This document provides a methodology for conducting risk assessments of buildings to mitigate potential terrorist attacks. It outlines a 5-step process: 1) identifying threats, 2) assessing asset values, 3) evaluating vulnerabilities, 4) determining risks, and 5) considering mitigation options. The goal is to identify cost-effective security measures to minimize risks. Appendices include a Building Vulnerability Assessment Checklist and guidance for a Risk Assessment Database to organize risk scoring and mitigation data for multiple buildings.
This article discusses approaches to assessing the adequacy of a firm's cybersecurity posture. It proposes that assessments should be conducted in phases focusing on attack vectors, using skilled assessors with a variety of tools. Assessments should take a risk-based approach, ensure patch management is adequate, review defense-in-depth strategies, and use standards like NIST SP 800-53 to test the actual security state. The assessments aim to identify vulnerabilities and ensure perimeter defenses and compliance-based strategies are updated to address evolving cyber risks.
This document discusses safety, risk, and ethics in engineering. It covers definitions of safety and risk, methods for assessing safety and risk, factors that influence risk acceptability, and uncertainties in product design. Safety is defined as acceptable risk, while risk is the probability and consequence of potential harm. Engineers must consider various uncertainties and test products thoroughly to minimize risk and ensure safety. Proper risk assessment and management require effective communication between experts and the public.
Lightweight Cybersecurity Risk Assessment Tools for Cyberinfrastructurejbasney
Presented Nov 11 2017
http://www.stem-trek.org/news-events/urisc/
“Lightweight Cybersecurity Risk Assessment Tools for Cyberinfrastructure”
Risk assessment provides valuable insights to the cyberinfrastructure security program, but launching a risk assessment process can seem daunting for all but the largest projects. Jim Basney will present risk assessment tools (checklists, spreadsheets, templates) developed by CTSC (trustedci.org) for getting started on a lightweight risk assessment for cyberinfrastructure projects of varying types and sizes.
CHAPTER 7 Risk Assessment, Security Surveys, and PlanningLEARNIN.docxchristinemaritza
CHAPTER 7 Risk Assessment, Security Surveys, and Planning
LEARNING OBJECTIVES
After completing this chapter, the reader should be able to
· ■ define risk and risk assessment.
· ■ list and describe five distinct types of risk that threaten individuals and organizations.
· ■ discuss management techniques associated with risk elimination, reduction, and mitigation.
· ■ evaluate risks to determine vulnerability, probability, and criticality of loss.
· ■ conduct a risk assessment utilizing subjective as well as objective measurements.
· ■ conduct a security survey.
· ■ analyze needs identified through a risk assessment.
· ■ develop appropriate courses of action to eliminate, reduce, or mitigate risks identified in a risk assessment.
· ■ discuss the importance of the budget process.
· ■ demonstrate knowledge of crime prevention through environmental design.
· ■ demonstrate knowledge of emergency planning.
INTRODUCTION
A major focus for security management is the concept of risk. Subjective information as well as objective measurement instruments (such as a security survey) are used in an essential first step of a planning process designed to identify and assess the threat posed by each risk source. As the planning process proceeds, security personnel make recommendations and determine the financial impact of any potential risk mitigation strategy. Planning activities also involve preparation for emergency situations and consideration of anticrime measures available through environmental manipulation.
THE CONCEPT OF RISK
Risk Defined
Risk may be defined as the possibility of suffering harm or loss, exposure to the probability of loss or damage, an element of uncertainty, or the possibility that results of an action may not be consistent with the planned or expected outcomes. A decision maker evaluates risk conditions to predict or estimate the likelihood of certain outcomes. From a security perspective, risk management is defined as the process involved in the anticipation, recognition, and appraisal of a risk and the initiation of action to eliminate the risk entirely or reduce the threat of harm to an acceptable level. A risk involves a known or foreseeable threat to an organization’s assets: people, property, information, or reputation. Risk cannot be totally eliminated. However, effective loss prevention programs can reduce risk and its impact to the lowest possible level. An effective risk management program can maximize asset protection while minimizing protection costs (Fay, 2000; Fischer & Janoski, 2000; Kovacich & Halibozek, 2003; Robbins & Coulter, 2009; Simonsen, 1998; Sweet, 2006).
Types of Risk
Generally, risk is associated with natural phenomena or threats created by human agents. Natural risks arise from earthquakes, volcanic eruptions, floods, and storms. Risks created by human beings include acts or failures to act that lead to crime, accidents, or environmental disaster. As many as five distinct types of risk threaten individuals a ...
unit4.pptx professional ethics in engineeringPoornachanranKV
Is a morality or standard of righteous behaviour in relationship to citizen’s involvement in society.
Cultivation of individual habits important for a communities success.
CHALLENGES IN THE WORK PLACE
• The biggest workplace
challenge is said to be the
employee’s work ethics.
• interest in work and
attendance
• Punctuality
• commitment to the job,
and getting along with
others
• Demands inculcation of
good character in the
workplace by employees.
• good character
• The Four Temperaments
• Types of Character
• the sensitive
• the active (great and the
mediocre)
• the apathetic (purely
apathetic or dull),
• the intelligent.
• Ethics and Character
• Education and Character
• Building Character in the
Workplace
Building Character in the Workplace
1. Employee Hiring, Training, and Promotion Activities
– Institute and adopt an organization policy statement to
positive character in the workplace.
– Prominently and explicitly include character
considerations in recruiting procedures
– Emphasize the importance of character and adherence to
the ‘six pillars’ of character(trustworthiness, respect,
responsibility, fairness, caring and citizenship)
– Include evaluation of fundamental character values
– Institute recognition and reward system for the employees
– Think of your employees
Building Character in the Workplace
2. Internal Communication
– to create a friendly environment that praises positive role
modeling
– Through Internal newsletters, Workplace posters in canteens
and recreation rooms, Mailers, Electronic mails.
3. External Communication
– In relations with customers, vendors and others.
– Advertise and market honoring consensual values (the six
pillars),
– Assure that none of your products and services undermines
character building,
– Include positive messages about voluntarism and celebrate, and
– ‘Character counts’ week in advertising, billings and other
mailers.
Building Character in the Workplace
4. Financial and Human Resources
– Support local and national ‘character’ projects and the
activities of the members
– Sponsor ‘character’ movement through financial
support.
5. Community Outreach
– Use public outreach structures to encourage
mentoring and other character-building programs.
– Encourage educational and youth organizations to
become active in character building.
– Use corporate influence to encourage business groups
and other companies to support ‘character’ building.
SPIRITUALITY
• Spirituality is a way of living that emphasizes the constant
awareness and recognition of the spiritual dimension (mind and its
development) of nature and people, with a dynamic balance
between the material development and the spiritual development.
