The study analyzed 100 multidrug-resistant Acinetobacter baumannii isolates from intensive care unit patients in Tehran, Iran between 2006 and 2011 to evaluate changes in genotypic diversity and antimicrobial susceptibility patterns. Resistance to antimicrobials tested increased between 0-30% within 5 years. By 2011, 6-100% of isolates were resistant to each agent tested. Genotypic changes among isolates were also drastic, with novel international clone variants comprising 36% of isolates in 2011. Resistance is growing for last-resort antimicrobials such as colistin and tigecycline.
Prevalence and Characterisation of Beta Lactamases in Multi Drug Resistant Gr...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Inducible Clindamycin Resistance in Staphylococcus Aureus: A Study from Weste...paperpublications3
Abstract: The resistance to antimicrobial agents among Staphylococci is an increasing problem. The resistance to macrolide can be mediated by msr a gene coding for efflux mechanism or via erm gene encoding for enzymes that confer inducible or constitutive resistance to macrolide, lincosamide and Type B streptogramin. The present study was aimed to find out the percentage of Staphylococcus aureus having inducible clindamycin resistance (iMLS B) in our geographic area using D-test.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri M...Scientific Review
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44 were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42) tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes (MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1 and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
Prevalence and Characterisation of Beta Lactamases in Multi Drug Resistant Gr...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
Inducible Clindamycin Resistance in Staphylococcus Aureus: A Study from Weste...paperpublications3
Abstract: The resistance to antimicrobial agents among Staphylococci is an increasing problem. The resistance to macrolide can be mediated by msr a gene coding for efflux mechanism or via erm gene encoding for enzymes that confer inducible or constitutive resistance to macrolide, lincosamide and Type B streptogramin. The present study was aimed to find out the percentage of Staphylococcus aureus having inducible clindamycin resistance (iMLS B) in our geographic area using D-test.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri M...Scientific Review
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44 were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42) tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes (MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1 and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
Evaluation of resistance profile of pseudomonas aeruginosa with reference to ...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
ANTIMICROBIAL RESISTANCE PATTERNS AMONG ACINETOBACTER BAUMANNII ISOLATED FROM...inventionjournals
Acinetobacter baumannii (Ab) is a troublesome and increasingly problematic healthcareassociated pathogen, especially in critical care unit (ICU) and cardiovascular internal medicine (CIM). This organism has a capacity for long-term survival in the hospital environment. This study aimed to investigate the drug resistance patterns of Ab strains isolated from Thongnhat Dongnai General Hospital and the relationships between Ab isolations with clinical wards and year of patients. The antibiotic susceptibility of 279 Ab isolates for aminoglycosides, fluro-quinolons, cephalosporins, carbapenems, colistin and bactrim was determined using Kirby-Bauer disk diffusion method. The minimum inhibitor concentration (MIC) of 146 Ab isolates for Meropenem was determined using E-test method according to CLSI guide-line. A total 279 A. baumannii strains out of 1,976 positive isolates were collected from various specimens during study period. Among Ab-positive specimens, the most isolated specimen was sputum (26.6%, χ 2 =161.705 p<0.000),><0.000)><0.000),><0.000). Among 279 Ab isolated, resistance from 53.16% – 63.52% to aminoglycosides, 23.6% – 68.58% to fluroquinolons, 59.61% to 97.93% to cephalosporins, 60.27% to 80.7% to carbapenem, 10.53% to 66.48% to antibiotic combinations, 0.75% to colistin and 61.71% to bactrim. Among 146 multidrug-resistant Ab, 53.42% MICmeropenem ≥ 32 μg/ml and only 18.49% strains were susceptible to Meropenem. Due to the high antimicrobial resistance to two clinical wards (ICU and CIM) and carbapenems by disk agar diffusion test and E-test; we must focus on both a wiser use of antimicrobials and the prevention of infection. Continuous monitoring of antimicrobial susceptibility and strict adherence to infection prevention guidelines are essential to eliminate major outbreaks in the future.
Incidence rate of multidrug-resistant organisms in a tertiary care hospital, ...Apollo Hospitals
Antimicrobial resistance to microorganisms is a growing public health concern globally, especially in developing countries. This study was conducted to study the incidence rate of multidrug-resistant organisms with their antibiotic sensitivity pattern.
Antimicrobial Susceptibility, Biochemical Characterization and Molecular Typi...wilhelm mendel
Pathogenic isolates of Klebsiella pneumoniae (K. pneumoniae), particularly the extended-spectrum β-lactamase (ESBL) producing strains, are mostly associated with the failure of antibiotic therapy in nosocomial infections. The present work was designed to evaluate the impact of Mr. Trivedi’s biofield energy treatment on phenotypic and genotypic characteristics of K. pneumoniae. The strain of K. pneumoniae bearing ATCC 15380 (American Type Culture Collection) was procured from the Bangalore Genei, in sealed pack and divided into control and treated groups. Treated group was subjected to Mr. Trivedi’s biofield energy treatment and analyzed for the antimicrobial susceptibility, minimum inhibitory concentration (MIC), biochemical reactions, and biotyping using automated MicroScan Walk-Away® system. Further, the effect of biofield treatment was also evaluated using Random Amplified Polymorphic DNA (RAPD) in order to determine their epidemiological relatedness and genetic characteristics of biofield treated K. pneumoniae samples. The antimicrobial susceptibility results showed an improve sensitivity (i.e. from intermediate to susceptible) of ampicillin/sulbactam and chloramphenicol, while altered sensitivity of cephalothin (i.e. from susceptible to intermediate) was also reported as compared to the control sample. The MIC value showed two-fold decrease in MIC value of ampicillin/sulbactam (i.e. 16/8 to ≤8/4 μg/mL) and chloramphenicol (i.e. 16 to ≤ 8 μg/mL) as compared to the control. The cephalothin showed two-folds change (i.e. ≤ 8 to 16 μg/mL) in the MIC value as compared with the control. Biofield treatment showed 9.09% alterations in biochemical reactions followed by a change in biotype number (7774 4272) in the treated group with respect to the control (7774 4274). Genetic fingerprinting was performed on control and treated samples using RAPD-PCR biomarkers, which showed an average range of 11 to 15% of polymorphism among the treated samples with respect to the control. These results suggested that Mr. Trivedi’s biofield energy treatment has a significant impact on K. pneumoniae.
Ligand and structure based drug design against antimicrobial resistance induc...Mohit Kumar
Helicobacter pylori is a gram-negative, microaerophilic bacterium found usually in the stomach of a person with chronic gastritis and gastric ulcers. More than 50% of the world’s population harbor H. pylori in their upper gastrointestinal tract. About 85% of people infected with H. pylori never experience symptoms or complications. Individuals with chronic gastritis and infected with H. pylori have a 10 to 20% lifetime risk of developing peptic ulcers, MALT lymphoma, the pathogenesis of gastric cancer and several extra-gastric diseases. No vaccines are developed yet and the bacterial antibiotic resistance has been a growing concern. Helicobacter pylori produce virulence and antibiotic resistance through quorum sensing mechanisms by generating AI-2. Inhibition of quorum sensing would be a novel approach for the effective treatment of antibiotic-resistant strains of H. pylori. Chemical nature of AI-2 is furanosyl borate diester which is generated from 4,5-dihydroxy 2,3-pentanedione (DPD). But there are no synthetic congeners of AI-2 and DPD compounds tested against H. pylori till date. Therefore, it is the aim of the present study to design some potent AI-2 and DPD compounds under the framework of pharmacophore modeling.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
Evaluation of resistance profile of pseudomonas aeruginosa with reference to ...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
ANTIMICROBIAL RESISTANCE PATTERNS AMONG ACINETOBACTER BAUMANNII ISOLATED FROM...inventionjournals
Acinetobacter baumannii (Ab) is a troublesome and increasingly problematic healthcareassociated pathogen, especially in critical care unit (ICU) and cardiovascular internal medicine (CIM). This organism has a capacity for long-term survival in the hospital environment. This study aimed to investigate the drug resistance patterns of Ab strains isolated from Thongnhat Dongnai General Hospital and the relationships between Ab isolations with clinical wards and year of patients. The antibiotic susceptibility of 279 Ab isolates for aminoglycosides, fluro-quinolons, cephalosporins, carbapenems, colistin and bactrim was determined using Kirby-Bauer disk diffusion method. The minimum inhibitor concentration (MIC) of 146 Ab isolates for Meropenem was determined using E-test method according to CLSI guide-line. A total 279 A. baumannii strains out of 1,976 positive isolates were collected from various specimens during study period. Among Ab-positive specimens, the most isolated specimen was sputum (26.6%, χ 2 =161.705 p<0.000),><0.000)><0.000),><0.000). Among 279 Ab isolated, resistance from 53.16% – 63.52% to aminoglycosides, 23.6% – 68.58% to fluroquinolons, 59.61% to 97.93% to cephalosporins, 60.27% to 80.7% to carbapenem, 10.53% to 66.48% to antibiotic combinations, 0.75% to colistin and 61.71% to bactrim. Among 146 multidrug-resistant Ab, 53.42% MICmeropenem ≥ 32 μg/ml and only 18.49% strains were susceptible to Meropenem. Due to the high antimicrobial resistance to two clinical wards (ICU and CIM) and carbapenems by disk agar diffusion test and E-test; we must focus on both a wiser use of antimicrobials and the prevention of infection. Continuous monitoring of antimicrobial susceptibility and strict adherence to infection prevention guidelines are essential to eliminate major outbreaks in the future.
