spectrophotometer then the GPCR concentration was determined by using
ELISA Kit . The fractions which gave the highest absorbance and concentration of GPCR were collected .The
molecular weight of GPCR was determined by gel filtration chromatography using blue dextrin solution.
Standard curve was plotted between log of molecular weight for standard protein and the ratio of Ve/Vo of
GPCR . The purity of the GPCR that extracted and purified from whole cell of S, cerevisiae were carried out by
using SDS-PAGE electrophoresis In the first step 5ml of crude extract was applied on sepharose 6B column
(1.6x 96 cm) which previously equilibrated with 50 mM phosphate buffer saline pH= 7.4 . Multiple proteins
peaks appeared after elution with elution buffer (PBS PH= 7.4 containing 0. 5 % DDM). One peak only give
positive result with GPCR assay, fractions representing GPCR were collected , pooled and concentrated by
sucrose. In the second step five active fractions from the previous step were collected and applied once again on
the same column and same conditions. This step gave a single peak that was identical with the peak of GPCR
concentration ,maximum concentration of GPCR that observed in the fractions (34-38) was 18.541 (ng/ml) . The
specific activity for these fractions was 261.14 (ng/mg) protein with yield of 47.717%. The present study a chive
a relatively high purification of GPCR from membrane fraction of a local strain S. cerevisiae with fold
purification 5.094 and a yield of 47.717%. and molecular weight about~55KD.
LanglaisC_2007_Systematic approach to protein experssion in cell free systemsClaudia Langlais
This document describes a study that tested the expression of 960 human full-length proteins using both in vivo and in vitro expression systems. The researchers found that E. coli cell-free expression systems and wheat germ cell-free expression were better able to express proteins that did not express in E. coli in vivo. They optimized expression in the E. coli cell-free system through sequence modifications and achieved a 93% success rate for cell-free expression overall. Wheat germ expression showed high solubility and protein yield for the proteins tested.
This document describes a protocol for one-step targeted gene deletion in Candida albicans haploids. C. albicans is an important human fungal pathogen that was previously thought to exist only as a diploid. However, the discovery of viable haploid strains of C. albicans enables more efficient gene deletion through a single transformation step rather than the previous two-step process required in diploids. The protocol uses URA3 flipper cassettes containing flanking regions of homology to the target gene for deletion. Transformants are screened by colony PCR to identify those with correct gene deletion and assess ploidy. The protocol enables more rapid functional analysis of C. albicans genes.
V79C cells were derived from V79 cell line by through chronic oxidative stress that was found to be radio-resistant. These cells had demonstrated transformation–like stable changes and could be used as model system to study oxidant induced carcinogenesis. Our objective was to understand mechanism of radiation-resistance in these cells. Apoptotic cell death was inhibited in these cells as visualized microscopically by Hoechst staining and nucleosomal ladder formation in agarose gel. Release of cytochrome c in cytoplasm and Apoptosis Inducing Factor in the mitochondrial and nuclear fraction of cells were determined by Western blotting. The caspase 9 and caspase 3 activities in these cells were estimated from fluorimetric assays. These results revealed that the radiation resistance was due to inhibition of caspase-dependent apoptotic death pathways although Apoptosis Inducing Factor mediated pathway remained unaffected. These findings may aid in understanding the mechanism of radiation resistance in tumors arising from oxidative stress.
The document discusses yeast molecular biology and genetics. It provides information on commonly used yeast species Saccharomyces cerevisiae and Schizosaccharomyces pombe. It discusses yeast genome, life cycle, vectors, cloning, transformation methods, and applications including gene expression and making mutants.
Strain improvement studies on L-aspaginase producing bacteriaSriramNagarajan17
This document summarizes strain improvement studies done on Bacillus cereus MS-6 to increase its production of L-asparaginase enzyme. The wild strain was subjected to UV radiation, yielding mutant MUV-9 with a 7.84-fold increase in enzyme activity. Further mutagenesis with NTG produced mutant MNTG-7 with a 12.04-fold increase versus the wild strain. EMS mutagenesis of MNTG-7 did not significantly improve enzyme activity beyond the parent strain. The strain improvement program resulted in a mutant strain producing over 12 times more L-asparaginase than the original wild strain.
Rice is the principal food crop for more than half of the
world's population. Rice, as a staple food, supports more
than three billion people and comprises 50%–80% of their
daily calorie intake [1]. Adverse environmental factors
such as excessive cold, heat, drought, and salinity stresses
result in a considerable yield loss of crop plants all over
the world. Plant adaptations to environmental stresses
depend on the activation of cascades of molecularnetworks involved in signal transduction, stress perception,
and expressions of stress‐related genes. These
abiotic stresses elicit complex cellular responses in the
plant system, resulting in the production of excessive
reactive oxygen species (ROS) such as hydrogen peroxide
(H2O2), hydroxyperoxyl (HO2·), superoxide (O2
−), and
singlet oxygen (1O2) radicals. To protect themselves from
adverse conditions, plants have evolved a number of
cellular defense mechanisms including antioxidants such
as ascorbate, glutathione, and tocopherols as well as
ROS‐detoxifying enzymes such as superoxide dismutases
(SODs), peroxidases, and catalases (CATs) [2,3].
Successful colonization of roots and Plant growth promotion of sorghum (Sorgh...Premier Publishers
Pseudomonas putida (P29) and Azotobacter chroococcum (Azb19) are the efficient promising strains selected from in vitro plant growth promoting studies. These two strains were tested for their ability to promote growth of sorghum and colonize sorghum roots. Seed bacterization with P29 and Azb19 resulted in increased plant height, shoot height, root volume, leaf area and total plant dry mass. Further, bacterial inoculation also significantly increased macro-and micro-nutrient uptake by sorghum plants. Using electroporation method, pure cultures of P29 and Azb19 were transformed with pHC 60 plasmid containing gfp gene. Transformants detected by colony PCR were used to study the colonization pattern on roots of sorghum. Confocal fluorescence scanning microscope (CLSM) was used to locate the inoculants on or inside roots. Root colonization in sorghum by P29 was internal whereas Azb19 was detected on root surface. GFP-tagged Pseudomonas was predominantly detected at the root differentiation zone. In case of Azb19 small aggregates of micro-colonies were observed on the surface of the roots. The efficient sorghum root colonization by these inoculants clearly demonstrated that the introduced strains could successfully inhabit the rhizosphere and thus resulting in increased nutrient uptake. Inoculation with P29 resulted in increased uptake of P (288.5%), K (179.1%), Fe (242.7%), and Zn (168.1%) as compared to Azb19 where the uptake of P, K, Fe, Mn, and Zn increased by 142.6%, 161.6%, 199.5%, and 121.9%, respectively. On the other hand, inoculation with Azb19 could enhance better uptake of N (163.6%) as compared to P29 (133.3%). The strains also differed in their mode of root colonization.
Purification of G-Protein Coupled Receptor from Membrane Cell of Local Strain...iosrjce
The aim of this study to purify GPCR from a local strain of S. cerevisiae using gel filtration
chromatography techniques , by packing materials for columns which will be chosen of low cost comparing to
the already used in published researches, which depend on the costly affinity chromatography and other
expensive methods of purification. Local strain of S. cerevisiae chosen for extraction and purification of Gprotein
coupled receptor (GPCR) .The strains were obtained from biology department in Al- Mosul University,
Iraq. The isolated colony was activated on Yeast Extract Pepton Dextrose Broth (YEPDB) and incubated at 30
C˚ for 24 h .Loop fully of the yeast culture was transferred to (10ml) of yeast extract peptone glucose agar
(YEPGA) slant , then incubated at 30C˚for 24h , after that it was stored at 4C˚ ,the yeast cultures were
reactivated and persevered after each two weeks period. S.cerevisiae was identified by morphological,
microscopic characterization and biochemical test . The GPCR that extract from membrane of S.cerevisiae was
purified by gel filtration chromatography in two steps using Sepharose 6B. The optical density for each fraction
was measured at 280 nm by UV-VS spectrophotometer then the GPCR concentration was determined by using
ELISA Kit . The fractions which gave the highest absorbance and concentration of GPCR were collected .The
molecular weight of GPCR was determined by gel filtration chromatography using blue dextrin solution.
Standard curve was plotted between log of molecular weight for standard protein and the ratio of Ve/Vo of
GPCR . The purity of the GPCR that extracted and purified from whole cell of S, cerevisiae were carried out by
using SDS-PAGE electrophoresis In the first step 5ml of crude extract was applied on sepharose 6B column
(1.6x 96 cm) which previously equilibrated with 50 mM phosphate buffer saline pH= 7.4 . Multiple proteins
peaks appeared after elution with elution buffer (PBS PH= 7.4 containing 0. 5 % DDM). One peak only give
positive result with GPCR assay, fractions representing GPCR were collected , pooled and concentrated by
sucrose. In the second step five active fractions from the previous step were collected and applied once again on
the same column and same conditions. This step gave a single peak that was identical with the peak of GPCR
concentration ,maximum concentration of GPCR that observed in the fractions (34-38) was 18.541 (ng/ml) . The
specific activity for these fractions was 261.14 (ng/mg) protein with yield of 47.717%. The present study a chive
a relatively high purification of GPCR from membrane fraction of a local strain S. cerevisiae with fold
purification 5.094 and a yield of 47.717%. and molecular weight about~55KD.
LanglaisC_2007_Systematic approach to protein experssion in cell free systemsClaudia Langlais
This document describes a study that tested the expression of 960 human full-length proteins using both in vivo and in vitro expression systems. The researchers found that E. coli cell-free expression systems and wheat germ cell-free expression were better able to express proteins that did not express in E. coli in vivo. They optimized expression in the E. coli cell-free system through sequence modifications and achieved a 93% success rate for cell-free expression overall. Wheat germ expression showed high solubility and protein yield for the proteins tested.