• spirituality includes the faith or belief in supernatural power
• Spirituality includes creativity, communication, recognition of the
individual as human being, respect to others, acceptance, vision,
and partnership
• Spirituality is motivation as it encourages the colleagues to perform
better. Cr
Risk Assessment for Building Construction Sites in Myanmarijtsrd
In Myanmar, construction industries carry on to become safety first. There are many hazards and risks in construction that can cause employee injuries and illnesses. In order to be safe, risk assessment technique is widely used in international but less in Myanmar. So this paper aims to help what kind of risks can occur and to know how to reduce these risks by using additional controls. Firstly, it is required to collect data. Therefore, three construction companies in Mandalay Myanmar are chosen. Hazards are obtained from the observed data. Questionnaires concerned with likelihood and severity are collected from the project engineers in these sites. The results from questionnaires are used to evaluate the risks. The evaluated risks are reviewed whether these are acceptable or additional controls are required to reduce risks. On the basis of outcome results, risk prioritization number charts can be obtained. Thus, this study can provide for developing necessary controls to reduce risks and to be safe for construction industries. Nyein Nyein Thant | Zin Mar Soe "Risk Assessment for Building Construction Sites in Myanmar" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-5 , August 2019, URL: https://www.ijtsrd.com/papers/ijtsrd26655.pdfPaper URL: https://www.ijtsrd.com/engineering/civil-engineering/26655/risk-assessment-for-building-construction-sites-in-myanmar/nyein-nyein-thant
US Government Software Assurance and Security InitiativesiLindsey Landolfi
This document provides an overview of software assurance (SwA) initiatives within the US federal government. It discusses how the Department of Homeland Security established the National Cyber Security Division Software Assurance Program to promote software security, integrity, and resiliency. It also describes the development of a common measurement framework to help organizations implement security best practices throughout the software development lifecycle. Finally, it analyzes security risks and mitigation strategies for Supervisory Control and Data Acquisition (SCADA) systems used in critical infrastructure through examples like the Stuxnet malware.
Quantified Risk Assessment as a decision support for the protection of the Cr...Community Protection Forum
by Micaela Demichela
SAfeR – Centro Studi su Sicurezza Affidabilità e Rischi Dipartimento di Scienza Applicata e Tecnologia - Politecnico di Torino
e-mail: micaela.demichela@polito.it
This article discusses approaches to assessing the adequacy of a firm's cybersecurity posture. It proposes that assessments should be conducted in phases focusing on attack vectors, using skilled assessors with a variety of tools. Assessments should take a risk-based approach, ensure patch management is adequate, review defense-in-depth strategies, and use standards like NIST SP 800-53 to test the actual security state. The assessments aim to identify vulnerabilities and ensure perimeter defenses and compliance-based strategies are updated to address evolving cyber risks.
This document discusses safety, risk, and ethics in engineering. It covers definitions of safety and risk, methods for assessing safety and risk, factors that influence risk acceptability, and uncertainties in product design. Safety is defined as acceptable risk, while risk is the probability and consequence of potential harm. Engineers must consider various uncertainties and test products thoroughly to minimize risk and ensure safety. Proper risk assessment and management require effective communication between experts and the public.
Lightweight Cybersecurity Risk Assessment Tools for Cyberinfrastructurejbasney
Presented Nov 11 2017
http://www.stem-trek.org/news-events/urisc/
“Lightweight Cybersecurity Risk Assessment Tools for Cyberinfrastructure”
Risk assessment provides valuable insights to the cyberinfrastructure security program, but launching a risk assessment process can seem daunting for all but the largest projects. Jim Basney will present risk assessment tools (checklists, spreadsheets, templates) developed by CTSC (trustedci.org) for getting started on a lightweight risk assessment for cyberinfrastructure projects of varying types and sizes.
CHAPTER 7 Risk Assessment, Security Surveys, and PlanningLEARNIN.docxchristinemaritza
CHAPTER 7 Risk Assessment, Security Surveys, and Planning
LEARNING OBJECTIVES
After completing this chapter, the reader should be able to
· ■ define risk and risk assessment.
· ■ list and describe five distinct types of risk that threaten individuals and organizations.
· ■ discuss management techniques associated with risk elimination, reduction, and mitigation.
· ■ evaluate risks to determine vulnerability, probability, and criticality of loss.
· ■ conduct a risk assessment utilizing subjective as well as objective measurements.
· ■ conduct a security survey.
· ■ analyze needs identified through a risk assessment.
· ■ develop appropriate courses of action to eliminate, reduce, or mitigate risks identified in a risk assessment.
· ■ discuss the importance of the budget process.
· ■ demonstrate knowledge of crime prevention through environmental design.
· ■ demonstrate knowledge of emergency planning.
INTRODUCTION
A major focus for security management is the concept of risk. Subjective information as well as objective measurement instruments (such as a security survey) are used in an essential first step of a planning process designed to identify and assess the threat posed by each risk source. As the planning process proceeds, security personnel make recommendations and determine the financial impact of any potential risk mitigation strategy. Planning activities also involve preparation for emergency situations and consideration of anticrime measures available through environmental manipulation.
THE CONCEPT OF RISK
Risk Defined
Risk may be defined as the possibility of suffering harm or loss, exposure to the probability of loss or damage, an element of uncertainty, or the possibility that results of an action may not be consistent with the planned or expected outcomes. A decision maker evaluates risk conditions to predict or estimate the likelihood of certain outcomes. From a security perspective, risk management is defined as the process involved in the anticipation, recognition, and appraisal of a risk and the initiation of action to eliminate the risk entirely or reduce the threat of harm to an acceptable level. A risk involves a known or foreseeable threat to an organization’s assets: people, property, information, or reputation. Risk cannot be totally eliminated. However, effective loss prevention programs can reduce risk and its impact to the lowest possible level. An effective risk management program can maximize asset protection while minimizing protection costs (Fay, 2000; Fischer & Janoski, 2000; Kovacich & Halibozek, 2003; Robbins & Coulter, 2009; Simonsen, 1998; Sweet, 2006).
Types of Risk
Generally, risk is associated with natural phenomena or threats created by human agents. Natural risks arise from earthquakes, volcanic eruptions, floods, and storms. Risks created by human beings include acts or failures to act that lead to crime, accidents, or environmental disaster. As many as five distinct types of risk threaten individuals a ...
unit4.pptx professional ethics in engineeringPoornachanranKV
Is a morality or standard of righteous behaviour in relationship to citizen’s involvement in society.
Cultivation of individual habits important for a communities success.
CHALLENGES IN THE WORK PLACE
• The biggest workplace
challenge is said to be the
employee’s work ethics.
• interest in work and
attendance
• Punctuality
• commitment to the job,
and getting along with
others
• Demands inculcation of
good character in the
workplace by employees.
• good character
• The Four Temperaments
• Types of Character
• the sensitive
• the active (great and the
mediocre)
• the apathetic (purely
apathetic or dull),
• the intelligent.
• Ethics and Character
• Education and Character
• Building Character in the
Workplace
Building Character in the Workplace
1. Employee Hiring, Training, and Promotion Activities
– Institute and adopt an organization policy statement to
positive character in the workplace.
– Prominently and explicitly include character
considerations in recruiting procedures
– Emphasize the importance of character and adherence to
the ‘six pillars’ of character(trustworthiness, respect,
responsibility, fairness, caring and citizenship)
– Include evaluation of fundamental character values
– Institute recognition and reward system for the employees
– Think of your employees
Building Character in the Workplace
2. Internal Communication
– to create a friendly environment that praises positive role
modeling
– Through Internal newsletters, Workplace posters in canteens
and recreation rooms, Mailers, Electronic mails.
3. External Communication
– In relations with customers, vendors and others.
– Advertise and market honoring consensual values (the six
pillars),
– Assure that none of your products and services undermines
character building,
– Include positive messages about voluntarism and celebrate, and
– ‘Character counts’ week in advertising, billings and other
mailers.
Building Character in the Workplace
4. Financial and Human Resources
– Support local and national ‘character’ projects and the
activities of the members
– Sponsor ‘character’ movement through financial
support.
5. Community Outreach
– Use public outreach structures to encourage
mentoring and other character-building programs.
– Encourage educational and youth organizations to
become active in character building.
– Use corporate influence to encourage business groups
and other companies to support ‘character’ building.
SPIRITUALITY
• Spirituality is a way of living that emphasizes the constant
awareness and recognition of the spiritual dimension (mind and its
development) of nature and people, with a dynamic balance
between the material development and the spiritual development.