Incidence rate of multidrug-resistant organisms in a tertiary care hospital, ...Apollo Hospitals
Antimicrobial resistance to microorganisms is a growing public health concern globally, especially in developing countries. This study was conducted to study the incidence rate of multidrug-resistant organisms with their antibiotic sensitivity pattern.
Antimicrobial Susceptibility, Biochemical Characterization and Molecular Typi...wilhelm mendel
Pathogenic isolates of Klebsiella pneumoniae (K. pneumoniae), particularly the extended-spectrum β-lactamase (ESBL) producing strains, are mostly associated with the failure of antibiotic therapy in nosocomial infections. The present work was designed to evaluate the impact of Mr. Trivedi’s biofield energy treatment on phenotypic and genotypic characteristics of K. pneumoniae. The strain of K. pneumoniae bearing ATCC 15380 (American Type Culture Collection) was procured from the Bangalore Genei, in sealed pack and divided into control and treated groups. Treated group was subjected to Mr. Trivedi’s biofield energy treatment and analyzed for the antimicrobial susceptibility, minimum inhibitory concentration (MIC), biochemical reactions, and biotyping using automated MicroScan Walk-Away® system. Further, the effect of biofield treatment was also evaluated using Random Amplified Polymorphic DNA (RAPD) in order to determine their epidemiological relatedness and genetic characteristics of biofield treated K. pneumoniae samples. The antimicrobial susceptibility results showed an improve sensitivity (i.e. from intermediate to susceptible) of ampicillin/sulbactam and chloramphenicol, while altered sensitivity of cephalothin (i.e. from susceptible to intermediate) was also reported as compared to the control sample. The MIC value showed two-fold decrease in MIC value of ampicillin/sulbactam (i.e. 16/8 to ≤8/4 μg/mL) and chloramphenicol (i.e. 16 to ≤ 8 μg/mL) as compared to the control. The cephalothin showed two-folds change (i.e. ≤ 8 to 16 μg/mL) in the MIC value as compared with the control. Biofield treatment showed 9.09% alterations in biochemical reactions followed by a change in biotype number (7774 4272) in the treated group with respect to the control (7774 4274). Genetic fingerprinting was performed on control and treated samples using RAPD-PCR biomarkers, which showed an average range of 11 to 15% of polymorphism among the treated samples with respect to the control. These results suggested that Mr. Trivedi’s biofield energy treatment has a significant impact on K. pneumoniae.
Ligand and structure based drug design against antimicrobial resistance induc...Mohit Kumar
Helicobacter pylori is a gram-negative, microaerophilic bacterium found usually in the stomach of a person with chronic gastritis and gastric ulcers. More than 50% of the world’s population harbor H. pylori in their upper gastrointestinal tract. About 85% of people infected with H. pylori never experience symptoms or complications. Individuals with chronic gastritis and infected with H. pylori have a 10 to 20% lifetime risk of developing peptic ulcers, MALT lymphoma, the pathogenesis of gastric cancer and several extra-gastric diseases. No vaccines are developed yet and the bacterial antibiotic resistance has been a growing concern. Helicobacter pylori produce virulence and antibiotic resistance through quorum sensing mechanisms by generating AI-2. Inhibition of quorum sensing would be a novel approach for the effective treatment of antibiotic-resistant strains of H. pylori. Chemical nature of AI-2 is furanosyl borate diester which is generated from 4,5-dihydroxy 2,3-pentanedione (DPD). But there are no synthetic congeners of AI-2 and DPD compounds tested against H. pylori till date. Therefore, it is the aim of the present study to design some potent AI-2 and DPD compounds under the framework of pharmacophore modeling.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
ANTIMICROBIAL RESISTANCE PATTERNS AMONG ACINETOBACTER BAUMANNII ISOLATED FROM...inventionjournals
Acinetobacter baumannii (Ab) is a troublesome and increasingly problematic healthcareassociated pathogen, especially in critical care unit (ICU) and cardiovascular internal medicine (CIM). This organism has a capacity for long-term survival in the hospital environment. This study aimed to investigate the drug resistance patterns of Ab strains isolated from Thongnhat Dongnai General Hospital and the relationships between Ab isolations with clinical wards and year of patients. The antibiotic susceptibility of 279 Ab isolates for aminoglycosides, fluro-quinolons, cephalosporins, carbapenems, colistin and bactrim was determined using Kirby-Bauer disk diffusion method. The minimum inhibitor concentration (MIC) of 146 Ab isolates for Meropenem was determined using E-test method according to CLSI guide-line. A total 279 A. baumannii strains out of 1,976 positive isolates were collected from various specimens during study period. Among Ab-positive specimens, the most isolated specimen was sputum (26.6%, χ 2 =161.705 p<0.000),><0.000)><0.000),><0.000). Among 279 Ab isolated, resistance from 53.16% – 63.52% to aminoglycosides, 23.6% – 68.58% to fluroquinolons, 59.61% to 97.93% to cephalosporins, 60.27% to 80.7% to carbapenem, 10.53% to 66.48% to antibiotic combinations, 0.75% to colistin and 61.71% to bactrim. Among 146 multidrug-resistant Ab, 53.42% MICmeropenem ≥ 32 μg/ml and only 18.49% strains were susceptible to Meropenem. Due to the high antimicrobial resistance to two clinical wards (ICU and CIM) and carbapenems by disk agar diffusion test and E-test; we must focus on both a wiser use of antimicrobials and the prevention of infection. Continuous monitoring of antimicrobial susceptibility and strict adherence to infection prevention guidelines are essential to eliminate major outbreaks in the future
An Impact of Biofield Treatment: Antimycobacterial Susceptibility Potential U...albertdivis
The aim was to evaluate the impact of biofield treatment modality on mycobacterial strains in relation to antimycobacterials susceptibility. Mycobacterial sensitivity was analysed using 12 B BACTEC vials on the BACTEC 460 TB machine in 39 lab isolates (sputum samples) from stored stock cultures.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri ...Scientific Review SR
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a
challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate
Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44
were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different
and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42)
tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with
highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes
(MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1
and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by
most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With
over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and
might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the
nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
Abstract— Methicillin-resistant Staphylococcus aureus (MRSA) poses a great risk to burn patients with potential to cause significant morbidity and mortality. This study aimed to find out the prevalence of MRSA and its susceptibility, in burn wound infection/colonization in a Tertiary Care Hospital in North India. A retrospective study was conducted among patients admitted in burn ward of our hospital, between January to December 2012. All the patients irrespective of age, sex, duration of hospital stay, percentage and degree of burn were included in our study. Wound swabs from 1294 patients hospitalized in burn ward were analysed for bacteriological examination. Swabs were inoculated on Blood agar, MacConkey agar and Brain heart infusion broth. Isolates were examined for colony characteristics, Gram staining and biochemical tests. Antimicrobial susceptibility testing was done by modified Stokes disc diffusion method. Detection of MRSA was done by cefoxitin (30g) disc diffusion method. Among the Staphylococcus aureus (S.aureus) isolates, 56.7% (80/141) were found to be MRSA while 43.3% (61/141) were Methicillin Susceptible S.aureus (MSSA). All the MRSA isolates were resistant to penicillin, cephalexin and cefazolin. Resistance to erythromycin, clindamycin, ofloxacin, ciprofloxacin, gentamicin, amikacin, rifampicin, chloramphenicol was found to be 74%, 97.4%, 96%, 100%, 97.4%, 84.6%, 11.5%, 10.3%. All MRSA isolates were found to be sensitive to vancomycin and teicoplanin while 1.3% were resistant to linezolid. Although survival rates for burn patients have improved substantially over the years, nosocomial infections still remain a major challenge in burn care. This concludes that there is high prevalence of nosocomial infections specially the presence of multidrug resistant bacteria like Methicillin Resistant Staphylococcus aureus among burn patients suggest continuous surveillance of burn wound infections and development and stringent implementation of antibiotic policy.