This document describes a protocol for one-step targeted gene deletion in Candida albicans haploids. C. albicans is an important human fungal pathogen that was previously thought to exist only as a diploid. However, the discovery of viable haploid strains of C. albicans enables more efficient gene deletion through a single transformation step rather than the previous two-step process required in diploids. The protocol uses URA3 flipper cassettes containing flanking regions of homology to the target gene for deletion. Transformants are screened by colony PCR to identify those with correct gene deletion and assess ploidy. The protocol enables more rapid functional analysis of C. albicans genes.
V79C cells were derived from V79 cell line by through chronic oxidative stress that was found to be radio-resistant. These cells had demonstrated transformation–like stable changes and could be used as model system to study oxidant induced carcinogenesis. Our objective was to understand mechanism of radiation-resistance in these cells. Apoptotic cell death was inhibited in these cells as visualized microscopically by Hoechst staining and nucleosomal ladder formation in agarose gel. Release of cytochrome c in cytoplasm and Apoptosis Inducing Factor in the mitochondrial and nuclear fraction of cells were determined by Western blotting. The caspase 9 and caspase 3 activities in these cells were estimated from fluorimetric assays. These results revealed that the radiation resistance was due to inhibition of caspase-dependent apoptotic death pathways although Apoptosis Inducing Factor mediated pathway remained unaffected. These findings may aid in understanding the mechanism of radiation resistance in tumors arising from oxidative stress.
The document discusses yeast molecular biology and genetics. It provides information on commonly used yeast species Saccharomyces cerevisiae and Schizosaccharomyces pombe. It discusses yeast genome, life cycle, vectors, cloning, transformation methods, and applications including gene expression and making mutants.
This paper describes a novel method for generating large libraries for directed evolution of proteins using error-prone PCR and a Kunkel-like mutagenesis reaction. The method uses error-prone PCR to generate a mutated DNA fragment, with one primer containing phosphorothioate modifications. Treatment with exonuclease preferentially removes the non-modified strand, generating a single-stranded "megaprimer". This megaprimer is then used in a Kunkel-like reaction with a uracilated template to introduce mutations efficiently without subcloning. This approach enables generation of libraries with over 108 clones from a single E. coli transformation, which is more efficient than conventional error-prone PCR
Investigation of genetic modification in maize and soymilkFrank Soto
This document summarizes a student's experiment to identify genetically modified organisms (GMOs) using DNA extraction and polymerase chain reaction (PCR). The student aimed to identify three genes (35S promoter, NOS terminator, and PSII) in samples of corn, soy milk, papaya, and corn chips. DNA was extracted from the samples and PCR was performed to amplify the target genes. Electrophoresis revealed bands at 203bp and 225bp in the corn sample, indicating it contains the 35S and NOS genes and is genetically modified. The results for soy milk, papaya, and corn chips were inconclusive. The experimenter concluded the maize was genetically modified but the methods need improvement through repetition.
Application of Marker Assisted Selection (MAS) for the improvement of Bean Co...CIAT
The document summarizes efforts to develop common bean varieties in Rwanda resistant to Bean Common Mosaic Necrotic Virus (BCMNV) using Marker Assisted Selection (MAS). Researchers screened 219 bean varieties and identified genes conferring resistance. They developed 86 breeding lines by crossing donor lines containing resistance genes with local varieties. These lines were selected using linked markers and for resistance to BCMNV and other diseases. Participatory plant breeding involved farmers in selection. The integration of conventional breeding and MAS was successful in pyramiding resistance genes and developing lines adapted to Rwanda.
Allele mining in orphan underutilized cropsCCS HAU, HISAR
This document discusses allele mining as a research field aimed at identifying allelic variation in genetic resources collections that can be used for crop improvement. It defines key terms like alleles, orphan crops, and describes two major approaches for allele mining - TILLING and sequencing-based methods. Case studies on allele mining in cassava and sorghum are presented, outlining methodology used and results obtained, including the identification of superior alleles. The prospects of allele mining in molecular plant breeding are discussed, and the need for standardizing bioinformatics tools and developing advanced strategies to efficiently identify novel alleles from genetic resources.
Improved vector design eases cell line development workflow in the CHOZN GS-/...Merck Life Sciences
This poster was presented at ESACT meeting in 2017 in Lausanne, Switzerland. Cell line development for production of monoclonal antibody therapeutics requires an expression vector encoding both the heavy and light chains of the antibody. When expression of the heavy and lights chains is driven by the same promoter, the sequence redundancy can be problematic for verifying the vector sequence, copy number and insertion site in the host cell genome. This poster describes the work done to identify an expression vector that maintains a high level of antibody expression but lacks the sequence similarities, easing the cell line development workflow.
This document summarizes a study examining the use of biodegradable nanoparticles loaded with TGF-β and IL-2 cytokines and targeted to CD4+ cells for inducing and maintaining regulatory T cells (Tregs). The nanoparticles were able to induce CD4+ Tregs in vitro and expand their numbers in vivo. Nanoparticle-induced Tregs demonstrated enhanced stability and retained their suppressive phenotype even in inflammatory conditions, highlighting the potential of this nanoparticle approach for stabilizing Tregs to treat autoimmune disease and inflammation.
This summary analyzes the mRNA expression levels of the Gmhsp17.6-L gene in soybean genotypes that are resistant or susceptible to the root-knot nematode Meloidogyne javanica. Previous research identified a microsatellite marker, 176 Soy HSP, that strongly correlates with resistance to M. javanica. Sequencing of this marker revealed similarity to the promoter region of the Gmhsp17.6-L gene. The study examines levels of Gmhsp17.6-L mRNA transcripts in resistant and susceptible genotypes using ribonuclease protection assay and quantitative PCR. Results indicate higher mRNA levels in resistant genotypes, which had larger AT(n) insertions in the Gmhsp17
This document describes the construction of an expression vector called pET-DB that contains a downstream box (DB) sequence to enhance protein expression in E. coli. The DB sequence matches the anti-DB sequence in 16S rRNA and facilitates translation initiation. Four genes were cloned into pET-DB and a control vector without the DB to test expression levels. Results showed that pET-DB increased protein expression by 35-70% compared to the control vector. The improved expression and ability to easily purify proteins with a His-tag make pET-DB a useful vector for high-level protein production in E. coli.
This study analyzed genetic variation in the DREB1A and DREB1B genes across 20 rice genotypes with different responses to low temperature stress. Sequencing found a few single nucleotide polymorphisms and indels in the coding and non-coding regions of the genes. However, none of the variations were found to be associated with cold tolerance based on seedling stage phenotypes. Expression analysis also found induction of both genes in tolerant and susceptible genotypes upon cold treatment. Comparison of 400 rice varieties additionally found low nucleotide diversity in DREB1A, DREB1B and a related gene MYB2 compared to other rice genes, suggesting the cold response pathway is highly conserved. Overall, the results indicate natural allelic variations in DREB
Gene editing with CRISPR/Cas9: sorghum as a case studyapaari
This document summarizes a presentation on using CRISPR/Cas9 gene editing to improve sorghum. The presentation discusses using gene editing to increase grain size and protein content in sorghum, which could improve its use for animal feed. It describes ongoing research knocking out specific genes to increase grain size by over 10% and protein content by up to 24%. If successful, this could increase sorghum yields and protein per hectare for uses like poultry feed. The presentation notes that gene edited crops may not be classified as GMOs, depending on regulatory decisions, and outlines ongoing research using this technology in sorghum.
This thesis examines how probiotics modulate immune responses by stimulating bone marrow-derived dendritic cells (BMDCs) and basophils (BMBs) in co-culture experiments. Flow cytometry was used to analyze cell surface markers, transcription factors, and cytokines produced. Results showed that BMBs stimulated with probiotics increased IL-4 production, which is involved in Th2 polarization. BMDCs stimulated with probiotics increasingly produced cytokines that promote Th1, Th17, and Treg polarization. Co-cultures of BMDCs and BMBs likely enhanced Th2 immune responses. The probiotic strains Lactobacillus plantarum WCFS1 and Lactobacillus casei BL
I reviewed several manuscripts, books, grants and project proposals. This is one of the paper I reviewed recently published in Plant Biotechnology Journal
Pyramiding of bacterial blight resistance genes in riceawareswapnil1111
This document describes the materials and methods used to pyramid genes for resistance to bacterial blight in rice. It involves using four near-isogenic lines and their recurrent parents that contain different resistance genes. The plants were grown in fields and screened for resistance to different races of the bacterial blight pathogen. DNA markers linked to the resistance genes were used to select plants in the F2 and subsequent generations that were homozygous for multiple resistance genes, resulting in lines with different combinations of two or more genes conferring bacterial blight resistance. Southern analysis and PCR were used with the DNA markers to select targeted plants at different stages of the breeding program.
This document describes a study that generated a synthetic antibody library with predefined complementarity determining regions (CDRs) for high-throughput antibody selection. The library was constructed using oligonucleotides encoding designed CDR sequences synthesized on microarrays. The library was used to select novel antibodies against four human protein targets. Enriched CDR sequences from early selection rounds were identified and reconstructed to generate a consensus antibody specific for each target.