• spirituality includes the faith or belief in supernatural power
• Spirituality includes creativity, communication, recognition of the
individual as human being, respect to others, acceptance, vision,
and partnership
• Spirituality is motivation as it encourages the colleagues to perform
better. Cr
Risk Assessment for Building Construction Sites in Myanmarijtsrd
In Myanmar, construction industries carry on to become safety first. There are many hazards and risks in construction that can cause employee injuries and illnesses. In order to be safe, risk assessment technique is widely used in international but less in Myanmar. So this paper aims to help what kind of risks can occur and to know how to reduce these risks by using additional controls. Firstly, it is required to collect data. Therefore, three construction companies in Mandalay Myanmar are chosen. Hazards are obtained from the observed data. Questionnaires concerned with likelihood and severity are collected from the project engineers in these sites. The results from questionnaires are used to evaluate the risks. The evaluated risks are reviewed whether these are acceptable or additional controls are required to reduce risks. On the basis of outcome results, risk prioritization number charts can be obtained. Thus, this study can provide for developing necessary controls to reduce risks and to be safe for construction industries. Nyein Nyein Thant | Zin Mar Soe "Risk Assessment for Building Construction Sites in Myanmar" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-5 , August 2019, URL: https://www.ijtsrd.com/papers/ijtsrd26655.pdfPaper URL: https://www.ijtsrd.com/engineering/civil-engineering/26655/risk-assessment-for-building-construction-sites-in-myanmar/nyein-nyein-thant
US Government Software Assurance and Security InitiativesiLindsey Landolfi
This document provides an overview of software assurance (SwA) initiatives within the US federal government. It discusses how the Department of Homeland Security established the National Cyber Security Division Software Assurance Program to promote software security, integrity, and resiliency. It also describes the development of a common measurement framework to help organizations implement security best practices throughout the software development lifecycle. Finally, it analyzes security risks and mitigation strategies for Supervisory Control and Data Acquisition (SCADA) systems used in critical infrastructure through examples like the Stuxnet malware.
Quantified Risk Assessment as a decision support for the protection of the Cr...Community Protection Forum
by Micaela Demichela
SAfeR – Centro Studi su Sicurezza Affidabilità e Rischi Dipartimento di Scienza Applicata e Tecnologia - Politecnico di Torino
e-mail: micaela.demichela@polito.it
2016 Resilience Survey for Real Estate and Critical Infrastructure ProjectsJulian R
Control Risks has conducted this survey with a view to better understanding the perception and approach taken to
security and resilience by those who deal with real estate and critical infrastructure. We surveyed more than 100
architects, developers, investors, end-users and engineers.
Homeland Security Building RecommendationsChuck Thompson
http://www.gloucestercounty-va.com This is the building security recommendations for schools from Homeland Security. 317 pages up to date and complete. Is your school safe?
Running Head CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUS.docxhealdkathaleen
Running Head: CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUSTRY TO ELIMINATE SECURITY RISKS 2
CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUSTRY TO ELIMINATE SECURITY RISKS 2
Current Techniques Implemented in the Construction Industry to Eliminate Security Risks
Group 4
Balaram Chekuri
Laxmi Sravani Vallurpallis
Mohan Kadali
Shivasai Pabba
Vaagdevi Jali
University of the Cumberlands
ITS835-41 Enterprise Risk Management
Residency Assignment Research Paper
Professor Dr. James C. Hyatt
10/20/2019
Statement of the Problem and it is Setting
Risk management has been one of the breakthroughs for the modern world, and at the same one of the intellectual achievements is the identification, transformation, or risk and going from a world that described risk as fate to a world that looks at risk as an area of study. Risk management is the utilization of risk analysis to come up with management strategies used to reduce risk. Whereby generally in project management there are the two techniques categories qualitative; that involves impact and probability assessment, expected value calculations and influence diagrams and quantitative; that typically focuses on the overall risk which is managed more with numerical approach, and has techniques such as decision trees, Monte Carlo analysis and sensitivity analysis (McNeil et al. 2015). In various fields, there is enormous risk faced, and at the same time, there is a corresponding quantitative technique that can be used to address the risk. The focus is on the quantitative risk management techniques; they are based on scientific, mathematical and statistical background, that promise to give thorough and detailed management and quantification of risk that is imperative for designing the response (Teixeira et al. 2015).
This paper, based on the construction industry, provides an overview of the analytic overview of different quantitative risk analysis techniques. There is a focus on building on the existing quantitative techniques that are best for the construction industry around the world when it comes to utilizing relevant techniques after a qualitative risk analysis. In addition to this, there is looking further into the techniques and their details.
Guiding Questions
· Does Your Risk Management Process Address Root Cause of Failure?
· Are there gaps in this field?
· What Does Your Business Performance Tell You About Risk?
· What Do Controls Tell You About Your Risks?
· The main focus is looking at the practitioners and researchers looking: at the reason why they should simplify the existing techniques?
· Which, at the same looks at the research gaps in this field and propose areas of further research for project risk management in construction, which will improve the existing techniques.
Assumptions
Project Risk manage ...
M.I.P. Security is a leading security consulting firm that offers strategic security assessments, physical security projects, risk assessment and mitigation, and security training. They have extensive experience working with governments and major corporations around the world. Their team of experts can analyze threats, identify vulnerabilities, and design cost-effective security solutions to meet any organization's protection needs.
Risk management plan
Executive Summary
The past few decades have seen technological evolutions on a rapid scale with the growth of the industry taking over the world by storm. Governments and companies alike are investing in further research and development of futuristic technologies in order to work towards a more efficient future in terms of productivity and task automation. The evolution of computers and powerful technologies being made available to the public with them having high processing power and some being small, powerful and portable has led to people having information in their hands, literally.
However, with the advantages of the recently introduced technologies, there still are threats brought about by the same since they have raised privacy and other security concerns as well as health concerns associated with a number of the devices. This paper is aimed at identification of strategies to handle risks which may arise from the continuous development of new technologies (Galati, 2015). Comment by Schneider, Paul: This is the only sentence in this summary which focuses on the paper, and it does a very poor job of previewing everything that the reader will see in this paper.
Project Summary
Scope Comment by Schneider, Paul: This section tells me nothing about the scope for your project. What are the task/activities needed to successfully complete your project?
This report is important in analysis of the importance of information technologies being managed and security implemented since with their introduction, most companies have taken them up therefore the need to prevent attacks via technologies implemented. Critical processes in business are reliant to information technologies therefore need for safeguarding them against hacking attacks among other similar threats relating to information technologies.
Milestones Comment by Schneider, Paul: This section tells me nothing about the milestones for your project. When does the project start? When does the project end? What are all of the milestones between the start & end?
All businesses especially in a technologically growing and depend world need to learn the vulnerabilities posed by the developments as well as methods which can be used to control or curb them. Most companies have successfully put in place firewalls and administrators of networks to monitor, analyze and notify of irregularities which may cause a breach to sensitive company information.
Cost Constraints Comment by Schneider, Paul: Very poor job.
In implementation of security within information technologies, there are costs involved, some being one off and others being recurrent however all serving the same purpose. Costs inclusive in implementation of security protocols are such as purchase as hardware and software offering security such as firewalls, antiviruses, antimalware programs and programs for detection of network intrusions. Costs can also arise from contracting an external organization to ...
This document provides an overview of risk identification and assessment. It defines risk and risk management, and outlines the key steps in the risk management cycle including risk identification, assessment, and analysis. Methods of risk assessment are also discussed, including qualitative, quantitative and hybrid approaches. National Institute of Standards and Technology (NIST) methodology is explained as one of the common risk assessment methodologies used. The responsibilities of different parties in conducting risk assessments are highlighted. A case study on risk assessment of a regulatory organization is presented to demonstrate the process.