A study of antibiotic resistance of Extended-Spectrum Beta-Lactamases produci...Premier Publishers
Background: Extended-Spectrum Beta-Lactamases - producing Enterobacteriaceae are common in hospitals. This study aims to describe the antibiotic resistance of these bacteria and their associated demographic and clinical factors. Methods: It was a prospective study of 73 isolates of Extended-Spectrum Beta-Lactamases - producing Enterobacteriaceae for a period of six months from July to December 2019 in the laboratory of Befelatanana. Results: This study showed 73 (6.3%) isolates of Extended-Spectrum Beta-Lactamases- producing Enterobacteriaceae, represented by 25 (34.2%) isolates of Klebsiella spp, 24 (32.9%) isolates of Escherichia coli, 22 (30.1%) isolates of Enterobacter spp and 2 (2.7%) isolates of Proteus spp. The antibiotic resistance of these bacteria varied from 0% to 100% for all of the antibiotics tested. Resistance to aminoglycosides ranged from 0% (amikacin) to 69.9% (gentamycin). Resistance to quinolones ranged from 43.8% (levofloxacin) to 76.7% (nalidixic acid). Similarly, 60 (82.2%) isolates were resistant to cotrimoxazole and 25 (34.2%) isolates to chloramphenicol. Patients under 20 years (57.1%) (p=0.03), men (52.2%)(p=0.11; NS), patients with respiratory samples (83.3%)(p=0.004), with pus (61.9%)(p=0.02) and hospitalized in surgery and intensive care units (68.4%)(p=0.0009) were the most affected by these enterobacteria. Conclusion: Extended-Spectrum Beta-Lactamases - producing Enterobacteriaceae are responsible for severe infections and the majorities are multi-resistant bacteria.
Keywords: Beta-lactamase, Enterobacteriaceae, antibiotic resistance, amikacin, imipenem.
Disinfectants play an important role in health careassociated
infection control by either minimizing or preventing
microorganism dissemination. This article to study the
morphological changes which may be related to the lose of
antibiotic resistance after disinfectant exposure using SEM.
Showed all isolates resistant to ampicillin, amoxicillin, cloxacillin,
cephalexin, tetracycline, doxycycline, rifampin, chloramphenicol,
trimethoprim cefotaxime and erythromycin, while one of burn
isolates was susceptible for gentamicin, chloramphenicol and
trimethoprim, and 15 of burn, 6 of wound, 5 of ear, and all urine
isolates were susceptible to gentamicin using Kirby-Bauer
method.
The MICs of four common in use disinfectants (Hexatane,
Dettol, Savlon and Povidone – Iodine) were determined for all
isolates. The results showed that the MICs of Hexatane ranged
from (64–512) µg/ml, Dettol (2048–16384) µg/ml,
Savlon (4096:40960)–(32768:327680) µg/ml and for Povidone –
Iodine MICs were (8192–32768) µg/ml. It has been found that
burn and urine isolates were more resistant to disinfectants than
wound and ear isolates. According to the effect of subMICs of
disinfectants at different exposure patterns on antibiotic
resistance, the results showed lose of resistance to tetracycline,
doxycycline, rifampin, chloramphenicol, cefotaxime and
trimethoprim in %72, %72, %68, %22, %28 and %36 of isolates,
respectively. The results of SEM micrograph showed normal
morphology and small sized bacteria with nub formation on some
of them when exposed to dettol, and shape changes in cells with
bulging in exposed to Povidone-iodine, while elongation and
deformation were recorded in some cells in exposed to
Savlon(chlorohexidine/ cetrimide) and Hexatane (chlorohexidine/
gluconate), respectively.
1. Multidrug Resistance
Among Acinetobacter baumannii Isolates from Iran:
Changes in Antimicrobial Susceptibility Patterns
and Genotypic Profile
Abbas Bahador,1
Reza Raoofian,2
Mohammad Taheri,3
Babak Pourakbari,4
Zahra Hashemizadeh,5
and Farhad B. Hashemi1
Background and Aim: Widespread multidrug-resistant Acinetobacter baumannii (MDR-AB) strains have limited
therapeutic options for treating intensive care unit (ICU) patients with MDR-AB infection in Iran. We aimed to
evaluate MDR-AB diversity and antimicrobial susceptibility in Tehran (Iran) to address the need for feasible and
effective control approaches against severe MDR-AB infections. Methods: We used amplified fragment length
polymorphism (AFLP) and minimum inhibitory concentration (MIC) determinations to compare genotypic di-
versity and susceptibility patterns of 100 MDR-AB isolates from ICU patients in two medical centers in Tehran
(Iran), from 2006 to 2011. Results: Within 5 years, drastic genotypic changes occurred among MDR-AB isolates,
and resistance to antimicrobials increased 0–30%. In 2011, 6–100% of isolates were resistant to every agent
tested. All isolates remained susceptible to either minocycline or tobramycin, however, MIC50 concentrations
against these agents increased. Novel international clone (IC) variants (not IC I–III types) comprised 36% MDR-
AB isolates in 2011. Conclusions: The MDR-AB population in Tehran is rapidly changing toward growing
resistance to various antimicrobials, including colistin and tigecycline. Although increasing resistance to last-
resort antimicrobials is alarming, simultaneous susceptibility of all MDR-AB isolates to some conventional
antibiotics highlights the merits of investigating their synergistic activity against extended-spectrum and pandrug
resistant A. baumannii. Integrating the novel Iranian MDR-AB IC variants into epidemiologic clonal and
susceptibility profile databases can help global efforts toward the control of MDR-AB pandemic.
Introduction
Multidrug-resistant Acinetobacter baumannii
(MDR-AB) strains have emerged as formidable nos-
ocomial pathogens, particularly among patients with pneu-
monia in intensive care units (ICU).17,23 In developing
countries, such as Iran, clinicians face serious challenges
in empirical and therapeutic treatment of critically ill pa-
tients with MDR-AB infections. Since 2008, several epi-
demiologic studies have reported nosocomial outbreaks of
A. baumannii in Iran.2,8,9,25,27–29,32,34,35
The emergence of
colistin-resistant nosocomial A. baumannii has become a
serious concern in healthcare settings in Iran, particularly
among ICUs.4
Carbapenems are currently the drug of
choice; however, widespread resistance to carbapenems and
numerous other antimicrobials has led to a dearth of thera-
peutic choices in treating MDR-AB infections among ICU
patients in developing countries.30
Up-to-date surveillance
data regarding genotypic distribution, plus local suscepti-
bility patterns of A. baumannii strains, are essential for
successful treatment and control of MDR-AB hospital out-
breaks.7,10
However, not only are such data scarce in de-
veloping countries but also the newer effective antimicrobial
agents are costly and less accessible. Thus, to address the
need for affordable and effective antimicrobials to control
outbreaks and treat patients with MDR-AB infections,7,10,30
we investigated the changes in patterns of MDR-AB anti-
microbial susceptibility to explore feasible alternatives for
control of MDR-AB spread in developing countries with
limited resources. We also present evidence for prominent
genotypic variations among MDR A. baumannii population
in Tehran, Iran.
Departments of 1
Microbiology and 2
Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran.
3
Diagnostic Laboratory Sciences and Technology Research Center, School of Paramedical Sciences, Shiraz University of Medical
Sciences, Shiraz, Iran.
4
Pediatrics Infectious Disease Research Center, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran.
5
Department of Microbiology and Virology, Shiraz University of Medical Sciences, Shiraz, Iran.