The current study investigated the immunomodulatory
potential of ethyl acetate soluble supernatant of
Lactobacillus casei (LC-EAS) in vitro. The effect of
LC-EAS on nitric oxide release was analyzed in RAW
264.7 cells, wherein, an inhibition in nitric oxide production
through suppression of inducible nitric oxide synthase
mRNA expression was observed. Evaluation of LC-EAS
on LPS-induced peripheral blood mononuclear cells
showed a down-regulation in TNF-a and IL-6 genes and an
upregulation of IL-10. An inhibition in the protein
expression of NF-kB, ERK1/2 and STAT3 phosphorylation
confirms the immunomodulatory potential of LC-EAS. The
effect of LC-EAS on in vitro intestinal epithelial cells was
investigated using HT-29 human colon adenocarcinoma
cancer cells. LC-EAS exhibited an inhibition of NF-jB and
ERK1/2 phosphorylation, whereas STAT3 phosphorylation
was unregulated. To evaluate the downstream target of
STAT3 upregulation, expression of the intestinal trefoil
factor TFF3 which is a NF-jB regulator and STAT3
downstream target was studied. LC-EAS was observed to
elevate TFF3 mRNA expression. Overall the study shows
that the anti-inflammatory potential of LC-EAS is through
inhibition of NF-kB in different cell types.
This document summarizes research on the Scr74 gene family in Phytophthora infestans and how different variants of this gene are recognized in potato genotypes. The key points are:
1. 27 variants of the Scr74 effector gene were identified from 12 P. infestans isolates. 4 novel variants were cloned.
2. 13 amino acid sites in Scr74 were found to be under positive diversifying selection, indicating these sites are important for pathogen recognition.
3. 17 Scr74 variants were screened using PVX assays on 12 potato genotypes. Some genotypes had strong cell death responses to specific Scr74 variants, suggesting recognition of these variants.
4. Scr74 variants Scr74-A
Transformation of signal sequence by reporter gene fusion technology was attempted. The promoter containing signal sequences was taken from Erwinia carotovora, a plant pathogenic soil bacterium. Plasmid DNA (Deoxyribonucleic acid) and genomic DNA were cleaved by BamHI and Sau3A1, respectively. Result of gel electrophoresis reveals successful cutting of restriction enzyme in both plasmid and genomic DNA. Best banding was found in 0.75 U/mg DNA of Sau3A1 compared to other concentrations of Sau3A1 used. Bacterial growth was found on LBcmp (Luria-Bertani) plates, since chloramphenicol resistance ability was pre-existed in this plasmid. Highest colony forming unit was observed with ligation ratio (1:5). It was also evident that the cells have been successfully transformed with the plasmid resulting notable growth of bacteria in LBamp plate.
The document discusses different host systems for producing recombinant proteins, including prokaryotic and eukaryotic systems. It focuses on the bacterial expression system Escherichia coli (E. coli) as a widely used prokaryotic host. While E. coli allows high levels of recombinant protein expression at low cost, it has limitations such as a lack of post-translational modifications and improper protein folding. Recent research has shown some success in secreting recombinant proteins from E. coli to circumvent some of these limitations. The document examines advantages and challenges of various host systems for recombinant protein production.
This paper describes a novel method for generating large libraries for directed evolution of proteins using error-prone PCR and a Kunkel-like mutagenesis reaction. The method uses error-prone PCR to generate a mutated DNA fragment, with one primer containing phosphorothioate modifications. Treatment with exonuclease preferentially removes the non-modified strand, generating a single-stranded "megaprimer". This megaprimer is then used in a Kunkel-like reaction with a uracilated template to introduce mutations efficiently without subcloning. This approach enables generation of libraries with over 108 clones from a single E. coli transformation, which is more efficient than conventional error-prone PCR
Investigation of genetic modification in maize and soymilkFrank Soto
This document summarizes a student's experiment to identify genetically modified organisms (GMOs) using DNA extraction and polymerase chain reaction (PCR). The student aimed to identify three genes (35S promoter, NOS terminator, and PSII) in samples of corn, soy milk, papaya, and corn chips. DNA was extracted from the samples and PCR was performed to amplify the target genes. Electrophoresis revealed bands at 203bp and 225bp in the corn sample, indicating it contains the 35S and NOS genes and is genetically modified. The results for soy milk, papaya, and corn chips were inconclusive. The experimenter concluded the maize was genetically modified but the methods need improvement through repetition.
Application of Marker Assisted Selection (MAS) for the improvement of Bean Co...CIAT
The document summarizes efforts to develop common bean varieties in Rwanda resistant to Bean Common Mosaic Necrotic Virus (BCMNV) using Marker Assisted Selection (MAS). Researchers screened 219 bean varieties and identified genes conferring resistance. They developed 86 breeding lines by crossing donor lines containing resistance genes with local varieties. These lines were selected using linked markers and for resistance to BCMNV and other diseases. Participatory plant breeding involved farmers in selection. The integration of conventional breeding and MAS was successful in pyramiding resistance genes and developing lines adapted to Rwanda.
Allele mining in orphan underutilized cropsCCS HAU, HISAR
This document discusses allele mining as a research field aimed at identifying allelic variation in genetic resources collections that can be used for crop improvement. It defines key terms like alleles, orphan crops, and describes two major approaches for allele mining - TILLING and sequencing-based methods. Case studies on allele mining in cassava and sorghum are presented, outlining methodology used and results obtained, including the identification of superior alleles. The prospects of allele mining in molecular plant breeding are discussed, and the need for standardizing bioinformatics tools and developing advanced strategies to efficiently identify novel alleles from genetic resources.
Improved vector design eases cell line development workflow in the CHOZN GS-/...Merck Life Sciences
This poster was presented at ESACT meeting in 2017 in Lausanne, Switzerland. Cell line development for production of monoclonal antibody therapeutics requires an expression vector encoding both the heavy and light chains of the antibody. When expression of the heavy and lights chains is driven by the same promoter, the sequence redundancy can be problematic for verifying the vector sequence, copy number and insertion site in the host cell genome. This poster describes the work done to identify an expression vector that maintains a high level of antibody expression but lacks the sequence similarities, easing the cell line development workflow.
This document summarizes a study examining the use of biodegradable nanoparticles loaded with TGF-β and IL-2 cytokines and targeted to CD4+ cells for inducing and maintaining regulatory T cells (Tregs). The nanoparticles were able to induce CD4+ Tregs in vitro and expand their numbers in vivo. Nanoparticle-induced Tregs demonstrated enhanced stability and retained their suppressive phenotype even in inflammatory conditions, highlighting the potential of this nanoparticle approach for stabilizing Tregs to treat autoimmune disease and inflammation.
This summary analyzes the mRNA expression levels of the Gmhsp17.6-L gene in soybean genotypes that are resistant or susceptible to the root-knot nematode Meloidogyne javanica. Previous research identified a microsatellite marker, 176 Soy HSP, that strongly correlates with resistance to M. javanica. Sequencing of this marker revealed similarity to the promoter region of the Gmhsp17.6-L gene. The study examines levels of Gmhsp17.6-L mRNA transcripts in resistant and susceptible genotypes using ribonuclease protection assay and quantitative PCR. Results indicate higher mRNA levels in resistant genotypes, which had larger AT(n) insertions in the Gmhsp17
This document describes the construction of an expression vector called pET-DB that contains a downstream box (DB) sequence to enhance protein expression in E. coli. The DB sequence matches the anti-DB sequence in 16S rRNA and facilitates translation initiation. Four genes were cloned into pET-DB and a control vector without the DB to test expression levels. Results showed that pET-DB increased protein expression by 35-70% compared to the control vector. The improved expression and ability to easily purify proteins with a His-tag make pET-DB a useful vector for high-level protein production in E. coli.
This study analyzed genetic variation in the DREB1A and DREB1B genes across 20 rice genotypes with different responses to low temperature stress. Sequencing found a few single nucleotide polymorphisms and indels in the coding and non-coding regions of the genes. However, none of the variations were found to be associated with cold tolerance based on seedling stage phenotypes. Expression analysis also found induction of both genes in tolerant and susceptible genotypes upon cold treatment. Comparison of 400 rice varieties additionally found low nucleotide diversity in DREB1A, DREB1B and a related gene MYB2 compared to other rice genes, suggesting the cold response pathway is highly conserved. Overall, the results indicate natural allelic variations in DREB
Gene editing with CRISPR/Cas9: sorghum as a case studyapaari
This document summarizes a presentation on using CRISPR/Cas9 gene editing to improve sorghum. The presentation discusses using gene editing to increase grain size and protein content in sorghum, which could improve its use for animal feed. It describes ongoing research knocking out specific genes to increase grain size by over 10% and protein content by up to 24%. If successful, this could increase sorghum yields and protein per hectare for uses like poultry feed. The presentation notes that gene edited crops may not be classified as GMOs, depending on regulatory decisions, and outlines ongoing research using this technology in sorghum.
This thesis examines how probiotics modulate immune responses by stimulating bone marrow-derived dendritic cells (BMDCs) and basophils (BMBs) in co-culture experiments. Flow cytometry was used to analyze cell surface markers, transcription factors, and cytokines produced. Results showed that BMBs stimulated with probiotics increased IL-4 production, which is involved in Th2 polarization. BMDCs stimulated with probiotics increasingly produced cytokines that promote Th1, Th17, and Treg polarization. Co-cultures of BMDCs and BMBs likely enhanced Th2 immune responses. The probiotic strains Lactobacillus plantarum WCFS1 and Lactobacillus casei BL
I reviewed several manuscripts, books, grants and project proposals. This is one of the paper I reviewed recently published in Plant Biotechnology Journal
Pyramiding of bacterial blight resistance genes in riceawareswapnil1111
This document describes the materials and methods used to pyramid genes for resistance to bacterial blight in rice. It involves using four near-isogenic lines and their recurrent parents that contain different resistance genes. The plants were grown in fields and screened for resistance to different races of the bacterial blight pathogen. DNA markers linked to the resistance genes were used to select plants in the F2 and subsequent generations that were homozygous for multiple resistance genes, resulting in lines with different combinations of two or more genes conferring bacterial blight resistance. Southern analysis and PCR were used with the DNA markers to select targeted plants at different stages of the breeding program.