This document presents chapter 13 from the book "Next Generation Disaster and Security Management". The chapter discusses how situation awareness is crucial for effective disaster management. It argues that new information technologies can help improve situation awareness by enabling the collection and sharing of real-time information from various sources. However, challenges remain in processing large amounts of data from diverse sources and ensuring the data's accuracy and usefulness for decision making. The chapter advocates for approaches to enhance situation awareness using new technologies while addressing issues around data quality and management.
Road Map to HIPAA Security Rules Compliance: Risk Analysis at Orbit ClinicsIOSR Journals
The organization, which will be used in this risk assessment report, is a healthcare provider and concealed name “Orbit Clinic” is to protect confidentiality and anonymity of the real clinic’s name. This assessment will look at the clinic IT systems only from HIPAA Security Rules point of view. This clinic has chosen because there are various threats and vulnerabilities, which are faced by these kinds of organizations especially regarding the electronic Personal Health Information (e-PHI). They also have sensitive financial data that need to be secured due to the possible threats and vulnerabilities facing them. The analysis approaches that have used are interviews, survey, automated tools like Zenmap and Nessus. In addition, Methodologies such as quantitative, qualitative and Practical Threat Analysis (PTA) were used to conduct the risk analysis. As a result, to this risk assessment, quite a number of vulnerabilities were observed. Furthermore, the project provided countermeasure to all observed vulnerabilities as well as the most cost effective plan to mitigate the risks.
IRJET- Projects in Constructions due to Inadequate Risk ManagementIRJET Journal
This document discusses risks in construction projects due to inadequate risk management. It begins by introducing the topic and defining key terms like risk management. It then discusses sources of failure in construction projects when there is no initial risk assessment or risk management. Some of the major causes of project failure discussed include changes without documentation or tracking, incomplete status reports, and undefined parameters.
The document presents results from a questionnaire survey given to construction industry experts. The survey found that most companies have a poor understanding of managing troubled projects and not all project managers have the necessary skills. It then provides recommendations for recovering from failed projects, including conducting a review to identify lessons learned and causes of failure. Overall, the document advocates that systematic risk management can help construction projects
Efficacy of OCTAVE Risk Assessment Methodology in Information Systems Organiz...Editor IJCATR
With the increasing use of computers in business information security has also become a key issue in organizations. Risk assessment in organizations is vital in order to identify threats and take appropriate measures. There are various risk assessment methodologies exist which organizations use for risk assessment depending the type and need of organizations. In this research OCTAVE methodology has been used following a comparative study of various methodologies due to its flexibility and simplicity. The methodology was implemented in a financial institution and results of its efficacy have been discussed.
Risk Management Appraisal - A tool for successful Infrastructure projectIRJET Journal
This document discusses risk management for infrastructure projects. It identifies eight categories of risk for infrastructure projects: management risks, technical and construction risks, contractual and legal risks, resource and site-related risks, economic and finance risks, environmental risks, social and political risks, and safety and health risks. The key steps of risk management discussed are risk identification, risk analysis including likelihood and impact assessment, and risk mitigation techniques. Quantitative and qualitative methods are used for risk analysis. Managing risks is seen as essential for successfully achieving project goals of time, cost, quality and objectives.
This research work x-rays the indispensability of continuous
risk assessment on data and communication devices, to ensure
that full business uptime is assured and to minimize, if not
completely eradicate downtime caused by “unwanted elements
of the society” ranging from hackers, invaders, network
attackers to cyber terrorists. Considering high-cost of
downtime and its huge business negative impact, it becomes
extremely necessary and critical to proactively monitor,
protect and defend your business and organization by ensuring
prompt and regular Risk assessment of the data and
communication devices which forms the digital walls of the
organization. The work also briefly highlights the
methodologies used, methodically discusses core risk
assessment processes, common existing network architecture
and its main vulnerabilities, proposed network architecture
and its risk assessment integration(Proof), highlights the
strengths of the proposed architecture in the face of present
day business threats and opportunities and finally emphasizes
importance of consistent communication and consultation of
stakeholders and Original Equipment Manufacturers (OEMs)
The role of Risk Assessment and Risk Management is to continuously Identify, Analyze, Plan, Track, Control, and Communicate the risks associated with a project.
The Webster’s definition of risk is the possibility of suffering a loss. Risk in itself is not bad. Risk is essential to progress and failure is often a key part of learning. Managing risk is a key part of
success.
This document describes the foundations for conducting a risk assessment of a large-scale system
development project. Such a project will likely include the procurement of Commercial Off The
Shelf (COTS) products as well as their integration with legacy systems.
Niwot Ridge
The role of Risk Assessment and Risk Management is to continuously Identify, Analyze, Plan, Track, Control, and Communicate the risks associated with a project.
The Webster’s definition of risk is the possibility of suffering a loss. Risk in itself is not bad. Risk is essential to progress and failure is often a key part of learning. Managing risk is a key part of success.
This document describes the foundations for conducting a risk assessment of a large-scale system development project. Such a project will likely include the procurement of Commercial Off The Shelf (COTS) products as well as their integration with legacy systems.
This document discusses safety, risk assessment, and testing for engineering designs. It provides information on different definitions of safety and risk, factors that influence risk acceptability, and challenges in assessing risk and safety due to uncertainties and lack of information. The document emphasizes that thorough testing of prototypes and finished products is essential to determine safety and ensure risks are minimized.
This document discusses risk management for information technology systems using the spiral model. It provides an overview of the risk management process, which involves identifying risks, assessing risks, and taking steps to reduce risks to an acceptable level. The risk management process should be integrated into the system development life cycle. Key aspects of the risk management process discussed include identifying and assessing risks, developing risk assessment reports, mitigating risks, and ensuring ongoing evaluation and assessment of IT-related risks. Senior management commitment, user community awareness and cooperation, and evaluation of risks are keys to success for a risk management program.
Minimization of Risks in Construction projectsIRJET Journal
This document discusses risk management in construction projects. It begins by defining risk and explaining the importance of risk management in development projects. It then reviews the results of a survey on risks affecting construction projects in India. The top three risks identified were financial issues, site accidents, and inadequate planning. The study found that contractors are typically responsible for risks occurring during project execution, like issues with subcontractors or quality, while clients are responsible for risks like financial issues or changes to specifications. The best preventative risk management strategies identified were thorough planning using past project data and experience. The best corrective strategies once risks occur were close monitoring and coordination of activities. The document concludes that thorough planning and strong coordination during implementation are key to better managing projects
This document is a guide for the detailed development, selection implementation of information system and program level procedures to indicate the execution, effectiveness, and impact of security controls along with and other security associated activities.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to FEMARisk Management SeriesRisk AssessmentA How-To Gu.docx
2016 Resilience Survey for Real Estate and Critical Infrastructure ProjectsJulian R
Control Risks has conducted this survey with a view to better understanding the perception and approach taken to
security and resilience by those who deal with real estate and critical infrastructure. We surveyed more than 100
architects, developers, investors, end-users and engineers.
Homeland Security Building RecommendationsChuck Thompson
http://www.gloucestercounty-va.com This is the building security recommendations for schools from Homeland Security. 317 pages up to date and complete. Is your school safe?