MICROBIAL DRUG RESISTANCE
Volume 20, Number 6, 2014
ª Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2013.0146
632
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
2. Materials and Methods
Specimens and bacterial isolates
One hundred nonrepetitive patient isolates of multidrug-
resistant A. baumannii (MDR-AB) were collected from the
ICU patients of Imam Khomeini Medical Center (IKMC)
and Children Medical Center (CMC) in Tehran, Iran. The
IKMC and CMC centers are affiliated with the Tehran
University of Medical Sciences (TUMS), and both provide
tertiary patient care to patients referred from various re-
gions of Iran. To compare the phenotypic and genotypic
changes among MDR-AB isolates, samples were collected
within a 5-year period, from 2006 to 2011 (50 isolates per
year). The 2011 patient specimens were collected from
the same ICU that provided samples during 2006. About
10% of the MDR-AB isolates were isolates from our recent
report.3
The MDR-AB strains were isolated from several sources,
including wound (n = 42), respiratory tract (n = 36), urine
(n = 9), blood (n = 7), and CSF (n = 6). A. baumannii were
initially identified using the API20NE system (bioMe´rieux)
and later confirmed by gyrB multiplex PCR, as previously
described (Supplementary Fig. S1; Supplementary Data are
available online at www.liebertpub.com/mdr).13
Antimicrobial susceptibility tests
The Clinical Laboratory Standards Institute (CLSI) guide-
line21
for minimum inhibitory concentrations (MICs) using
the E-test was used to assess the susceptibility of MDR-AB
isolates to ampicillin–sulbactam (SAM, 0.016–256/0.008–
128 mg/ml; 2:1 ratio), cefepime (FEP, 2–256mg/ml), cefta-
zidime (CAZ, 2–256mg/ml), ciprofloxacin (CIP, 0.01–240mg/
ml), colistin (CST, 0.01–240mg/ml), co-trimoxazole (COT,
0.01–240mg/ml), imipenem (IPM, 4–256mg/ml), levofloxacin
(LVX, 0.01–240mg/ml), minocycline (MIN, 0.01–240mg/ml),
piperacillin (PIP, 0.01–240mg/ml), piperacillin–tazobactam
(TZP, 0.01–240mg/ml, each dilution contains 4mg of tazo-
bactam), rifampicin (RIF, 0.01–240mg/ml), tetracycline (TET,
0.01–240mg/ml), tigecycline (TGC, 0.016–192mg/ml), and to-
bramycin (TOB, 0.01–240mg/ml).
All antimicrobial E-TestÒ
strips (HiMedia Laboratories
Pvt. Ltd.), including SAM E-TestÒ
strips (bioMe´rieux),
were used according to the manufacturer’s recommenda-
tions. For tigecycline susceptibility tests, the criteria of
Table 1. Primer Sequences and Adaptors Used in This Study
Use(s) Primer Sequence (5¢–3¢)a
Reference
Confirmatory PCR gyrB multiplex PCR gyrB-2 CTTACGACGCGTCATTTCAC 14
D14 GACAACAGTTATAAGGTTTCAGGTG
D19 CCGCTATCTGTATCCGCAGTA
D16 GATAACAGCTATAAAGTTTCAGGTGGT
D8 CAAAAACGTACAGTTGTACCACTGC
Sp2F GTTCCTGATCCGAAATTCTCG
Sp4F CACGCCGTAAGAGTGCATTA
Sp4R AACGGAGCTTGTCAGGGTTA
International clonal
lineage
Group 1 PCR OmpAF306 GATGGCGTAAATCGTGGTA 43
OmpAR660 CAACTTTAGCGATTTCTGG
CsuEF CTTTAGCAAACATGACCTACC
CsuER TACACCCGGGTTAATCGT
OXA66F89 GCGCTTCAAAATCTGATGTA
OXA66R647 GCGTATATTTTGTTTCCATTC
Group 2 PCR OmpAF378 GACCTTTCTTATCACAACGA
OmpAR660 CAACTTTAGCGATTTCTGG
CsuEF GGCGAACATGACCTATTT
CsuER CTTCATGGCTCGTTGGTT
OXA69F169 CATCAAGGTCAAACTCAA
OXA69R330 TAGCCTTTTTTCCCCATC
AFLP Adaptors adp MbI GTAGCGCGACGGCCAGTCGCG 4
ADP MbI GATCCGCGACTGGCCGTCGCGCTAC
adp MsI GTAGCGCGACGGCCAGTCGCGT
ADP MsI TAACGCGACTGGCCGTCGCGCTAC
Preamplification PreAmp-Mbo ACGGCCAGTCGCGGATC
PreAmp-Mse CGACGGCCAGTCGCGTTAA
Selective primers Mb1 PreAmp Mbo + A
Mb2 PreAmp Mbo + T
Mb3 PreAmp Mbo + C
Mb4 PreAmp Mbo + G
Ms1 PreAmp Mse + A
Ms2 PreAmp Mse + T
Ms3 PreAmp Mse + C
Ms4 PreAmp Mse + G
a
Nucleotide.
AFLP, amplified fragment length polymorphism.
MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII FROM IRAN 633
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
3. the European Committee on Antimicrobial Susceptibility
Testing (EUCAST) for members of Enterobacteriaceae
were used (i.e., MIC of £ 1 mg/L defined as susceptible
and > 2 mg/L as resistant).37
Also, rifampicin susceptibility
was interpreted according to CLSI criteria using breakpoint
values suggested for Staphylococcus aureus (susceptible
and resistant defined as £ 1 mg/L and ‡ 4 mg/L, respec-
tively).21
MIC determinations included MIC range, MIC50,
and MIC90 for each isolate using Escherichia coli ATCC
25922, Pseudomonas aeruginosa ATCC 27853, and E. coli
ATCC 35218 as quality control organisms. Isolates were
defined as multidrug resistant (MDR), extended spectrum
drug resistant (XDR), or pandrug resistant (PDR) accord-
ing to the International Expert proposal for Interim Stan-
dards guidelines.20
The MDR-AB strain was defined as
nonsusceptibility to at least one member of the three an-
timicrobial classes, and tigecycline and rifampicin sus-
ceptibilities were excluded from MDR definition.
Molecular typing
Clonal lineage of MDR-AB isolates was determined by
amplified restriction fragment polymorphism (AFLP) by a
ligation-PCR method, as previously described (Supple-
mentary Fig. S2).3
Briefly, genomic DNA from isolates
were double digested with MboI and MseI (Fermentas), li-
gated to adaptors (Table 1), and used as templates for pre-
liminary PCR using Mbo- and Mse-specific primers (Table
1). Preliminary PCR products were amplified by selective
PCR to generate AFLP profiles, determined by image
analysis of gel-resolved bands using BioNumerics version
5.10 (Applied Maths) with A. baumannii NCTC 12156 as a
normalization reference. The similarity between band pat-
terns was calculated using the Dice coefficient (with an op-
timization of 0.5% and a position tolerance of 1%). The
AFLP clusters and type identification were defined by groups
formed at 60% and 90% Dice similarity cutoffs, respectively,
on a dendrogram constructed by the unweighted pair group
method using average linkages (UPGMA).
Determination of International clonal types
International clone (IC) types were determined using two
complementary multiplex PCR assays (primers, Table 1), as
previously described.42
Multiplex PCR assays selectively
amplified the outer membrane protein A (ompA), chaper-
one–subunit usher E (csuE), and intrinsic carbapenemase
(blaOXA-51-like) genes of MDR-AB isolates. Standard AB
strains belonging to IC type I, II, and III served as controls.
Strains positive for all three ompA, csuE, and blaOXA-51-like
allele amplicons were identified as IC type I, and isolates not
assigned as either IC type I, II, or type III were reported as
the variant (V) clonal type.