This document describes a study that generated a synthetic antibody library with predefined complementarity determining regions (CDRs) for high-throughput antibody selection. The library was constructed using oligonucleotides encoding designed CDR sequences synthesized on microarrays. The library was used to select novel antibodies against four human protein targets. Enriched CDR sequences from early selection rounds were identified and reconstructed to generate a consensus antibody specific for each target.
The current study investigated the immunomodulatory
potential of ethyl acetate soluble supernatant of
Lactobacillus casei (LC-EAS) in vitro. The effect of
LC-EAS on nitric oxide release was analyzed in RAW
264.7 cells, wherein, an inhibition in nitric oxide production
through suppression of inducible nitric oxide synthase
mRNA expression was observed. Evaluation of LC-EAS
on LPS-induced peripheral blood mononuclear cells
showed a down-regulation in TNF-a and IL-6 genes and an
upregulation of IL-10. An inhibition in the protein
expression of NF-kB, ERK1/2 and STAT3 phosphorylation
confirms the immunomodulatory potential of LC-EAS. The
effect of LC-EAS on in vitro intestinal epithelial cells was
investigated using HT-29 human colon adenocarcinoma
cancer cells. LC-EAS exhibited an inhibition of NF-jB and
ERK1/2 phosphorylation, whereas STAT3 phosphorylation
was unregulated. To evaluate the downstream target of
STAT3 upregulation, expression of the intestinal trefoil
factor TFF3 which is a NF-jB regulator and STAT3
downstream target was studied. LC-EAS was observed to
elevate TFF3 mRNA expression. Overall the study shows
that the anti-inflammatory potential of LC-EAS is through
inhibition of NF-kB in different cell types.
This document summarizes research on the Scr74 gene family in Phytophthora infestans and how different variants of this gene are recognized in potato genotypes. The key points are:
1. 27 variants of the Scr74 effector gene were identified from 12 P. infestans isolates. 4 novel variants were cloned.
2. 13 amino acid sites in Scr74 were found to be under positive diversifying selection, indicating these sites are important for pathogen recognition.
3. 17 Scr74 variants were screened using PVX assays on 12 potato genotypes. Some genotypes had strong cell death responses to specific Scr74 variants, suggesting recognition of these variants.
4. Scr74 variants Scr74-A
Transformation of signal sequence by reporter gene fusion technology was attempted. The promoter containing signal sequences was taken from Erwinia carotovora, a plant pathogenic soil bacterium. Plasmid DNA (Deoxyribonucleic acid) and genomic DNA were cleaved by BamHI and Sau3A1, respectively. Result of gel electrophoresis reveals successful cutting of restriction enzyme in both plasmid and genomic DNA. Best banding was found in 0.75 U/mg DNA of Sau3A1 compared to other concentrations of Sau3A1 used. Bacterial growth was found on LBcmp (Luria-Bertani) plates, since chloramphenicol resistance ability was pre-existed in this plasmid. Highest colony forming unit was observed with ligation ratio (1:5). It was also evident that the cells have been successfully transformed with the plasmid resulting notable growth of bacteria in LBamp plate.
The document discusses different host systems for producing recombinant proteins, including prokaryotic and eukaryotic systems. It focuses on the bacterial expression system Escherichia coli (E. coli) as a widely used prokaryotic host. While E. coli allows high levels of recombinant protein expression at low cost, it has limitations such as a lack of post-translational modifications and improper protein folding. Recent research has shown some success in secreting recombinant proteins from E. coli to circumvent some of these limitations. The document examines advantages and challenges of various host systems for recombinant protein production.
Role of biotechnology in enhancing fruit crop production and qualityankit gawri
It was evident that developed biotechnological approaches have the potential to enhance the yield, quality, and shelf-life of fruits and vegetables to meet the demands of the 21st century. However, the developed biotech approaches for fruits and vegetables were more of academic jargon than a commercial reality
This PPT has described how to produce soluble anf high amount of recombinant protein in E.coli host. This PPT has mentioned different expression vectors, different E.coli Expression host strain and other strategies for getting high expression of desired gene.
Rice is a major staple food worldwide and can be genetically modified using various methods like Agrobacterium-mediated transformation, biolistic transformation, and chloroplast transformation. Agrobacterium transformation has advantages like simplicity but is limited by host specificity. Biolistic transformation has the disadvantage of random integration and tissue damage. Chloroplast transformation involves constructing vectors by cloning homologous fragments and promoters before transforming rice chloroplasts. Co-cultivation on filter paper with cysteine gave non-browning calli for Agrobacterium transformation selection. Transgenic plants were confirmed using Southern blotting for all three methods.
The document describes research on pretreatment methods for agave bagasse to improve saccharification yields. Key findings include:
- Ionic liquid pretreatment was more effective at reducing cellulose crystallinity than alkaline hydrogen peroxide pretreatment for both raw and calcium oxalate-extracted bagasse.
- Calcium oxalate extraction prior to ionic liquid pretreatment significantly improved saccharification yields, but extraction reduced yields for alkaline hydrogen peroxide pretreatment.
- The study highlights the importance of understanding all plant cell wall components and how they impact biomass deconstruction. Ionic liquid generated the highest observed sugar yields.
Cloning and Characterization of Master Regulator of Systemic Acquired Resista...Akhilesh Rawat
The document describes research that cloned the npr1 gene, which encodes the non-expresser of PR proteins 1 protein and is a master regulator of systemic acquired resistance in plants. The researchers cloned the npr1 gene from mustard using PCR and sequenced it, finding 98% identity to reported npr1 genes. They transferred the cloned gene to tobacco through Agrobacterium-mediated transformation. The putative transgenic tobacco plants were confirmed using gene-specific PCR. Overexpression of npr1 has potential to provide broad-spectrum disease resistance in crops.
This document discusses transplastomics, which involves transferring genes into the plastid genome. It begins with an introduction to plastids and plastomes. Important milestones in plastid engineering from 1988 to 2013 are summarized. Methods for gene transfer include biolistics and PEG-mediated transformation. Selection of transformants relies on antibiotic or herbicide resistance genes. Case studies demonstrate expression of foreign genes conferring traits like abiotic stress tolerance, protein production, and carotenoid enhancement. While transplastomics offers advantages, drawbacks include challenges delivering DNA and achieving homoplasmy in some plant species.
An Understanding Of Bacterial Transformation By Plasmid DnaGina Buck
Bacterial plasmids are small, circular DNA molecules within bacteria that are separate from the bacterial chromosome. Plasmids can contain genes that provide bacteria with useful traits like antibiotic resistance. During genetic transformation, the plasmid is introduced to recipient bacteria where it can be replicated independently of the bacterial chromosome. The foreign DNA from the plasmid is then expressed in the recipient bacteria, altering its genotype and phenotype. This allows bacteria to horizontally acquire new genes from plasmids and gain traits like antibiotic resistance without direct contact between bacterial cells.
Crimson publishers-5-MethylcytosineDNA Methylation Patterns among Gut Predomi...CrimsonpublishersMedical
5-MethylcytosineDNA Methylation Patterns among Gut Predominate Commensal Escherichia coli and Lactobacilli from the Balbas and Mazekh Domestic Sheep Breeds by Pepoyan AZ* in Research in Medical &Engineering Sciences
This document discusses cisgenesis and intragenesis, which involve genetically modifying a crop plant using genes isolated from a crossable donor plant or from the same plant species, respectively. It defines cisgenic and intragenic plants and outlines their similarities and differences. It describes the prerequisites and various methods for constructing intragenic vectors and producing marker-free cisgenic/intragenic plants. The document presents several case studies demonstrating the development and evaluation of cisgenic plants with improved disease resistance. It discusses regulations around cisgenic/intragenic crops in different countries and potential benefits compared to transgenic and conventional breeding approaches.
Virus-induced gene silencing (VIGS) is described as a method to silence target genes in barley seedling leaves using barley stripe mosaic virus (BSMV) vectors. The procedure involves cloning gene fragments into BSMV RNA vectors, generating in vitro transcripts, and rub inoculating seedling leaves. As a control, a phytoene desaturase (PDS) fragment is used, which results in photobleached leaves. Two non-overlapping fragments of the brassinosteroid-insensitive 1 (BRI1) gene are also cloned and shown to cause dwarfing symptoms when silenced. The method allows for rapid phenotypic analysis of gene function in barley compared to stable transformation.
This document discusses clean gene technology for developing transgenic plants without selectable marker genes. It presents 5 methods for producing marker-free transgenic plants: 1) co-transformation, 2) site-specific recombination-mediated marker deletion using the Cre/loxP system, 3) transposon-based marker methods, 4) intrachromosomal recombination, and 5) removal of chloroplast marker genes using homologous recombination. Each method is described briefly along with their advantages and limitations. The document concludes with a list of references on clean gene technology and selectable marker genes.
Majority of agronomic traits are quantitative and are controlled polygenetically.Instead of producing transgenic plants through single gene transfer many researchers are attempting on multigene engineering. The simultaneous transfer of multiple genes in to plants will enable us to produce plants with more desirable characters. Engineering of genes coding for complete metabolic pathways, bacterial operons or biopharmaceuticals that require an assembly of complex multisubunit proteins etc are some of the successful examples of multigene engineering.