Running Head CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUS.docxhealdkathaleen
Running Head: CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUSTRY TO ELIMINATE SECURITY RISKS 2
CURRENT TECHNIQUES IMPLEMENTED IN CONSTRUCTION INDUSTRY TO ELIMINATE SECURITY RISKS 2
Current Techniques Implemented in the Construction Industry to Eliminate Security Risks
Group 4
Balaram Chekuri
Laxmi Sravani Vallurpallis
Mohan Kadali
Shivasai Pabba
Vaagdevi Jali
University of the Cumberlands
ITS835-41 Enterprise Risk Management
Residency Assignment Research Paper
Professor Dr. James C. Hyatt
10/20/2019
Statement of the Problem and it is Setting
Risk management has been one of the breakthroughs for the modern world, and at the same one of the intellectual achievements is the identification, transformation, or risk and going from a world that described risk as fate to a world that looks at risk as an area of study. Risk management is the utilization of risk analysis to come up with management strategies used to reduce risk. Whereby generally in project management there are the two techniques categories qualitative; that involves impact and probability assessment, expected value calculations and influence diagrams and quantitative; that typically focuses on the overall risk which is managed more with numerical approach, and has techniques such as decision trees, Monte Carlo analysis and sensitivity analysis (McNeil et al. 2015). In various fields, there is enormous risk faced, and at the same time, there is a corresponding quantitative technique that can be used to address the risk. The focus is on the quantitative risk management techniques; they are based on scientific, mathematical and statistical background, that promise to give thorough and detailed management and quantification of risk that is imperative for designing the response (Teixeira et al. 2015).
This paper, based on the construction industry, provides an overview of the analytic overview of different quantitative risk analysis techniques. There is a focus on building on the existing quantitative techniques that are best for the construction industry around the world when it comes to utilizing relevant techniques after a qualitative risk analysis. In addition to this, there is looking further into the techniques and their details.
Guiding Questions
· Does Your Risk Management Process Address Root Cause of Failure?
· Are there gaps in this field?
· What Does Your Business Performance Tell You About Risk?
· What Do Controls Tell You About Your Risks?
· The main focus is looking at the practitioners and researchers looking: at the reason why they should simplify the existing techniques?
· Which, at the same looks at the research gaps in this field and propose areas of further research for project risk management in construction, which will improve the existing techniques.
Assumptions
Project Risk manage ...
M.I.P. Security is a leading security consulting firm that offers strategic security assessments, physical security projects, risk assessment and mitigation, and security training. They have extensive experience working with governments and major corporations around the world. Their team of experts can analyze threats, identify vulnerabilities, and design cost-effective security solutions to meet any organization's protection needs.
Risk management plan
Executive Summary
The past few decades have seen technological evolutions on a rapid scale with the growth of the industry taking over the world by storm. Governments and companies alike are investing in further research and development of futuristic technologies in order to work towards a more efficient future in terms of productivity and task automation. The evolution of computers and powerful technologies being made available to the public with them having high processing power and some being small, powerful and portable has led to people having information in their hands, literally.
However, with the advantages of the recently introduced technologies, there still are threats brought about by the same since they have raised privacy and other security concerns as well as health concerns associated with a number of the devices. This paper is aimed at identification of strategies to handle risks which may arise from the continuous development of new technologies (Galati, 2015). Comment by Schneider, Paul: This is the only sentence in this summary which focuses on the paper, and it does a very poor job of previewing everything that the reader will see in this paper.
Project Summary
Scope Comment by Schneider, Paul: This section tells me nothing about the scope for your project. What are the task/activities needed to successfully complete your project?
This report is important in analysis of the importance of information technologies being managed and security implemented since with their introduction, most companies have taken them up therefore the need to prevent attacks via technologies implemented. Critical processes in business are reliant to information technologies therefore need for safeguarding them against hacking attacks among other similar threats relating to information technologies.
Milestones Comment by Schneider, Paul: This section tells me nothing about the milestones for your project. When does the project start? When does the project end? What are all of the milestones between the start & end?
All businesses especially in a technologically growing and depend world need to learn the vulnerabilities posed by the developments as well as methods which can be used to control or curb them. Most companies have successfully put in place firewalls and administrators of networks to monitor, analyze and notify of irregularities which may cause a breach to sensitive company information.
Cost Constraints Comment by Schneider, Paul: Very poor job.
In implementation of security within information technologies, there are costs involved, some being one off and others being recurrent however all serving the same purpose. Costs inclusive in implementation of security protocols are such as purchase as hardware and software offering security such as firewalls, antiviruses, antimalware programs and programs for detection of network intrusions. Costs can also arise from contracting an external organization to ...
This document provides an overview of risk identification and assessment. It defines risk and risk management, and outlines the key steps in the risk management cycle including risk identification, assessment, and analysis. Methods of risk assessment are also discussed, including qualitative, quantitative and hybrid approaches. National Institute of Standards and Technology (NIST) methodology is explained as one of the common risk assessment methodologies used. The responsibilities of different parties in conducting risk assessments are highlighted. A case study on risk assessment of a regulatory organization is presented to demonstrate the process.
This document presents chapter 13 from the book "Next Generation Disaster and Security Management". The chapter discusses how situation awareness is crucial for effective disaster management. It argues that new information technologies can help improve situation awareness by enabling the collection and sharing of real-time information from various sources. However, challenges remain in processing large amounts of data from diverse sources and ensuring the data's accuracy and usefulness for decision making. The chapter advocates for approaches to enhance situation awareness using new technologies while addressing issues around data quality and management.
Road Map to HIPAA Security Rules Compliance: Risk Analysis at Orbit ClinicsIOSR Journals
The organization, which will be used in this risk assessment report, is a healthcare provider and concealed name “Orbit Clinic” is to protect confidentiality and anonymity of the real clinic’s name. This assessment will look at the clinic IT systems only from HIPAA Security Rules point of view. This clinic has chosen because there are various threats and vulnerabilities, which are faced by these kinds of organizations especially regarding the electronic Personal Health Information (e-PHI). They also have sensitive financial data that need to be secured due to the possible threats and vulnerabilities facing them. The analysis approaches that have used are interviews, survey, automated tools like Zenmap and Nessus. In addition, Methodologies such as quantitative, qualitative and Practical Threat Analysis (PTA) were used to conduct the risk analysis. As a result, to this risk assessment, quite a number of vulnerabilities were observed. Furthermore, the project provided countermeasure to all observed vulnerabilities as well as the most cost effective plan to mitigate the risks.
IRJET- Projects in Constructions due to Inadequate Risk ManagementIRJET Journal
This document discusses risks in construction projects due to inadequate risk management. It begins by introducing the topic and defining key terms like risk management. It then discusses sources of failure in construction projects when there is no initial risk assessment or risk management. Some of the major causes of project failure discussed include changes without documentation or tracking, incomplete status reports, and undefined parameters.
The document presents results from a questionnaire survey given to construction industry experts. The survey found that most companies have a poor understanding of managing troubled projects and not all project managers have the necessary skills. It then provides recommendations for recovering from failed projects, including conducting a review to identify lessons learned and causes of failure. Overall, the document advocates that systematic risk management can help construction projects
Efficacy of OCTAVE Risk Assessment Methodology in Information Systems Organiz...Editor IJCATR
With the increasing use of computers in business information security has also become a key issue in organizations. Risk assessment in organizations is vital in order to identify threats and take appropriate measures. There are various risk assessment methodologies exist which organizations use for risk assessment depending the type and need of organizations. In this research OCTAVE methodology has been used following a comparative study of various methodologies due to its flexibility and simplicity. The methodology was implemented in a financial institution and results of its efficacy have been discussed.