Results
Antimicrobial susceptibility testing
Overall, resistance against all test antimicrobials (10
classes) among MDR-AB isolates from ICU patients in-
creased, except for tobramycin. During a 5-year period, the
frequency of resistant MDR-AB isolates against each anti-
microbial increased by 11–30% (Table 2). By 2011, all
MDR-AB isolates had become completely resistant to
group A ceftazidime and three other group B antimicrobials,
Table 2. Comparison of Antimicrobial Agents’ Minimum Inhibitory Concentration
Against Acinetobacter baumannii Isolates, and Percentage of Resistant Isolates According
to Their Year and Location of Isolation, as Determined by E-Test
Acinetobacter baumannii isolates
2006 2011
Anti-
microbial
MIC (mg/ml) Nonsusceptible (%) MIC (mg/ml) Nonsusceptible (%)
agents Range MIC50 MIC90 IKMC CMC Total Range MIC50 MIC90 IKMC CMC Total
CST 0.001–1 0.01 1 0 0 0 0.001–30 0.1 2 4 2 6
IPM £ 4–64 £ 4 24 18 12 30 £ 4– ‡ 256 12 32 26 22 48
PIP 5– ‡ 240 ‡ 240 ‡ 240 38 34 72 ‡ 240 ‡ 240 ‡ 240 50 50 100
TZP 0.01– ‡ 240 30 120 32 18 50 0.01– ‡ 240 120 ‡ 240 38 26 64
SAM 2/1– ‡ 256/128 16/8 ‡ 256/128 26 16 42 2/1– ‡ 256/128 32/16 ‡ 256/128 28 20 48
CAZ 32– ‡ 256 64 ‡ 256 50 50 100 32– ‡ 256 128 ‡ 256 50 50 100
FEP 4– ‡ 256 64 128 48 42 90 32– ‡ 256 128 ‡ 256 50 50 100
CIP 0.01– ‡ 240 10 10 40 22 62 0.1– ‡ 240 30 60 44 24 68
LVX 0.01–120 5 10 26 14 40 0.1– ‡ 240 10 30 46 22 68
TET 0.1–60 5 5 2 0 2 0.1–120 5 10 8 4 12
MIN 0.01–30 5 5 2 0 2 0.1–60 5 10 6 2 8
TGC 0.016–1 0.25 1 0 0 0 0.023–32 0.5 3 4 0 4
TOB 0.01–64 5 30 30 14 44 0.1– ‡ 240 5 60 30 10 40
COT 0.1– ‡ 240 10 30 48 50 98 5– ‡ 240 30 60 50 50 100
RIF 0.1–60 5 30 38 32 70 0.1–120 10 30 46 48 94
Most antimicrobial agents were selected according to CLSI-defined grouping of A, B, and O antimicrobial groups.
CAZ, ceftazidime; CIP, ciprofloxacin; CLSI, Clinical Laboratory Standards Institute; CMC, Children Medical Center; COT, co-
trimoxazole; CST, colistin; FEP, cefepime; IKMC, Imam Khomeini Medical Center; IPM, imipenem; LVX, levofloxacin; MIC, minimum
inhibitory concentration; MIN, minocycline; PIP, piperacillin; RIF, rifampicin; SAM, ampicillin/sulbactam; TET, tetracycline; TGC,
tigecycline; TOB, tobramycin; TZP, piperacillin–tazobactam.
634 BAHADOR ET AL.
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
4. namely, piperacillin, cefepime, and co-trimoxazole. In
contrast, all 2006 isolates were only resistant against cef-
tazidime. In addition, Table 2 shows that MDR-AB isolates
from 2011 had the lowest frequency of resistance to colistin
(6%), tigecycline (8%), and minocycline (8%).
MIC determinations of MDR-AB isolates, 2006 versus
2011, revealed a rising trend of higher MIC ranges across all
test antimicrobial agents (Table 2). Although for most anti-
biotics, MIC ranges showed a twofold increase in the high-
end of MIC range; the increases for colistin, tigecycline, and
imipenem were 32-, 30-, and 4-fold, respectively. Within 5
years, MIC50 for all test antimicrobials also increased, except
for piperacillin, tobramycin, minocycline, and tetracycline.
MIC90 concentrations against A. baumannii isolates also in-
creased for all antimicrobials, and by 2011, MIC90 concen-
trations of test antibiotics were two to six times higher than
MIC90 of isolates from 2006. Notably, MIC90 concentrations
against tobramycin increased twofold, despite the decline in
frequency of isolates resistant to this antimicrobial.
Table 2 also compares the MIC of antimicrobial agents
against A. baumannii isolates according to the location of
their isolation. While among A. baumannii isolates from
both IKMC and CMC, the resistance rates to ceftazidime,
cefepime, co-trimoxazole, and rifampicin were similar,
overall, the isolates from IKMC showed upto threefold
higher resistance rates than the CMC isolates during 2011.
In fact, all tigecycline-resistant A. baumannii isolates were
isolated from IKMC (Table 2).
Table 3 shows the changes in antimicrobial resistance
rates among MDR-AB isolates, between 2006 and 2011.
The highest increase in frequency of resistant MDR-AB was
against piperacillin (30%) and rifampicin (24%), whereas the
smallest increase among isolates was against co-trimoxazole
(2%) and minocycline (4%). While all 2006 isolates were
susceptible to tigecycline and colistin, by 2011, MDR-AB
resistance to these antibiotics had emerged and 6% of
MDR-AB isolates were resistant to tigecycline and colistin
(Table 3).
Table 3 also shows that while 52% of 2011 isolates re-
mained susceptible to imipenem, carbapenem resistance
rose by 18%, as compared to the 2006 isolates. Resistance to
other first-line drugs (group A), for example, levofloxacin
and ampicillin–sulbactam, also increased in 2011 by 14%
and 10%, respectively. However, rates of resistance to cef-
tazidime and tobramycin remained unchanged or decreased
slightly (Table 3).
AFLP analysis
AFLP analysis of MDR-AB isolates indicated drastic
changes in genotypic patterns within a 5-year period. These
changes were evidenced by the finding that novel IC vari-
ants comprised 36% of MDR-AB isolates in 2011.
Figure 1 shows the frequency of MDR-AB AFLP geno-
types in 2006 and 2011, in addition to their antimicrobial
resistance profile. Twelve distinct AFLP genotypes (A
through L) were identified among all MDR-AB isolates with
predominance of D, F, I, and J genotypes. Genotypes I and F
(42% and 38%) were the most frequent genotypes in 2006
and 2011, respectively. In 2006, genotypes I and J com-
prised 62% of MDR-AB isolates, whereas in 2011, geno-
types D and F accounted for 62% of isolates. While 98% of
Table3.ComparisonofFrequencyofAntimicrobialResistance(byAntibioticGroupings)
AmongMDR-ABPatientIsolatesin2006Versus2011
CLSIantimicrobialgroupsa
No(%)
Yearof
ABOOtheragents
IsolationIPMSAMLEVCIPCAZTOBTETMINPIPTZPFEPCOTCSTTGCRIF
2006(n=50)15(30)21(42)27(54)31(62)50(100)22(44)1(2)1(2)35(70)21(42)45(90)49(98)0(0)0(0)35(70)
2011(n=50)24(48)26(52)34(68)34(68)50(100)20(40)6(12)4(8)50(100)25(50)50(100)50(100)3(6)4(8)47(94)
Change(%)9(18)5(10)7(14)3(6)0(0)2(-4)5(10)3(6)15(30)4(8)5(10)1(2)3(6)4(8)12(24)
AntimicrobialagentsarecategorizedaccordingtoCLSI-definedgroupingasA,B,andOantimicrobialgroups.
a
AccordingtoCLSIguideline,considerationsintheassignmentofagentstoGroupsA,B,andOincludeclinicalefficacy,prevalenceofresistance,minimizingemergenceofresistance,cost,
FDAclinicalindicationsforusage,andcurrentconsensusrecommendationsforfirst-choiceandalternativedrugs.GroupAareconsideredappropriateforinclusioninaroutine,primarytesting
panel,aswellasforroutinereportingofresultsfortheorganism.GroupBcomprisesagentsthatmaywarrantprimarytesting.However,theymaybereportedonlyselectively,suchaswhenthe
organismisresistanttoagentsofthesameclass,asinGroupA.GroupO(other)includesagentsthathaveaclinicalindicationfortheorganism,butaregenerallynotcandidatesforroutine
testingandreportingintheUnitedStates.
MDR-AB,multidrug-resistantAcinetobacterbaumannii.
MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII FROM IRAN 635
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
5. AFLP types included > 1 MDR-AB isolate, only a single
isolate of genotype A (in 2006) or G (in 2011) was isolated.
The F genotype was the only genotype observed in both
2006 and 2011, and its frequency increased by 14% among
2011 MDR-AB isolates. The scarcity of 2006 genotypes
among 2011 isolates (and vice versa) suggests that dramatic
clonal changes have occurred among MDR-AB isolates. It is
notable that genotypes F and K showed the same antimicro-
bial susceptibility profile, despite their different AFLP profile;
however, genotype E1 and E2 isolates had different antibiotic
resistance patterns (i.e., E2 genotype resistance to tigecy-
cline), despite showing an identical AFLP profile (Fig. 1).
MDR-AB isolates of genotype A (2006) were the most
susceptible isolates being resistant to only 5 (33%) of the
test antimicrobials; however, MDR-AB genotype B, C, and
G isolates (2011) showed the broadest resistance profiles,
showing resistance to 10–12 (66–80%) of antimicrobials.