This document discusses techniques for engineering bacteriophages (phages) to enhance their potential as antimicrobial agents. It describes various methods for genetically modifying phage genomes, including homologous recombination, recombineering, and rebuilding genomes in vitro or in yeast. Synthetic phages have been engineered with broader host ranges or the ability to deliver genes conferring antibiotic sensitivity. Phage lysins have also been developed as antimicrobials targeting pathogens like MRSA. Overall, the document outlines how phage engineering is an area of active research with applications for treating antibiotic-resistant bacteria.
This document describes a study investigating gene duplication and evolution of the proC gene, which is involved in proline biosynthesis, across multiple species of Agrobacterium bacteria. The researchers identified multiple copies of the proC gene in the genomes of A. radiobacter K84, A. rhizogenes A4, and A. tumefaciens S4. They then used functional complementation assays to determine if individual proC genes from each species could allow E. coli cells to survive in a proline-deficient environment when inserted into a plasmid. All tested proC genes complemented growth except one duplicate from A. rhizogenes A4.
The document discusses developing a DNA vaccine for fish using chitosan nanoparticles to deliver plasmid DNA encoding the OMP38 gene of Vibrio anguillarum. Key points:
- Chitosan nanoparticles were developed to deliver the pVAOMP38 plasmid and protect it from nuclease degradation. Studies showed the nanoparticles maintained plasmid integrity.
- The pVAOMP38 plasmid was transfected into seabass kidney cells in vitro and shown to express.
- Fish were vaccinated by feeding with chitosan-pVAOMP38 nanoparticles, chitosan-empty vector, or chitosan alone. The fish were later challenged with V. anguillarum to evaluate vaccine efficiency.
The document presents on gene stacking, pathway engineering, and marker-free transgenic development strategies. It discusses various methods for combining multiple genes/traits into plants, including gene stacking, gene pyramiding, sexual hybridization, re-transformation, co-transformation, and marker-free techniques. The goal is to develop crops with improved agronomic traits through plant genome engineering approaches.
This document discusses a study on the transient expression of the Red Fluorescent Protein (RFP) gene in maize (Zea mays) callus tissue using particle bombardment. Specifically, it aims to evaluate the tissue culture response of different maize genotypes, construct an expression vector for particle-inflow gun mediated transformation of maize calli, and determine the strength and localization of RFP gene expression using confocal microscopy. Ten maize genotypes were chosen for the study. The expression vector will contain the RFP gene driven by the coconut promoter Cocosin. RFP expression will be observed after calli bombardment with the RFP gene coated on tungsten particles. This study hopes to contribute to genetic transformation methods in
1) Transgenic fish models carrying bacteriophage λ and plasmid pUR288 vectors were developed to improve methods for assessing health risks from environmental mutagens and establish new animal models for studying in vivo mutagenesis.
2) The bacteriophage λ transgenic medaka model uses the cII and lacI genes as mutational targets, allowing detection of mutations through packaging of the phage vector and infection of E. coli. Spontaneous mutation frequencies in medaka were comparable to rodent models.
3) Exposure to chemical mutagens like ENU induced concentration-dependent, tissue-specific, and time-dependent increases in cII mutations, demonstrating the utility of the transgenic fish model for studying mut
Similar to DNA construct instability in bacteria used for Agrobacterium mediated plant transformation (20)
An Examination of Effectuation Dimension as Financing Practice of Small and M...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Does Goods and Services Tax (GST) Leads to Indian Economic Development?iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Childhood Factors that influence success in later lifeiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Emotional Intelligence and Work Performance Relationship: A Study on Sales Pe...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Customer’s Acceptance of Internet Banking in Dubaiiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study of Employee Satisfaction relating to Job Security & Working Hours amo...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Consumer Perspectives on Brand Preference: A Choice Based Model Approachiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Student`S Approach towards Social Network Sitesiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Broadcast Management in Nigeria: The systems approach as an imperativeiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study on Retailer’s Perception on Soya Products with Special Reference to T...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study Factors Influence on Organisation Citizenship Behaviour in Corporate ...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Consumers’ Behaviour on Sony Xperia: A Case Study on Bangladeshiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Design of a Balanced Scorecard on Nonprofit Organizations (Study on Yayasan P...iosrjce
1. The document describes a study that designed a balanced scorecard for a nonprofit organization called Yayasan Pembinaan dan Kesembuhan Batin (YPKB) in Malang, Indonesia.
2. The balanced scorecard translated YPKB's vision and mission into strategic objectives across four perspectives: financial, customer, internal processes, and learning and growth.
3. Key strategic objectives included donation growth, budget effectiveness, customer satisfaction, reputation, service quality, innovation, and employee development. Customers perspective had the highest weighting, suggesting a focus on public service over financial growth.
Public Sector Reforms and Outsourcing Services in Nigeria: An Empirical Evalu...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Media Innovations and its Impact on Brand awareness & Considerationiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Customer experience in supermarkets and hypermarkets – A comparative studyiosrjce
- The document examines customer experience in supermarkets and hypermarkets in India through a survey of 418 customers.
- It finds that in supermarkets, previous experience, atmosphere, price, social environment and experience in other channels most influence customer experience, while in hypermarkets, previous experience, product assortment, social environment and experience in other channels are most influential.
- The study provides insights for retailers on key determinants of customer experience in each format to help them improve strategies and competitive positioning.
Social Media and Small Businesses: A Combinational Strategic Approach under t...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Secretarial Performance and the Gender Question (A Study of Selected Tertiary...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Implementation of Quality Management principles at Zimbabwe Open University (...iosrjce
This document discusses the implementation of quality management principles at Zimbabwe Open University's Matabeleland North Regional Centre. It begins with background information on ZOU and the importance of quality management in open and distance learning institutions. The study aimed to determine if quality management and its principles were being implemented at the regional centre. Key findings included that the centre prioritized customer focus and staff involvement. Decisions were made based on data analysis. The regional centre implemented a quality system informed by its policy documents. The document recommends ensuring staffing levels match needs and providing sufficient resources to the regional centre.
Organizational Conflicts Management In Selected Organizaions In Lagos State, ...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Your One-Stop Shop for Python Success: Top 10 US Python Development Providersakankshawande
Simplify your search for a reliable Python development partner! This list presents the top 10 trusted US providers offering comprehensive Python development services, ensuring your project's success from conception to completion.
Full-RAG: A modern architecture for hyper-personalizationZilliz
Mike Del Balso, CEO & Co-Founder at Tecton, presents "Full RAG," a novel approach to AI recommendation systems, aiming to push beyond the limitations of traditional models through a deep integration of contextual insights and real-time data, leveraging the Retrieval-Augmented Generation architecture. This talk will outline Full RAG's potential to significantly enhance personalization, address engineering challenges such as data management and model training, and introduce data enrichment with reranking as a key solution. Attendees will gain crucial insights into the importance of hyperpersonalization in AI, the capabilities of Full RAG for advanced personalization, and strategies for managing complex data integrations for deploying cutting-edge AI solutions.
Removing Uninteresting Bytes in Software FuzzingAftab Hussain
Imagine a world where software fuzzing, the process of mutating bytes in test seeds to uncover hidden and erroneous program behaviors, becomes faster and more effective. A lot depends on the initial seeds, which can significantly dictate the trajectory of a fuzzing campaign, particularly in terms of how long it takes to uncover interesting behaviour in your code. We introduce DIAR, a technique designed to speedup fuzzing campaigns by pinpointing and eliminating those uninteresting bytes in the seeds. Picture this: instead of wasting valuable resources on meaningless mutations in large, bloated seeds, DIAR removes the unnecessary bytes, streamlining the entire process.
In this work, we equipped AFL, a popular fuzzer, with DIAR and examined two critical Linux libraries -- Libxml's xmllint, a tool for parsing xml documents, and Binutil's readelf, an essential debugging and security analysis command-line tool used to display detailed information about ELF (Executable and Linkable Format). Our preliminary results show that AFL+DIAR does not only discover new paths more quickly but also achieves higher coverage overall. This work thus showcases how starting with lean and optimized seeds can lead to faster, more comprehensive fuzzing campaigns -- and DIAR helps you find such seeds.
- These are slides of the talk given at IEEE International Conference on Software Testing Verification and Validation Workshop, ICSTW 2022.
Things to Consider When Choosing a Website Developer for your Website | FODUUFODUU
Choosing the right website developer is crucial for your business. This article covers essential factors to consider, including experience, portfolio, technical skills, communication, pricing, reputation & reviews, cost and budget considerations and post-launch support. Make an informed decision to ensure your website meets your business goals.
Generating privacy-protected synthetic data using Secludy and MilvusZilliz
During this demo, the founders of Secludy will demonstrate how their system utilizes Milvus to store and manipulate embeddings for generating privacy-protected synthetic data. Their approach not only maintains the confidentiality of the original data but also enhances the utility and scalability of LLMs under privacy constraints. Attendees, including machine learning engineers, data scientists, and data managers, will witness first-hand how Secludy's integration with Milvus empowers organizations to harness the power of LLMs securely and efficiently.
Building Production Ready Search Pipelines with Spark and MilvusZilliz
Spark is the widely used ETL tool for processing, indexing and ingesting data to serving stack for search. Milvus is the production-ready open-source vector database. In this talk we will show how to use Spark to process unstructured data to extract vector representations, and push the vectors to Milvus vector database for search serving.
How to Get CNIC Information System with Paksim Ga.pptxdanishmna97
Pakdata Cf is a groundbreaking system designed to streamline and facilitate access to CNIC information. This innovative platform leverages advanced technology to provide users with efficient and secure access to their CNIC details.