Risk Management Appraisal - A tool for successful Infrastructure projectIRJET Journal
This document discusses risk management for infrastructure projects. It identifies eight categories of risk for infrastructure projects: management risks, technical and construction risks, contractual and legal risks, resource and site-related risks, economic and finance risks, environmental risks, social and political risks, and safety and health risks. The key steps of risk management discussed are risk identification, risk analysis including likelihood and impact assessment, and risk mitigation techniques. Quantitative and qualitative methods are used for risk analysis. Managing risks is seen as essential for successfully achieving project goals of time, cost, quality and objectives.
This research work x-rays the indispensability of continuous
risk assessment on data and communication devices, to ensure
that full business uptime is assured and to minimize, if not
completely eradicate downtime caused by “unwanted elements
of the society” ranging from hackers, invaders, network
attackers to cyber terrorists. Considering high-cost of
downtime and its huge business negative impact, it becomes
extremely necessary and critical to proactively monitor,
protect and defend your business and organization by ensuring
prompt and regular Risk assessment of the data and
communication devices which forms the digital walls of the
organization. The work also briefly highlights the
methodologies used, methodically discusses core risk
assessment processes, common existing network architecture
and its main vulnerabilities, proposed network architecture
and its risk assessment integration(Proof), highlights the
strengths of the proposed architecture in the face of present
day business threats and opportunities and finally emphasizes
importance of consistent communication and consultation of
stakeholders and Original Equipment Manufacturers (OEMs)
The role of Risk Assessment and Risk Management is to continuously Identify, Analyze, Plan, Track, Control, and Communicate the risks associated with a project.
The Webster’s definition of risk is the possibility of suffering a loss. Risk in itself is not bad. Risk is essential to progress and failure is often a key part of learning. Managing risk is a key part of
success.
This document describes the foundations for conducting a risk assessment of a large-scale system
development project. Such a project will likely include the procurement of Commercial Off The
Shelf (COTS) products as well as their integration with legacy systems.
Niwot Ridge
The role of Risk Assessment and Risk Management is to continuously Identify, Analyze, Plan, Track, Control, and Communicate the risks associated with a project.
The Webster’s definition of risk is the possibility of suffering a loss. Risk in itself is not bad. Risk is essential to progress and failure is often a key part of learning. Managing risk is a key part of success.
This document describes the foundations for conducting a risk assessment of a large-scale system development project. Such a project will likely include the procurement of Commercial Off The Shelf (COTS) products as well as their integration with legacy systems.
This document discusses safety, risk assessment, and testing for engineering designs. It provides information on different definitions of safety and risk, factors that influence risk acceptability, and challenges in assessing risk and safety due to uncertainties and lack of information. The document emphasizes that thorough testing of prototypes and finished products is essential to determine safety and ensure risks are minimized.
This document discusses risk management for information technology systems using the spiral model. It provides an overview of the risk management process, which involves identifying risks, assessing risks, and taking steps to reduce risks to an acceptable level. The risk management process should be integrated into the system development life cycle. Key aspects of the risk management process discussed include identifying and assessing risks, developing risk assessment reports, mitigating risks, and ensuring ongoing evaluation and assessment of IT-related risks. Senior management commitment, user community awareness and cooperation, and evaluation of risks are keys to success for a risk management program.
Minimization of Risks in Construction projectsIRJET Journal
This document discusses risk management in construction projects. It begins by defining risk and explaining the importance of risk management in development projects. It then reviews the results of a survey on risks affecting construction projects in India. The top three risks identified were financial issues, site accidents, and inadequate planning. The study found that contractors are typically responsible for risks occurring during project execution, like issues with subcontractors or quality, while clients are responsible for risks like financial issues or changes to specifications. The best preventative risk management strategies identified were thorough planning using past project data and experience. The best corrective strategies once risks occur were close monitoring and coordination of activities. The document concludes that thorough planning and strong coordination during implementation are key to better managing projects
This document is a guide for the detailed development, selection implementation of information system and program level procedures to indicate the execution, effectiveness, and impact of security controls along with and other security associated activities.
Similar to FEMARisk Management SeriesRisk AssessmentA How-To Gu.docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Philippine Edukasyong Pantahanan at Pangkabuhayan (EPP) CurriculumMJDuyan
(𝐓𝐋𝐄 𝟏𝟎𝟎) (𝐋𝐞𝐬𝐬𝐨𝐧 𝟏)-𝐏𝐫𝐞𝐥𝐢𝐦𝐬
𝐃𝐢𝐬𝐜𝐮𝐬𝐬 𝐭𝐡𝐞 𝐄𝐏𝐏 𝐂𝐮𝐫𝐫𝐢𝐜𝐮𝐥𝐮𝐦 𝐢𝐧 𝐭𝐡𝐞 𝐏𝐡𝐢𝐥𝐢𝐩𝐩𝐢𝐧𝐞𝐬:
- Understand the goals and objectives of the Edukasyong Pantahanan at Pangkabuhayan (EPP) curriculum, recognizing its importance in fostering practical life skills and values among students. Students will also be able to identify the key components and subjects covered, such as agriculture, home economics, industrial arts, and information and communication technology.
𝐄𝐱𝐩𝐥𝐚𝐢𝐧 𝐭𝐡𝐞 𝐍𝐚𝐭𝐮𝐫𝐞 𝐚𝐧𝐝 𝐒𝐜𝐨𝐩𝐞 𝐨𝐟 𝐚𝐧 𝐄𝐧𝐭𝐫𝐞𝐩𝐫𝐞𝐧𝐞𝐮𝐫:
-Define entrepreneurship, distinguishing it from general business activities by emphasizing its focus on innovation, risk-taking, and value creation. Students will describe the characteristics and traits of successful entrepreneurs, including their roles and responsibilities, and discuss the broader economic and social impacts of entrepreneurial activities on both local and global scales.
How to Manage Reception Report in Odoo 17Celine George
A business may deal with both sales and purchases occasionally. They buy things from vendors and then sell them to their customers. Such dealings can be confusing at times. Because multiple clients may inquire about the same product at the same time, after purchasing those products, customers must be assigned to them. Odoo has a tool called Reception Report that can be used to complete this assignment. By enabling this, a reception report comes automatically after confirming a receipt, from which we can assign products to orders.
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
Temple of Asclepius in Thrace. Excavation resultsKrassimira Luka
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
How to Download & Install Module From the Odoo App Store in Odoo 17Celine George
Custom modules offer the flexibility to extend Odoo's capabilities, address unique requirements, and optimize workflows to align seamlessly with your organization's processes. By leveraging custom modules, businesses can unlock greater efficiency, productivity, and innovation, empowering them to stay competitive in today's dynamic market landscape. In this tutorial, we'll guide you step by step on how to easily download and install modules from the Odoo App Store.
THE SACRIFICE HOW PRO-PALESTINE PROTESTS STUDENTS ARE SACRIFICING TO CHANGE T...indexPub
The recent surge in pro-Palestine student activism has prompted significant responses from universities, ranging from negotiations and divestment commitments to increased transparency about investments in companies supporting the war on Gaza. This activism has led to the cessation of student encampments but also highlighted the substantial sacrifices made by students, including academic disruptions and personal risks. The primary drivers of these protests are poor university administration, lack of transparency, and inadequate communication between officials and students. This study examines the profound emotional, psychological, and professional impacts on students engaged in pro-Palestine protests, focusing on Generation Z's (Gen-Z) activism dynamics. This paper explores the significant sacrifices made by these students and even the professors supporting the pro-Palestine movement, with a focus on recent global movements. Through an in-depth analysis of printed and electronic media, the study examines the impacts of these sacrifices on the academic and personal lives of those involved. The paper highlights examples from various universities, demonstrating student activism's long-term and short-term effects, including disciplinary actions, social backlash, and career implications. The researchers also explore the broader implications of student sacrifices. The findings reveal that these sacrifices are driven by a profound commitment to justice and human rights, and are influenced by the increasing availability of information, peer interactions, and personal convictions. The study also discusses the broader implications of this activism, comparing it to historical precedents and assessing its potential to influence policy and public opinion. The emotional and psychological toll on student activists is significant, but their sense of purpose and community support mitigates some of these challenges. However, the researchers call for acknowledging the broader Impact of these sacrifices on the future global movement of FreePalestine.