Although two of the 2011 isolates (genotype C) were de-
fined as XDR-AB isolates (with an extended resistance
profile), they remained susceptible to imipenem, tigecycline,
and/or tobramycin (Fig. 1). MDR-AB genotypes with re-
sistance to most (8 or 10) antimicrobial agents were isolated
in 2011 (i.e., genotypes B, D, E2, F, G, and K). Interestingly,
the only isolate resistant to both colistin and tigecycline (ge-
notype G) remained susceptible to several conventional agents,
including members of the primary (ampicillin–sulbactam),
secondary (ciprofloxacin, levofloxacin), and alternative
(piperacillin–tazobactam, tobramycin) groups (Fig. 1).
Figure 1 also compares the susceptibilities of MDR-AB
isolates, which were resistant to first-line or last-resort
drugs, against various conventional antimicrobials. For in-
stance, in 2011, all carbapenem-resistant MDR-AB isolates
as well as 98% of TGC + CST-resistant isolates were sus-
ceptible to either minocycline or tobramycin. In addition,
analysis of simultaneous susceptibility of MDR-AB iso-
lates to ‡ 2 antimicrobials revealed that all 2011 isolates
were simultaneously susceptible to the following antimi-
crobials: ciprofloxacin–levofloxacin + tigecycline and colis-
tin + tobramycin. Surprisingly, while 28% of 2006 isolates
were simultaneously resistant to ampicillin–sulbactam and
tobramycin, none of the isolates from 2011 showed simul-
taneous resistance to these antimicrobials. In other words,
all 2011 MDR-AB were susceptible to either ampicillin–
sulbactam or tobramycin (Fig. 1).
Further analysis of simultaneous susceptibility of MDR-
AB genotypes showed that all imipenem-resistant 2011
isolates were susceptible to either ciprofloxacin–levofloxacin
or tobramycin, except for genotype B isolates (16%). Al-
though MDR-AB genotype A, J, and L isolates were resistant
to both the primary (IPM and SAM) antimicrobials, they all
remained susceptible to ‡ 4 of the secondary drugs (i.e.,
CST, TGC, CIP, LVX, or RIF). Only 2% of isolates were
susceptible to either rifampicin or tigecycline (Fig. 1), sig-
nifying that 98% of MDR-AB isolates might be susceptible
to a combination of these drugs, which remains to be tested.
Figure 2 shows the distribution of MDR-AB genotypes
based on type, the year, and site of specimen collection from
ICU patients. While in 2006, genotype I comprised most
(35%) MDR-AB isolates from respiratory sites, the imipenem-
resistant genotype D predominated among the respiratory
2011 MDR-AB isolates (31%). Interestingly, the predomi-
nant MDR-AB genotypes I (2006—42%) and F (2011—38%)
were both imipenem susceptible and mostly isolated from
wounds (Fig. 2). In fact, an increasing trend of carbapenem
resistance was observed among MDR-AB recovered from all
sites. For example, imipenem resistance rose by 10% and 19%
in among respiratory and wound MDR-AB isolates, respec-
tively. Genotypic profiles of 80% of MDR-AB isolates from
FIG. 1. Dendrogram analysis of AFLP fingerprint patterns, and the international clone (IC) determination of MDR-AB
isolates depicting the genetic relatedness of MDR-AB isolates from 2006 to 2011. Resistance to antimicrobial agents is
indicated by closed black circle (); antimicrobials are classified as primary, secondary, or alternative therapeutic regimens,
according to Sanford guideÒ
for antimicrobial therapy (http://webedition.sanfordguide.com/sanford-guide-online/disease-
clinicalcondition/Acinetobacter baumannii, accessed September 18, 2012). AFLP, amplified fragment length polymorphism;
CAZ, ceftazidime; CIP, ciprofloxacin; COT, co-trimoxazole; CST, colistin; FEP, cefepime; IPM, imipenem; LVX, levo-
floxacin; MDR-AB, multidrug-resistant Acinetobacter baumannii; MIN, minocycline; PIP, piperacillin; RIF, rifampicin;
SAM, ampicillin–sulbactam; TET, tetracycline; TGC, tigecycline; TOB, tobramycin; TZP, piperacillin–tazobactam; V,
variants of IC.
636 BAHADOR ET AL.
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
6. 2011 (AFLP types C, D, E2, F, and G) were similar to the
genotypes of isolates from our previous report,3
which ex-
amined MDR-AB isolates from other parts of Iran and other
patients in Tehran (Supplementary Table S1; Note: specimen
overlap between studies was about 10%, unpublished data).
Figure 2 also shows that the main IC type among MDR-
AB isolates was IC type II (66% in 2006 and 52% in 2011).
None of the isolates was identified as IC type III; however,
IC type I isolates comprised 30% and 16% of MDR-AB
from 2006 to 2011, respectively. While 36% of the 2011
MDR-AB isolates were assigned as ‘‘novel IC variant’’ type
(not corresponding to the IC I, II, or III definitions), only 4%
of the 2006 isolates were identified as novel IC variants.
Among MDR-AB isolates from 2011, the novel variants of
IC strains were most frequently (16%) isolated from the
respiratory tract specimens.
Discussion
MDR-AB has emerged as a morbidly successful nosoco-
mial pathogen, especially among the ICU patients with re-
spiratory complications.19
Widespread carbapenem-resistant
MDR and XDR-AB isolates in ICU wards present grave
challenges to clinicians facing a dearth of treatment options
against severe MDR-AB infections. In developing countries
like Iran, these challenges are magnified by barriers in ob-
taining the newly approved antimicrobial agents like tigecy-
cline, compounded by growing MDR-AB resistance to drugs
of last resort.3,6,14
Consequently, several studies have focused
on approaches that may potentiate the activity of available
antimicrobials to effectively treat MDR-AB infections.4,5,26,33
Recent reports have declared an urgent need for effective
therapeutic regimens to control MDR-AB outbreaks in hos-
pitals throughout the world,6,38
but given that MDR-AB sus-
ceptibility often depends on the isolate’s origin, successful
control measures necessitate epidemiologic knowledge of ge-
notypic and antimicrobial susceptibility profile of local iso-
lates.11,24,38 To address this need, our 5-year study compared
the susceptibility patterns and the genotypic changes among
MDR-AB isolates of two medical centers in Tehran, Iran.
Overall, we report an alarming trend of increase in MDR-
AB resistance against a wide spectrum of antimicrobial agents
in Tehran, Iran. If not controlled, this trend promises to
eventually render even the last-resort antimicrobials inade-
quate while treating patients with severe MDR-AB infections.
Among our greatest concerns is the recent emergence and
growing number of MDR-AB strains, which are resistant
to both tigecycline and colistin, as reported recently.3
For-
tunately, while the rising number of TGC + CST-resistant
MDR-AB isolates reveals a worrisome trend of high frequency
of XDR and PDR-AB cases, so far, all TGC +CST-resistant
isolates have remained susceptible to a few conventional drugs,
like tobramycin or ciprofloxacin–levofloxacin.
Generally, our findings are consistent with recent studies
from Iran that show a growing trend of widespread carbape-
nem resistance among MDR-AB isolates.1,9,31,36
However,
contrary to these reports, all imipenem-resistant MDR-AB
isolates, in the present study, remained sensitive to conven-
tional antimicrobials such as ciprofloxacin–levofloxacin or
minocycline, which are readily available in Iran. The unex-
pected susceptibility of all 2011 MDR-AB isolates to either
ampicillin–sulbactam or tobramycin and complete suscepti-
bility of carbapenem-resistant isolates to either minocycline or
tobramycin (despite their rising MIC90 values) deserve further
evaluation. This effort might lead to potential therapeutic
approaches for PDR-AB infections in Iran, especially since
FIG. 2. Frequency and distribution
of AFLP genotypes of MDR-Acine-
tobacter baumannii (n = 100) accord-
ing to (A) specimen’s year and site of
collection and (B) the IC. a
Others in-
cluded urine (n = 9), blood (n = 7), and
CSF (n = 6) specimens. b
Imipenem-
resistant Vc
= variant of IC.
MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII FROM IRAN 637
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
7. the prospects of availability of novel antimicrobials against
PDR-AB infections seem bleak.4,5
We recently tested 200
additional MDR-AB isolates, which were 100% susceptible to
either tobramycin or minocycline (Bahador, A. et al., un-
published data), and plan to verify these results in an in vivo
model. Rising colistin resistance and poor clinical outcome43
combined with high cost of tigecycline underscore the value
of such assessments for developing countries. Combination
therapy has reduced the risk of emergence of resistant strains
in HIV disease, tuberculosis, as well as malaria39,40
; some
results of combination antibiotics against PDR-AB strains are
promising.4,5,15,26
Taken together, our MDR-AB resistance and genotypic
profile data suggest that MDR-AB isolates from IKMC and
CMC represent a dynamic population whose members un-
dergo marked clonal and susceptibility changes during a 5-
year period. These clonal changes have given rise to novel
MDR-AB variants, which present serious infection control
challenges in Iran because resistance has probably contrib-
uted to their spread.12,22,41
This underscores the importance
of enforcing continuous molecular epidemiologic monitor-
ing programs in Iranian hospitals; however, method varia-
tion in studying the MDR-AB genotypic diversity from
different parts of Iran1,9
has complicated data comparisons
rendering the analyses inconclusive. Our recent finding of
similar MDR-AB genotypes from Tehran (various areas
of Iran3
) highlights the critical need for implementation of
concerted monitoring and infection control policies, as well
as local standardization of MDR-AB genotypic data analysis
at the national level in Iran.
Additionally, at a regional level, the predominance of IC
type II among our MDR-AB isolates is consistent with re-
ports from other Asian countries, including China, Pakistan,
South Korea, and Taiwan.12
However, the high number
of novel IC variants, from 2011, suggests that MDR-AB
isolates from our sites may share similarities with local
A. baumannii strains collected from regions closer to Teh-
ran, as reported recently.3,16
Although the A. baumannii IC
grouping was devised using mostly isolates from Europe and
the United States,18
identification of novel IC variants in Iran
and several European countries41
highlights the need for a
comprehensive global system to group MDR-AB isolates.
In conclusion, we present evidence that MDR-AB isolates
from Iran represent a dynamic population that undergoes
marked genotypic and antimicrobial susceptibility change
over 5 years. While these changes lead to development of
resistance to several first-line and last-resort drugs, a ma-
jority of resistant MDR-AB remain sensitive to conventional
agents, such as tobramycin and minocycline, which are vi-
able agents in controlling MDR-AB outbreaks, especially in
developing countries. Our findings highlight the importance
of a comprehensive, national, susceptibility review program,
which evaluates MDR-AB isolates from various parts of
Iran. It also contends that effective global control measures
against MDR-AB depend on vigilant epidemiologic moni-
toring of susceptibility profiles and novel IC clone variants
of MDR-AB from all regions of the world, including Iran.
Acknowledgments
The authors would like to thank the dedicated ICU staff
and laboratory personnel at the IKMC and CIDC hospitals
(Tehran University of Medical Sciences Complex), who
helped collect specimens for this study. They are also
grateful to Dr. M.M. Feizabadi for the kind gift of A. bau-
mannii NCTC 12156 as well as several clinical A. bau-
mannii isolates.
Funding: This study was funded, in part, by the Office of
Vice Dean for Medical Research at the Tehran University of
Medical Sciences; grant No. 89. 01-30-10430.
Ethical approval: not required.
Disclosure Statement
No competing financial interests exist.
References
1. Asadollahi, P., S. Soroush, M. Taherikalani, K. Asa-
dollahi, K. Sayehmiri, A. M. Maleki, P. Karimi, and M.
Emaneini. 2012. Antimicrobial resistance patterns and
their encoding genes among Acinetobacter baumannii
strains isolated from burned patients. Burns 38:1198–
1203.
2. Bahador, A., A. Bazargani, M. Taheri, Z. Hashe-
mizadeh, A. Khaledi, H. Rostami, and D. Esmaili. 2013.
Clonal lineages and virulence factors among Acinetobacter
baumannii isolated from Southwest of Iran. J. Pure Appl.
Micribiol. 7:1559–1566.
3. Bahador, A., M. Taheri, B. Pourakbari, Z. Ha-
shemizadeh, H. Rostami, N. Mansoori, and R. Raoofian.
2014. Emergence of rifampicin, tigecycline, and colistin-
resistant Acinetobacter baumannii in Iran; spreading of
MDR strains of novel international clone variants. Microb.
Drug Resist. 19:397–406.
4. Chopra, S., M. Torres-Ortiz, L. Hokama, P. Madrid, M.
Tanga, K. Mortelmans, K. Kodukula, and A.K. Ga-
lande. 2010. Repurposing FDA-approved drugs to com-
bat drug-resistant Acinetobacter baumannii. J. Antimicrob.
Chemother. 65:2598–2601.
5. Chopra, S.M.K., T. Tran, and P. Madrid. 2012. Sys-
tematic discovery of synergistic novel antibiotic combina-
tions targeting multidrug resistant Acinetobacter
baumannii. Int. J. Antimicrob. Agents 40:377–379.
6. Dijkshoorn, L., A. Nemec, and H. Seifert. 2007. An in-
creasing threat in hospitals: multidrug-resistant Acineto-
bacter baumannii. Nat. Rev. Microbiol. 5:939–951.
7. Eliopoulos, G.M., L.L. Maragakis, and T.M. Perl. 2008.
Acinetobacter baumannii: epidemiology, antimicrobial re-
sistance, and treatment options. Clin. Infect. Dis. 46:1254–
1263.
8. Farajnia. S., F. Azhari, M.Y. Alikhani, M.K. Hosseini,
A. Peymani, and N. Sohrabi. 2013. Prevalence of PER
and VEB type extended spectrum betalactamases among
multidrug resistant Acinetobacter baumannii isolates in
North-West of Iran. Iran. J. Basic Med. Sci. 16:751–755.
9. Feizabadi, M.M, B. Fathollahzadeh, M. Taherikalani, M.
Rasoolinejad, N. Sadeghifard, M. Aligholi, S. Soroush,
and S. Mohammadi-Yegane. 2008. Antimicrobial suscep-
tibility patterns and distribution of blaOXA genes among
Acinetobacter spp. isolated from patients at Tehran hospi-
tals. Jpn. J. Infect. Dis. 61:274–278.
10. Fishbain, J., and A.Y. Peleg. 2010. Treatment of Acine-
tobacter infections. Clin. Infect. Dis. 51:79–84.
11. Giamarellou, H., A. Antoniadou, and K. Kanellako-
poulou. 2008. Acinetobacter baumannii: a universal threat
to public health? Int. J. Antimicrob. Agents 32:106–119.
638 BAHADOR ET AL.
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
8. 12. Higgins, P.G., C. Dammhayn, M. Hackel, and H. Seifert.
2010. Global spread of carbapenem-resistant Acinetobacter
baumannii. J. Antimicrob. Chemother. 65:233–238.
13. Higgins, P.G., M. Lehmann, H. Wisplinghoff, and H.
Seifert. 2010. gyrB multiplex PCR to differentiate between
Acinetobacter calcoaceticus and Acinetobacter genomic
species 3. J. Clin. Microbiol. 48:4592–4594.
14. Kempf, M., and J.M. Rolain. 2012. Emergence of
resistance to carbapenems in Acinetobacter baumannii in
Europe: clinical impact and therapeutic options. Int. J.
Antimicrob. Agents 39:105–114.
15. Kiratisin, P., A. Apisarnthanarak, and S. Kaewdaeng.
2010. Synergistic activities between carbapenems and other
antimicrobial agents against Acinetobacter baumannii in-
cluding multidrug-resistant and extensively drug-resistant
isolates. Int. J. Antimicrob. Agents 36:243–246.
16. Kulah, C., M.J. Mooij, F. Comert, E. Aktas, G.Celebi,
N. Ozlu, M.C. Rijnsburger, and P.H. Savelkoul. 2010.
Characterisation of carbapenem -resistant Acinetobacter
baumannii outbreak strains producing OXA-58 in Turkey.
Int. J. Antimicrob. Agents 36:114–118.
17. Lee, K., D. Yong, S.H. Jeong, and Y. Chong. 2011.
Multidrug-resistant Acinetobacter spp.: increasingly prob-
lematic nosocomial pathogens. Yonsei Med. J. 52:879–
891.
18. Livermore, D.M., R.L. Hill, H. Thomson, A. Charlett,
J.F. Turton, R. Pike, B.C. Patel, R. Manuel, S. Gillespie,
and I.Balakrishnan. 2010. Antimicrobial treatment and
clinical outcome for infections with carbapenem-and mul-
tiply-resistant Acinetobacter baumannii around London.
Int. J. Antimicrob. Agents 35:19–24.