Unlocking Productivity: Leveraging the Potential of Copilot in Microsoft 365, a presentation by Christoforos Vlachos, Senior Solutions Manager – Modern Workplace, Uni Systems
Ocean lotus Threat actors project by John Sitima 2024 (1).pptxSitimaJohn
Ocean Lotus cyber threat actors represent a sophisticated, persistent, and politically motivated group that poses a significant risk to organizations and individuals in the Southeast Asian region. Their continuous evolution and adaptability underscore the need for robust cybersecurity measures and international cooperation to identify and mitigate the threats posed by such advanced persistent threat groups.
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-und-domino-lizenzkostenreduzierung-in-der-welt-von-dlau/
DLAU und die Lizenzen nach dem CCB- und CCX-Modell sind für viele in der HCL-Community seit letztem Jahr ein heißes Thema. Als Notes- oder Domino-Kunde haben Sie vielleicht mit unerwartet hohen Benutzerzahlen und Lizenzgebühren zu kämpfen. Sie fragen sich vielleicht, wie diese neue Art der Lizenzierung funktioniert und welchen Nutzen sie Ihnen bringt. Vor allem wollen Sie sicherlich Ihr Budget einhalten und Kosten sparen, wo immer möglich. Das verstehen wir und wir möchten Ihnen dabei helfen!
Wir erklären Ihnen, wie Sie häufige Konfigurationsprobleme lösen können, die dazu führen können, dass mehr Benutzer gezählt werden als nötig, und wie Sie überflüssige oder ungenutzte Konten identifizieren und entfernen können, um Geld zu sparen. Es gibt auch einige Ansätze, die zu unnötigen Ausgaben führen können, z. B. wenn ein Personendokument anstelle eines Mail-Ins für geteilte Mailboxen verwendet wird. Wir zeigen Ihnen solche Fälle und deren Lösungen. Und natürlich erklären wir Ihnen das neue Lizenzmodell.
Nehmen Sie an diesem Webinar teil, bei dem HCL-Ambassador Marc Thomas und Gastredner Franz Walder Ihnen diese neue Welt näherbringen. Es vermittelt Ihnen die Tools und das Know-how, um den Überblick zu bewahren. Sie werden in der Lage sein, Ihre Kosten durch eine optimierte Domino-Konfiguration zu reduzieren und auch in Zukunft gering zu halten.
Diese Themen werden behandelt
- Reduzierung der Lizenzkosten durch Auffinden und Beheben von Fehlkonfigurationen und überflüssigen Konten
- Wie funktionieren CCB- und CCX-Lizenzen wirklich?
- Verstehen des DLAU-Tools und wie man es am besten nutzt
- Tipps für häufige Problembereiche, wie z. B. Team-Postfächer, Funktions-/Testbenutzer usw.
- Praxisbeispiele und Best Practices zum sofortigen Umsetzen
HCL Notes and Domino License Cost Reduction in the World of DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
Essentials of Automations: The Art of Triggers and Actions in FMESafe Software
In this second installment of our Essentials of Automations webinar series, we’ll explore the landscape of triggers and actions, guiding you through the nuances of authoring and adapting workspaces for seamless automations. Gain an understanding of the full spectrum of triggers and actions available in FME, empowering you to enhance your workspaces for efficient automation.
We’ll kick things off by showcasing the most commonly used event-based triggers, introducing you to various automation workflows like manual triggers, schedules, directory watchers, and more. Plus, see how these elements play out in real scenarios.
Whether you’re tweaking your current setup or building from the ground up, this session will arm you with the tools and insights needed to transform your FME usage into a powerhouse of productivity. Join us to discover effective strategies that simplify complex processes, enhancing your productivity and transforming your data management practices with FME. Let’s turn complexity into clarity and make your workspaces work wonders!
Let's Integrate MuleSoft RPA, COMPOSER, APM with AWS IDP along with Slackshyamraj55
Discover the seamless integration of RPA (Robotic Process Automation), COMPOSER, and APM with AWS IDP enhanced with Slack notifications. Explore how these technologies converge to streamline workflows, optimize performance, and ensure secure access, all while leveraging the power of AWS IDP and real-time communication via Slack notifications.
Infrastructure Challenges in Scaling RAG with Custom AI modelsZilliz
Building Retrieval-Augmented Generation (RAG) systems with open-source and custom AI models is a complex task. This talk explores the challenges in productionizing RAG systems, including retrieval performance, response synthesis, and evaluation. We’ll discuss how to leverage open-source models like text embeddings, language models, and custom fine-tuned models to enhance RAG performance. Additionally, we’ll cover how BentoML can help orchestrate and scale these AI components efficiently, ensuring seamless deployment and management of RAG systems in the cloud.
Ivanti’s Patch Tuesday breakdown goes beyond patching your applications and brings you the intelligence and guidance needed to prioritize where to focus your attention first. Catch early analysis on our Ivanti blog, then join industry expert Chris Goettl for the Patch Tuesday Webinar Event. There we’ll do a deep dive into each of the bulletins and give guidance on the risks associated with the newly-identified vulnerabilities.
Fueling AI with Great Data with Airbyte WebinarZilliz
This talk will focus on how to collect data from a variety of sources, leveraging this data for RAG and other GenAI use cases, and finally charting your course to productionalization.
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
For the full video of this presentation, please visit: https://www.edge-ai-vision.com/2024/06/building-and-scaling-ai-applications-with-the-nx-ai-manager-a-presentation-from-network-optix/
Robin van Emden, Senior Director of Data Science at Network Optix, presents the “Building and Scaling AI Applications with the Nx AI Manager,” tutorial at the May 2024 Embedded Vision Summit.
In this presentation, van Emden covers the basics of scaling edge AI solutions using the Nx tool kit. He emphasizes the process of developing AI models and deploying them globally. He also showcases the conversion of AI models and the creation of effective edge AI pipelines, with a focus on pre-processing, model conversion, selecting the appropriate inference engine for the target hardware and post-processing.
van Emden shows how Nx can simplify the developer’s life and facilitate a rapid transition from concept to production-ready applications.He provides valuable insights into developing scalable and efficient edge AI solutions, with a strong focus on practical implementation.
“Building and Scaling AI Applications with the Nx AI Manager,” a Presentation...
DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
1. IOSR Journal of Biotechnology and Biochemistry (IOSR-JBB)
e-ISSN: XXXX-XXXX, p-ISSN: XXXX-XXXX, Volume 1, Issue 6 (Sep. – Oct. 2015), PP 10-15
www.iosrjournals.org
www.iosrjournals.org 10 | Page
DNA construct instability in bacteria used for Agrobacterium
mediated plant transformation
1
Ihuoma C. Okwuonu,2
Ome K. Achi, 2
Uchechi N. Ekwenye, 1
Solomon O.
Afuape2
Francis A.Nkaa,1
Chiedozie N Egesi.
1
Biotechnology Programme, National Root Crops Research Institute, Umudike, km 8 Ikot Ekpene Road,
Umuahia, Abia State, Nigeria
2
Michael Okpara University of Agriculture, Umudike, Abia State, Nigeria
Abstract: The use of plasmid in the production of genetically modified (GM) crops is highly essential in
research and in commercial production of GM plants. However plasmid instability constitutes a major problem
in the use of recombined microorganisms in the production of GM crops. In this study we evaluated the stability
of p8114 carrying a gene coding for a transcription factor (TFIIIA) driven by Cassava Vein Mosaic Virus
(CsVMV) promoter and an nptII selectable marker driven by 35S promoter in the T-DNA. The plasmid was
amplified in E.coliDH5α strain on Luria Broth (LB)agar supplemented with 100 µg/ml kanamycin. The colonies
were confirmed by Restriction Fragment Length Analysis (RFLA) and by DNA sequencing. The confirmed
colonies were stored as glycerol stock at -800
C and as DNA extracts in TE buffer at 40
C. Agrobacterium strains
LBA4404, EHA 105 and AGL1 were also transformed with DNA from the confirmed colonies. Plasmid stability
was evaluated after 3 months. Sixteen to hundred percent level of instability was observed in E.colicolonies
stored at -800
C and 50% level of instability in plasmid transformed into Agrobacterium strain LBA4404.
Agrobacterium strain LBA4404 showed a higher level of stability 75% compared to EHA 105 (0%) and AGL1
(50%).
Key words: Plasmid instability, genetically modified crops, Escherichia coli, Agrobacterium tumefaciens,
I. Introduction
Development of genetically modified plant both as a proof of concept or for product development
depends essentially on the production of heterologous protein encoded by the gene of interest. However the
production of the desired protein depends on the expression of the target gene cloned in an expression vector
whether plasmid or phage. Plasmid instability as a result of insertion, deletion or plasmid rearrangement could
lead to loss of target gene and as a consequence lead to the transfer of incomplete or altered genetic sequence
which will produce aberrant gene product[1]. Lack of quality control of such plasmid constructed for the
production of economically important food and industrial crops could result to waste of resources, time and
labor in the production of plants deficient of the desired gene or protein product.
Gene of interest are often amplified from source and cloned into a vector in the form of plasmid or phage
for multiplication and transfer into target cells. Plasmids are extra-chromosomal pieces of DNA that possess an
autonomous origin of replication and have the ability to exist independently in bacteria cells[2]. They usually
have genes that code for specific traits such as antibiotic resistance which confers characteristic traits on cells
harboring them. Based on theseselectable markers, plasmids are essential for expression of foreign DNA in
heterologous host including prokaryotes and eukaryotes. Essential features for plasmid desired for genetic
engineering of plants include high copy number which amplifies the concentration of transcription template,
presence of several unique restriction sites that facilitates insertion of several genes coding for desired traits,
relatively manageable size that imposes less metabolic burden on the host and facilitates transfer to target cells
during transformation and of course genetic stability that ensures that the desired product is formed[3, 4].