CapTechTalks Webinar Slides June 2024 Donovan Wright.pptxCapitolTechU
Slides from a Capitol Technology University webinar held June 20, 2024. The webinar featured Dr. Donovan Wright, presenting on the Department of Defense Digital Transformation.
This presentation was provided by Rebecca Benner, Ph.D., of the American Society of Anesthesiologists, for the second session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session Two: 'Expanding Pathways to Publishing Careers,' was held June 13, 2024.
1. FEMA
Risk Management Series
Risk Assessment
A How-To Guide to Mitigate Potential Terrorist Attacks
Against Buildings
FEMA 452 / January 2005
U
.S
.
A
IR
F
O
R
C
E
RISK MANAGEMENT SERIES
Risk Assessment
2. A How-To Guide to Mitigate
Potential Terrorist Attacks
Against Buildings
PROVIDING PROTECTION TO PEOPLE AND BUILDINGS
FEMA 452 / January 2005
www.fema.gov
Any opinions, findings, conclusions, or recommendations
expressed in this publication do
not necessarily reflect the views of FEMA. Additionally, neither
FEMA or any of its employees
makes any warrantee, expressed or implied, or assumes any
legal liability or responsibility for
the accuracy, completeness, or usefulness of any information,
product, or process included in
this publication. Users of information from this publication
assume all liability arising from
such use.
FOREWORD AND ACKNOWLEDGMENTS
iFOREWORD AND ACKNOWLEDGMENTS
BACKGROUND
The Federal Emergency Management Agency (FEMA)
developed this Risk
Assessment, A How-To Guide to Mitigate Potential Terrorist
Attacks Against Build-
ings, to provide a clear, flexible, and comprehensive
3. methodology to prepare
a risk assessment. The intended audience includes the building
sciences com-
munity of architects and engineers working for private
institutions, building
owners/operators/managers, and State and local government
officials
working in the building sciences community.
OBJECTIVE AND SCOPE
The objective of this How-To Guide is to outline methods for
identifying the
critical assets and functions within buildings, determining the
threats to those
assets, and assessing the vulnerabilities associated with those
threats. Based on
those considerations, the methods presented in this How-To
Guide provide a
means to assess the risk to the assets and to make risk-based
decisions on how
to mitigate those risks. The scope of the methods includes
reducing physical
damage to structural and non-structural components of buildings
and related
infrastructure, and reducing resultant casualties during
conventional bomb
attacks, as well as chemical, biological, and radiological (CBR)
agents. This
document is written as a How-To Guide. It presents five steps
and multiple
tasks within each step that will lead you through a process for
conducting a
risk assessment and selecting mitigation options. It discusses
what information
is required to conduct a risk assessment, how and where to
4. obtain it, and how
to use it to calculate a risk score against each selected threat.
This is one of a series of publications that address security
issues in high-popu-
lation, private sector buildings. This document is a companion
to the Reference
Manual to Mitigate Potential Terrorist Attacks Against
Buildings (FEMA 426) and
the Building Design for Homeland Security Training Course
(FEMA E155).
This document also leverages information contained within the
Primer for De-
sign of Commercial Buildings to Mitigate Terrorist Attacks
(FEMA 427).
The primary use of this risk assessment methodology is for
buildings, al-
though it could be adapted for other types of critical
infrastructure.
The foundation of the risk assessment methodology presented in
this docu-
ment is based on the approach that was developed for the
Department of
Veterans Affairs (VA) through the National Institute for
Building Sciences
ii FOREWORD AND ACKNOWLEDGMENTS
(NIBS). Over 150 buildings have been successfully assessed
using this tech-
nique. The risk assessment methodology presented in this
publication has
5. been refined by FEMA for this audience.
The purpose of this How-To Guide is to provide a methodology
for risk assess-
ment to the building sciences community working for private
institutions. It
is up to the decision-makers to decide which types of threats
they wish to pro-
tect against and which mitigation options are feasible and cost-
effective.
This How-To Guide views as critical that a team created to
assess a particular
building will be composed of professionals capable of
evaluating different
parts of the building. They should be senior individuals who
have a breadth
and depth of experience in the areas of civil, electrical, and
mechanical
engineering; architecture; site planning and security
engineering; and how
security and antiterrorism considerations affect site and
building design.
The information contained in this document is:
❍ not mandatory
❍ not applicable to all buildings
❍ not applicable when it interferes with other hazards such as
fire
ORGANIZATION AND CONTENT
In order to create a safe environment, many factors must be
considered.
Figure 1 depicts the risk assessment process presented in this
6. document to
help identify the best and most cost-effective terrorism
mitigation measures
for a building’s own unique security needs. The first step is to
conduct a
threat assessment wherein the threat or hazard is identified,
defined, and
quantified (Step 1). For terrorism, the threat is the aggressors
(people or
groups) that are known to exist and that have the capability and
a history of
using hostile actions, or that have expressed intentions for using
hostile ac-
tions against potential targets as well as on whom there is
current credible
information on targeting activity (surveillance of potential
targets) or indica-
tions of preparation for terrorist acts. The capabilities and
histories of the
aggressors include the tactics they have used to achieve their
ends. The next
step of the assessment process is to identify the value of a
building’s assets that
need to be protected (Step 2).
After conducting a asset value assessment, the next step is to
conduct a vulner-
ability assessment (Step 3). A vulnerability assessment
evaluates the potential
vulnerability of the critical assets against a broad range of
identified threats/
hazards. In and of itself, the vulnerability assessment provides a
basis for
7. iiiFOREWORD AND ACKNOWLEDGMENTS
determining mitigation measures for protection of the critical
assets. The vul-
nerability assessment is the bridge in the methodology between
threat/hazard,
asset value, and the resultant level of risk.
The next step of the process is the risk assessment (Step 4). The
risk assess-
ment analyzes the threat, asset value, and vulnerability to
ascertain the level
of risk for each critical asset against each applicable threat.
Inherent in this
is the likelihood or probability of the threat occurring and the
consequences
of the occurrence. Thus, a very high likelihood of occurrence
with very small
consequences may require simple low cost mitigation measures,
but a very low
likelihood of occurrence with very grave consequences may
require more costly
and complex mitigation measures. The risk assessment should
provide a relative
risk profile. High-risk combinations of assets against associated
threats, with the
identified vulnerability, allow prioritization of resources to
implement mitigation
measures.
The final step (Step 5) is to consider mitigation options that are
directly asso-
ciated with, and responsive to, the major risks identified during
Step 4. From
Step 5, decisions can be made as to where to minimize the risks
and how to
8. accomplish that over time. This is commonly referred to as Risk
Management.
A number of worksheets are utilized in this How-To Guide.
They can be used
to apply key concepts described in this document and are
presented at the
end of each Step.
A core element of this How-To Guide is the Building
Vulnerability Assess-
ment Checklist included in Appendix A. The Checklist can be
used to collect
Asset Value
Assessment
(Step 2)
Vulnerability
Assessment
(Step 3)
Consider
Mitigation Options
(Step 5)
Decision
(Risk Management)Risk Assessment
(Step 4)
Threat
Identification
9. and Rating
(Step 1)
Figure 1 Risk assessment process model
iv FOREWORD AND ACKNOWLEDGMENTS
and report information related to the building infrastructure. It
compiles
many best practices based on technologies and scientific
research to consider
during the design of a new building or renovation of an existing
building. It
allows a consistent security evaluation of designs at various
levels.