19. Lockhart, S.R., M.A. Abramson, S.E. Beekmann, G.
Gallagher, S. Riedel, D.J. Diekema, J.P. Quinn, and
G.V. Doern. 2007. Antimicrobial resistance among Gram-
negative bacilli causing infections in intensive care unit
patients in the United States between 1993 and 2004.
J. Clin. Microbiol. 45:3352–3359.
20. Magiorakos, A.P., A. Srinivasan, R. Carey, Y. Carmeli,
M. Falagas, C. Giske, S. Harbarth, J. Hindler, G.
Kahlmeter, and B. Olsson-Liljequist. 2012. Multidrug-
resistant, extensively drug-resistant and pandrug-resistant
bacteria: an international expert proposal for interim stan-
dard definitions for acquired resistance. Clin. Microbiol.
Infect. 18:268–281.
21. National Committee for Clinical Laboratory Standards
(NCCLS). 2011. Performance standards for antimicrobial
susceptibility testing. Twenty-Third informational supple-
ment M100-S23, Wayne: NCCLS, 33:66–69.
22. Nemec, A., L. Krˇı´zova´, M. Maixnerova´, L. Diancourt,
T.J. van der Reijden, S. Brisse, P. van den Broek, and
L. Dijkshoorn. 2008. Emer gence of carbapenem resis-
tance in Acinetobacter baumannii in the Czech Republic
is associated with the spread of multidrug-resistant strains
of European clone II. J. Antimicrob. Chemother. 62:484–
489.
23. Neonakis, I.K., D.A. Spandidos, and E. Petinaki. 2011.
Confronting multidrug-resistant Acinetobacter baumannii:
a review. Int. J. Antimicrob. Agents 37:102–109.
24. Peleg, A.Y., H. Seifert, and D.L. Paterson. 2008. Acine-
tobacter baumannii: emergence of a successful pathogen.
Clin. Microbiol. Rev. 21:538–582.
25. Peymani, A., S. Farajnia, M.R. Nahaei, N. Sohrabi, L.
Abbasi, K. Ansarin, and F. Azhari. 2012. Prevalence of
class 1 integron among multidrug-resistant Acinetobacter
baumannii in Tabriz, northwest of Iran. Pol. J. Microbiol.
61:57–60.
26. Rahal, J.J. 2006. Novel antibiotic combinations against
infections with almost completely resistant Pseudomonas
aeruginosa and Acinetobacter species. Clin. Infect. Dis.
43:S95–S99.
27. Rahbar, M., H. Mehrgan, and N.H. Aliakbari. 2010.
Prevalence of antibiotic-resistant Acinetobacter baumannii
in a 1000-bed tertiary care hospital in Tehran, Iran. Indian
J. Pathol. Microbiol. 53:290–293.
28. Rezaee, M.A., O. Pajand, M.R. Nahaei, R. Mahdian, M.
Aghazadeh, M. Ghojazadeh, and Z. Hojabri. 2013.
Prevalence of Ambler class A b-lactamases and ampC
expression in cephalosporin-resistant isolates of Acineto-
bacter baumannii. Diagn. Microbiol. Infect. Dis. 76:330–
334.
29. Safari, M., M. Saidijam, A. Bahador, R. Jafari, and
M.Y. Alikhani. 2013. High prevalence of multidrug re-
sistance and Metallo-beta-lactamase (MbL) producing
Acinetobacter baumannii isolated from patients in ICU
wards, Hamadan, Iran. J. Res. Health Sci. 13:162–167.
30. Sa´nchez, A., S. Gattarello, and J. Rello. 2011. New
treatment options for infections caused by multiresistant
strains of Pseudomonas aeruginosa and other nonferment-
ing Gram-negative bacilli. Semin. Respir. Crit. Care Med.
32:151–158.
31. Shahcheraghi, F., M. Abbasalipour, M.M. Feizabadi, G.
Ebrahimipour, and N. Akbari. 2011. Isolation and ge-
netic characterization of metallo-b-lactamase and carba-
penamase producing strains of Acinetobacter baumannii
from patients at Tehran hospitals. Iran. J. Microbiol. 3:68.
32. Sistanizad, M., M. Kouchek, M. Miri, R. Goharani, M.
Solouki, L. Ayazkhoo, M. Foroumand, and M. Mokh-
tari. 2013. Carbapenem restriction and its Effect on Bac-
terial Resistance in an Intensive Care unit of a Teaching
Hospital. Iran. J. Pharm. Res. 12:503–509.
33. Sobieszczyk, M.E., E.Y. Furuya, C.M. Hay, P. Pancholi,
P. Della-Latta, S.M. Hammer, and C.J. Kubin. 2004.
Combination therapy with polymyxin B for the treatment of
multidrug-resistant Gram-negative respiratory tract infec-
tions. J. Antimicrob. Chemother. 54:566–569.
34. Sohrabi, N., S. Farajnia, M.T. Akhi, M.R. Nahaei, B.
Naghili, A. Peymani, Z. Amiri, M.A. Rezaee, and N.
Saeedi. 2012. Prevalence of OXA-type b-lactamases
among Acinetobacter baumannii isolates from Northwest
of Iran. Microb. Drug Resist. 18:385–389.
35. Taherikalani, M., B. Fatolahzadeh, M. Emaneini, S.
Soroush, and M.M. Feizabadi. 2009. Distribution of dif-
ferent carbapenem resistant clones of Acinetobacter bau-
mannii in Tehran hospitals. New Microbiol. 32:265–271.
36. Taherikalani, M., A. Maleki, N. Sadeghifard, D. Mo-
hammadzadeh, S. Soroush, P. Asadollahi, K. Asadollahi,
and M. Emaneini. 2011. Dissemination of class 1, 2 and 3
integron s among different multidrug resistant isolates of
Acinetobacter baumannii in Tehran hospitals, Iran. Iran.
Pol. J. Microbiol. 60:169–174.
37. The European Committee on Antimicrobial Suscept-
ibility Testing (EUCAST). 2014. Breakpoint Tables for
Interpretation of MICs and Zone Diameters, Version 4.0.
Available at wwweucastorg/clinical_breakpoints, accessed
1st January 2014. (Online.)
38. Thomson, K.S. 2010. Extended-spectrum-b-lactamase,
AmpC, and carbapenemase issues. J. Clin. Microbiol. 48:
1019–1025.
MULTIDRUG-RESISTANT ACINETOBACTER BAUMANNII FROM IRAN 639
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N
9. 39. Tomioka, H., and K. Namba. 2006. [Development of
antituberculous drugs: current status and future prospects]
(In Japanese). Kekkaku 81:753–774.
40. Tougher, S., Y. Ye, J.H. Amuasi, I.A. Kourgueni, R.
Thomson, C. Goodman, A.G. Mann, R. Ren, B.A. Will-
ey, and C.A. Adegoke. 2012. Effect of the Affordable
Medicines Facility—malaria (AMFm) on the availability,
price, and market share of quality-assured artemisinin-
based combination therapies in seven countries: a before-
and-after analysis of outlet survey data. Lancet 380:1916–
1926.
41. Towner K., K. Levi, and M. Vlassiadi. 2008. Genetic
diversity of carbapenem-resistant isolates of Acineto-
bacter baumannii in Europe. Clin. Microbiol. Infect. 14:
161–167.
42. Turton, J., S. Gabriel, C. Valderrey, M. Kaufmann, and
T. Pitt. 2007. Use of sequence-based typing and multiplex
PCR to identify clonal lineages of outbreak strains of
Acinetobacter baumannii. Clin. Microbiol. Infect. 13:807–
815.
43. Whitman, T.J., S.S. Qasba, J.G. Timpone, B.S. Babel,
M.R. Kasper, J.F. English, J.W. Sanders, K.M. Hujer,
A.M. Hujer, and A. Endimiani. 2008. Occupational
transmission of Acinetobacter baumannii from a United
States serviceman wounded in Iraq to a health care worker.
Clin. Infect. Dis. 47:439–443.
Address correspondence to:
Farhad B. Hashemi, PhD
Department of Microbiology
School of Medicine
Tehran University of Medical Sciences
Building No. 6
100 Poursina Street
Tehran 14167-53955
Iran
E-mail: bonakdar@tums.ac.ir;
farhadb.hashemi@gmail.com
640 BAHADOR ET AL.
FO
R
R
EVIEW
O
N
LY
N
O
T
IN
TEN
D
ED
FO
R
D
ISTR
IBU
TIO
N
O
R
R
EPR
O
D
U
C
TIO
N