Plasmid stability can be affected by both cellular and environmental conditions which includes, the
vector type and host genotype, origin and size of foreign DNA, increased metabolic burden and host culture
conditions [5]. Schmidt et al.[6] showed that plasmid stability in E.coli was increased in a cloning vector system
pEG1 constructed on the basis of pBR322 derivative by cloning parB locus of R1 plasmid to alkaline
phosphatase gene (phoA) promoter. They concluded that the combination of parB locus and phoA promoter
facilitated plasmid stabilization as a result of post-segragational killing of plasmid-free cells during growth.
Differential host plasmid stability has also been reported. Al-Allafet al. [7] reported of the DNA structural
change in a recombined plasmid harboring an HIV based cassette “50-Olig2cDNA-IRES-dsRed2-30” in recA1
E.coli strain Stbl2 during large-scale bacterial cultivation. However the same plasmid when introduced in
an,E.coli strain Stbl3 did not exhibit any form of structural change [7].
Also implicated for plasmid instability is the presence and transcription of specific sequences located on
plasmid expression vectors. Chiang and Bremer [8] showed that plasmid stability was enhanced by deleting a
region within the tetpromoter of pBR322[8,9]. There could probably exist such other sequences that affect the
2. DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
www.iosrjournals.org 11 | Page
stability of other plasmids [3]. DNA size is another factor that could affect the stability of plasmid in
recombinant bacteria. Warnes and Stephenson [10] showed that insertions of DNA fragment greater than 8 kb
affected plasmid stability[10,11]. Importantly also is the competition between plasmid positive (P+
) and plasmid
negative (P-
) cells which could lead to the depletion of P+
cells due to greater growth difference between the
two types of cells. This could however be controlled by the incorporation of selective pressure that enriches the
survival of cell carrying the recombined plasmid.
In this study, the stability of recombined plasmid in bacteria used in the production of genetically
modified cassava was investigated to determine the frequency of plasmid instability and therefore develop
quality control strategies for ensuring that bacteria host employed in this process contains plasmid with the
intact coding sequence required to achieve the targeted product as well as saving time, labor and cost.
II. Material and Methods
2.1. p8114 vector construction.
Gene expression cassette for TFIIIAdriven by cassava vein mosaic virus (CsVMV) promoter with
AtuORF23 terminator was amplified using specific primers AAATCTAGAGGTGACTGACTGAACTAAACC
(sense) and ATTAAGCTTGCAACCTGGGACTCCCAT (antisense). A 3.6-kb fragment was excised and
ligated to zero-blunt vector from Invitrogen following the manufacturer’s instruction. Two microliters of the
ligation reaction was used to transform DH5α competent cells and plated out on Luria Broth (LB) agar medium
containing 50 mg/l kanamycin. The resultant clones were screened using Ecor1 and Xma1 restriction enzyme in
a 50 µl reaction containing. Positive colonies and pCambia 2300 were first digested in a 30 µl reaction with
Xma1 restriction enzyme for a better resolution of the insert from zeroblunt backbone and then in a 50 µl
reaction with Xba1 and Hind III restriction enzymes. The 3.6kb TFIIIA fragment and 8.9kb pCambia 2300
fragment were gel cleaned and ligated in a 10 µl reaction using T4 DNA ligase from NEB (USA) following the
manufacturer’s instruction. Positive colonies were confirmed with Xba1/Hind III restriction reaction and
designated p8114 (Fig. 1). Agrobacterium LBA4404 was transformed with the positive colony and reconfirmed
by back transforming in E.coli.
2.2. DNA sequencing
DNA was extracted from overnight grown E.colicultures using QiagenDNeasy plasmid mini kit
(Qiagen, CA, USA) according to manufacturer’s instruction. The DNA samples were prepared for sequencing
by diluting the DNA to a concentration of 50 ng/µl. Five microliters of 5 µM sense and antisense primers were
separately added to the DNA samples and sent for sequencing at GENEWIZ (South plainfield, NJ, USA).
Sequence information obtained was edited and contiged using Lasagene (DNA star) program. Sequence
identities were confirmed by searching for homology in NCBI database.
2.3. Restriction Fragment Length Analysis (RFLA) of ZFN constructs
DNA extracted from glycerol stock of E.coliDH5α cultures stored at -800
C were screened using Xho1,
BamH1 and Bgl II restriction enzymes. The digestion reaction was carried out in a 20 µl volume reaction with 1
µg DNA concentration and appropriate buffer systems for the restriction enzymes as specified by NEB. The
reaction was incubated at 370
C for 1 hour. The DNA fragment were analyzed by separation on 1% agarose gel
electrophoresis and visualized by means of an alpha imager gel documentation system (Cell Bioscience Inc. CA,
USA).
Three different Agrobacterium strains; LBA4404, EHA 105, and AGl1 were transformed with p8114.
Electro-competent strains of theseAgrobacterium strains were transformed by electroporation using Gene
pulser®II (Bio-Rad, CA, USA) and incubated at 280
C for 4 hours. Successful transformants were selected on a
selection medium containing 30 µg/ml rifampicillin, 30 µg/ml streptomycin and 100 µg/ml kanamycin
(LB/RSK) plate incubated at 280
C for 2 to 3 days. Two colonies each from the three strains were grown
overnight and DNA extracted using QiagenDNeasy plasmid mini kit (Qiagen, CA, USA) according to
manufacturer’s instruction. The extracted DNA samples were used to transform E.coliDH5α competent cells
from invitrogen (CA, USA). These cells were plated out on a LB media supplemented with 100 µg/ml
kanamycin selection (LB/Kan)plate.Ten colonies were selected from each of the two DNA samples obtained
from the three different Agrobacterium strains.
The DNA was digested with Bgl II and Sac1 restriction enzymes as described above. Restriction
fragment were analyzed on 1% agarose gel as described above.
3. DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
www.iosrjournals.org 12 | Page
Fig 1: Schematic representation of p8114: A binary vector construct carrying transcription factor (TFIIIA) gene
driven by cassava vein mosaic virus (CVMV) promoter fused to a neomycin phosphotransferase II gene driven
by enhance cauliflower mosaic virus (CaMV) - 35S promoter
Fig 2: Restriction fragment length analysis (RFLA) of colonies harboring TFIIIA construct stored as glycerol
stock at -800
C. (A) Restriction pattern obtained with Xba1/HindIII double restriction reaction with four our of
the five colonies showing the expected fragment sizes of 8718 bp and 3614 bp derived from vNTI restriction
fragment analysis. (B) SacI restriction pattern of TFIIIA construct derived from same colonies with none of the
five colonies showing the expected 9238 bp and 3098 bp fragment sizes expected from vNTI restriction
fragment analysis. Colony showed a different construct size from the other four constructs
Fig 3: Restriction fragment length analysis (RFLA) of colonies transformed with TFIIIA construct stored at -
40
C. Sample I show expected fragment sizes of 8718 bp and 3614 bp for Xba1/HindII double restriction
determined from vNTI restriction fragment analysis. (II) shows expected fragment sizes of 9238 bp and 3094 bp
of SacI restriction determine from VNTI.
III. Result
3.1.Plasmid stability in E.coli and Agrobacterium
DNA extracted from E. coli DH5αglycerol stocks stored at -800
C and analyzed by RFLA using
Xba1/Hind III double restriction reaction and Sac1 restriction reaction are shown in Figure 2. Five out of the six
colonies analyzed gave the expected 8718 and 3614 bps while one of the colonies remained uncut with Xba 1/
Hind III double restriction (Fig. 2A). For the Sac 1 restriction, surprisingly all six colonies did not give the
expected 9238 and 3094 bps (Fig. 2B). The DNA sample stored at 40
C were also analyzed with the same
restriction enzymes and gave the expected fragments of 8718 and 3614 bps with Xba1/Hind III restriction and
9238 and 3094 bps with Sac I restriction (Fig. 3). This original DNA was previously confirmed by sequencing
after cloning and stored at 40
C.
From the result obtained it is suspected that certain level of rearrangement might have occurred in the
glycerol stock. To confirm this, the TFIIIA expression cassette was amplified with sense and antisense primer
sets derived from TFIIIA coding sequence and sequence information was obtained from Genewiz sequencing
company (New Jersey, USA). Sequenced data returned, showed the presence of unidentified sequences within
the T-DNA region of the TFIIIA cassette when compared to the original sequence obtained after cloning (data
not shown). Several factors could be attributed to this phenomenon such as presence of transposable element,
stability in bacteria or storage temperature.
To further investigate the stability of p8114 construct and to confirm the likely effect of storage
temperature on plasmid stability, the DNA stored at 40
C was used to transform freshly prepared E.coliDH5α and
Agrobacterium LBA4404 competent cells. Successful transformants were selected on LB/Kan media for
4. DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
www.iosrjournals.org 13 | Page
E.colicolonies and on LB/RSK media for Agrobacterium colonies. Nine E.colicolonies were randomly selected
and DNA samples extracted were analyzed with Xho1, BamH1 and BglII restriction enzymes. All nine colonies
gave the expected restriction fragments of 7327, 4127 and 878 bps for Xho1 restriction, 9856, 1287 and 1189
bps for BamH1 restriction and 9485, 1612 and 1235 for BglII restriction (Fig. 4). Two resistant Agrobacterium
colonies were randomly selected and retransformed in E.colifrom which four colonies were randomly selected
and analyzed with Xho1, BamH1 and BglII restriction enzyme (Fig.5). All four E.colicolonies derived from
Agrobacterium colony 2 gave the expected restriction fragment sizes expected from the three restriction
enzymes while ¾ colonies derived from Agrobacterium 1 showed unexpected extra band when restricted with
Xho1, two showed unexpected fragment size with BamH1 and with BglII all the colonies showed certain level
of variation from the expected fragment sizes.
3.2.Stability of recombined plasmid in Agrobacterium strains LBA4404, EHA 105 and AGL1
The stability of p8114 was further evaluated in Agrobacterium strainsLBA4404, EHA105 and AGL1.
Two colonies of each strain were retransformed into E.colifor amplification. Twenty colonies, ten from each
Agrobacterium colony amplified in E.coli were analyzed for LBA4404, EHA 105 and AGL1 Agrobacterium
strains (Fig. 6). For the LBA4404 strain 25% of the colonies screened with BglII showed some level of
rearrangement and 30% with Sac1 restriction (Fig. 6A). Hundred percent of the EHA105 colonies showed
different restriction pattern from the control with both restriction enzymes (Fig. 6B) while 50% of AGL1
colonies differed from the control (Fig. 6C).
Fig 4: Restriction fragment length analysis (RFLA) of colonies derived from E.coliDH5α strain freshly
transformed with TFIIIA construct. Nine colonies were randomly selected and screened with (A) Xho1, (B)
BamH1 and (C) BglII restriction enzymes. All nine colonies gave the expected restriction pattern of 7327, 4127
and 878 bps for Xho1 restriction, 9856, 1287 and 1189 bps for BamH1 restriction and 9485, 1612 and 1235 for
BglII restriction. All restriction patterns were confirmed with vNTI restriction fragment analysis and with the
control sample X. The confirms the stability of TFIIIA construct in E.coliDH5α strain.
Fig 5: TFIIIA stability in two Agrobacterium LBA4404 back transformed in E.coli: Agrobacterium LBA4404 was
transformed with TFIIIA construct and successful transformants selected on LB/RSK medium. DNA extracted from two
randomly selected colonies were amplified in E.coliand screened for stability with (A) Xho1, (B) BamH1and (C) BglII
restriction enzymes. All four E.colicolonies derived from Agrobacterium 2 gave the expected restriction fragment sizes
expected from the three restriction enzymes while ¾ colonies derived from Agrobacterium 1 showed unexpected extra band
when restricted with Xho1, two showed unexpected fragment size with BamH1 and with BglII all the colonies showed
certain level of variation from the expected fragment sizes..
5. DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
www.iosrjournals.org 14 | Page
Fig 6: Restriction fragment length analysis of TFIIIA stability in different Agrobacterium strains:TFIIIA
construct was transformed into Agrobacterium strains LBA4404, EHA105, and AGL1. After 3 days growth,
DNA derived from these colonies were transformed into E.colifor amplification and analyzed with BglII and
Sac I restriction analysis. LBA4044 Agrobacterium strain showed the least level of rearrangement, 25% and
30% with BglII and SacI while EHA105 strain showed 100% level of rearrangement with both enzymes and
AGL1 50% rearrangement with both enzymes.
IV. Discussion
The TFIIIA construct stored at -800
C showed 17% rearrangement when analyzed with XbaI/Hind III
double digestion and 100% rearrangement with Sac 1 restriction enzyme. This result confirmed some level of
inconsistency in the quality of the TFIIIA recombinant DNA molecule and raises a concern with respect to the
effect of storage on the stability of the molecule. Nudelet al. [12] observed that the stability of expression of the
tryptophan (thr) operon cloned into pBR322 and introduced into E. coli depended both on the genetic
background of host as well as on environmental conditions. To investigate the effect of storage temperature on
the stability of recombinant TFIIIA molecule, TFIIIADNA molecule stored at 40
C was also analyzed using the
same set of enzymes. RFLA gave the expected fragment sizes of 8718 and 3614 bps with Xba1/Hind III
restriction and 9238 and 3094 bps with Sac 1 restriction (Fig. 2C). At this point the effect of storage on the
stability of TFIIIA was suspected.
To investigate this hypothesis, new E. coli DH5α strain was transformed with the DNA stored at
40
Cshowing the expected fragment length. All nine colonies screened did not show irregularities in the
restriction fragment pattern and thus suggests that storage at -800
C could have affected the stability of the
TFIIIA construct. There is need for further studies on the effect of low temperature on construct stability using
different constructs in different vector background. Instability of the TFIIIA molecule was shown to occur in
both E. coli DH5α strain stored at -800
C and in Agrobacterium LBA4404 strain in our study. This study is
essential towards the success of biotechnological process that depends on the use of plasmid DNA for product
development. It illustrates the importance of quality assurance of recombinant molecules before use in any
genetic transformation or fermentation process.
The stability of TFIIIA DNA molecule was also investigated in three Agrobacterium strains LBA 4404,
EHA 105 and AGL1 to determine the effect of host cell on the stability of the TFIIIA DNA molecule. Twenty
E. coli colonies each derived from two colonies of LBA4404, EHA 105 and AGL1 Agrobacterium strains were
analyzed. LBA4404 showed the least level of rearrangement among the three Agrobacterium strain with BglII
(25%) and Sac I (30%) restriction enzymes , EHA105 showed the highest level of rearrangement (100%) with
both restriction enzymes, while 50% of AGL1 showed level of rearrangement when analyzed with both
enzymes. DNA sequencing result of the rearranged molecule confirmed the insertion of about 7 kb sequences
originally not present in the molecule. This agrees with the findings of Nudelet al. [12] who showed that the
observed changes in the expression of tryptophan operon was due to the insertion of a DNA molecule of
approximately 5.6 kb. The data also showed that simply switching from LBA4404, as used in the present
6. DNA construct instability in bacteria used for Agrobacterium mediated plant transformation
www.iosrjournals.org 15 | Page
studies, to EHA105 of AGL1 would not have solved the problems encountered here, and described above,
related to recombination and rearrangements of the TFIIIA constructs.
V. Conclusion
In this study, we have shown that although Agrobacterium mediated transformation is widely
employed for the production of GM crops and is preferred over direct DNA transfer methods such as
microparticle bombardment mediated transformation, there is the likelihood of construct recombination in
Agrobacterium before transfer to target cells. This study also confirms the importance of proper quality
assurance of the recombinant DNA molecule prior to genetic transformation of plants to avoid waste of time and
labor in recovering events without the desired trait. There is a need to optimize the application of direct DNA
transfer methods such as microparticle bombardment, electroporation and polyethylene glycol for the
transformation of most GM crops as the use of minimal cassette in the transformation of most crop have proven
efficient in the production of quality transgenic crops with simple integration pattern, single copy number and
absence of vector backbone integration.
References
[1]. N. Kuniechick, R. Munareto, T. Milech de Assunção, G. Volpato, J. Chies, C. PaivaNunes, and D. Santiago Santos. "Determination
of the stability of recombinant plasmid containing the coding sequence of the human growth hormone in bioreactor."XSalão de
IniciaçãoCientífica PUCRS, 2009, 2829-2831.
[2]. A. Guruatma, K. Jiaquot;. Mama Ji's Molecular Kitchen. ASU - Ask A Biologist. Retrieved September 10, 2015 from
http://askabiologist.asu.edu/plasmids
[3]. P. Kumar, H. Maschke, K. Friehs, and K. Schügerl. Strategies for improving plasmid stability in genetically modified bacteria in
bioreactors. Trends in biotechnology, 9(1), 1991, 279-284.
[4]. F. Hoffmann, and U. Rinas. Stress induced by recombinant protein production in Escherichia coli. In Physiological Stress
Responses in Bioprocesses Springer Berlin Heidelberg 2004, 73-92.
[5]. M. Fakruddin, R. Mohammad Mazumdar, K. S. Bin Mannan, A. Chowdhury and M. N. Hossain, Critical factors affecting the
success of cloning, expression, and mass production of enzymes by recombinant E. coli. ISRN biotechnology, 2013.
[6]. T. Schweder, I. Schmidt, H. Herrmann, P. Neubauer, M. Hecker, and K. Hofmann, An expression vector system providing plasmid
stability and conditional suicide of plasmid-containing cells. Applied microbiology and biotechnology, 38(1), 1992), 91-93.
[7]. F. A. Al-Allaf, O. E. Tolmachov, L. P. Zambetti, V. Tchetchelnitski and H. Mehmet Remarkable stability of an instability-prone
lentiviral vector plasmid in Escherichia coli Stbl3. 3 Biotech, 3(1), 2013, 61-70.
[8]. C. S.Chiang and H. Bremer, Stability of pBR322-derived plasmids. Plasmid, 20(3), 1988, 207-220.
[9]. L. Olavarrieta, P. Hernandez, D. B. Krimer, and J. B. Schvartzman. DNA knotting caused by head-on collision of transcription and
replication. Journal of molecular biology, 322(1), 2002, 1-6.
[10]. A. Warnes and R. Stephensoin. The insertion of large pieces of foreign genetic material reduces the stability of bacterial plasmids.
Plasmid 16, , 1986, 116-123.
[11]. C. H.Collins and A. J. Beale,(Eds.), Safety in industrial microbiology and biotechnology. Elsevier. 2013
[12]. B. C. Nudel, B. Vosman, , M. J. T. De Mattos, K. J. Hellingwerf, and O. M. Neijssel, Increased stability of recombinant plasmids by
Tn1000 insertion in chemostat cultures of recombinantEscherichia coli GT123. Current Microbiology, 26(5), 1993, 281-286.