A Risk Assessment Database accompanies this publication in
the form of
computer software. The purpose of this database is for a user to
collect and
organize risk scoring, building vulnerability data, and
mitigation measures for
multiple buildings. More information can be found on
throughout this publi-
cation and in Appendix B.
The Building Vulnerability Assessment Checklist and the Risk
Assessment
Database were developed with assistance from the Department
of Veterans Af-
fairs and the National Institute for Building Sciences.
ACKNOWLEDGMENTS
10. Principal Authors:
Milagros Kennett, FEMA, Project Officer, Risk Management
Series
Publications
Eric Letvin, URS, Consultant Project Manager
Michael Chipley, PBSJ
Terrance Ryan, UTD, Inc.
Contributors:
Lloyd Siegel, Department of Veterans Affairs
Marcelle Habibion, Department of Veterans Affairs
Kurt Knight, Department of Veterans Affairs
Eve Hinman, Hinman Consulting Engineering
Sarah Steerman, UTD, Inc.
Deb Daly, Greenhorne & O’Mara, Inc.
Julie Liptak, Greenhorne & O’Mara, Inc.
Wanda Rizer, Consultant
Project Advisory Panel:
Elizabeth Miller, National Capital Planning Commission
Doug Hall, Smithsonian Institution
11. Wade Belcher, General Service Administration
vFOREWORD AND ACKNOWLEDGMENTS
Michael Gressel, CDC/NIOSH
Kenneth Mead, CDC/NIOSH
Robert Chapman, NIST
Lawrence Skelly, Department of Homeland Security
Curt Betts, U.S. Army Corps of Engineers
Earle Kennett, National Institute for Building Sciences
Frederick Krimgold, Virginia Tech
David Hattis, Building Technology, Inc.
Ettore Contestabile, Canadian Explosives Research Laboratory
This How-To Guide was prepared under contract to FEMA. It
will be revised
periodically, and comments and feedback to improve future
editions are
welcome. Please send comments and feedback by e-mail to
riskmanagements
[email protected]
mailto:[email protected]
mailto:[email protected]
12. TABLE OF CONTENTS
viiTABLE OF CONTENTS
Foreword and Acknowledgments
.....................................................................i
Step 1: Threat Identification and Rating
.................................................... 1-1
Task 1.1 Identifying the Threats ...................................... 1-1
Task 1.2 Collecting Information .................................... 1-16
Task 1.3 Determining the Design Basis Threat ............. 1-18
Task 1.4 Determining the Threat Rating ...................... 1-24
Step 2: Asset Value Assessment
.............................................................. 2-1
Task 2.1 Identifying the Layers of Defense ..................... 2-2
Task 2.2 Identifying the Critical Assets ............................ 2-6
Task 2.3 Identifying the Building Core Functions and
Infrastructure ................................................................... 2 -
11
Task 2.4 Determining the Asset Value Rating ............... 2-22
Step 3: Vulnerability Assessment
................................................................ 3-1
13. Task 3.1 Organizing Resources to Prepare the
Assessment ..........................................................................
3-2
Task 3.2 Evaluating the Site and Building ....................... 3-6
Task 3.3 Preparing a Vulnerability Portfolio ................. 3-11
Task 3.4 Determining the Vulnerability Rating ............ 3-13
Step 4: Risk Assessment
............................................................................ 4 -1
Task 4.1 Preparing the Risk Assessment Matrices ........... 4-2
Task 4.2 Determining the Risk Ratings ........................... 4-7
Task 4.3 Prioritizing Observations in the Building Vulner-
ability Assessment Checklist ........................................... 4-
10
viii TABLE OF CONTENTS
Step 5: Consider Mitigation Options
............................................................ 5-1
Task 5.1 Identifying Preliminary Mitigation Options ..... 5-2
Task 5.2 Reviewing Mitigation Options ........................... 5-6
Task 5.3 Estimating Cost ................................................... 5 -
9
14. Task 5.4 Mitigation, Cost, and the Layers of Defense .. 5-13
Appendix A Building Vulnerability Assessment Checklist
Appendix B1 Risk Management Database: Assessor's User
Guide
Appendix B2 Risk Management Database: Database
Administrator's User
Guide
Appendix B3 Risk Management Database: Manager's User
Guide
Appendix C Acronyms and Abbreviations
Figures
Foreword and Acknowledgments
Figure 1 Risk assessment process model ........................... iii
Chapter 1
Figure 1-1 Steps and tasks ................................................. 1-
1
Figure 1-2 Total international attacks by region, 1998-
2003 .....................................................................................
1-3
Figure 1-3 Explosive environments - blast range to
effect ...................................................................................
1-4
Figure 1-4 Explosive evacuation distance ........................ 1-5
15. Figure 1-5 Incident overpressure as a function of stand-off
distance ...............................................................................
1-6
Figure 1-6 Total facilities affected by international ter-
rorism and weapons of choice, 1998-2003 ..................... 1-16
ixTABLE OF CONTENTS
Chapter 2
Figure 2-1 Steps and tasks ................................................. 2-
1
Figure 2-2 Layers of defense ............................................. 2-
3
Figure 2-3 Layers of defense in urban setting ................. 2-5
Figure 2-4 Layers of defense when a particular building is
considered a critical asset .................................................. 2 -5
Figure 2-5 Potential blast effects – 200-lb car bomb ....... 2-7
Figure 2-6 Potential blast effects – 11,000-lb truck
bomb ...................................................................................
2-7
Figure 2-7 Using HAZUS-MH to identify the criticality of
assets ...................................................................................
2-8
Chapter 3
16. Figure 3-1 Steps and tasks ................................................. 3-
1
Figure 3-2 Common system vulnerabilities ................... 3-14
Chapter 4
Figure 4-1 Steps and tasks ................................................. 4-
1
Chapter 5
Figure 5-1 Steps and tasks ................................................. 5-
2
Figure 5-2 Cost considerations ....................................... 5-10
Figure 5-3 Mitigation options for the second layer of de-
fense .................................................................................. 5 -
14
Figure 5-4 Mitigation options for the third layer of de-
fense .................................................................................. 5-
15
Tables
Chapter 1
Table 1-1 Critical Biological Agent Categories ............. 1-11
Table 1-2 Event Profiles .................................................. 1-
13
17. x TABLE OF CONTENTS
Table 1-3 Criteria to Select Primary Threats ................. 1-21
Table 1-4 Nominal Example to Select Primary Threats for
a Specific Urban Multi-story Building ............................ 1-22
Table 1-5 Threat Rating .................................................. 1-25
Table 1-6A Nominal Example of Threat Rating for an
Urban Multi-story Building (Building Function) .......... 1-26
Table 1-6B Nominal Example of Threat Rating for an
Urban Multi-story Building (Building Infrastructure) . 1-26
Chapter 2
Table 2-1 Correlation of the Layers of Defense Against
Threats .............................................................................. 2 -
12
Table 2-2 Building Core Functions ................................ 2-18
Table 2-3 Building Core Infrastructure ......................... 2-19
Table 2-4 Levels of Protection and Recommended Secu-
rity Measures .................................................................... 2 -
21
Table 2-5 Asset Value Scale ............................................. 2-
23
Table 2-6A Nominal Example of Asset Value Rating for an
Urban Multi-story Building (Building Function) .......... 2-23
18. Table 2-6B Nominal Example of Asset Value Rating for an
Urban Multi-story Building (Building Infrastructure) . 2-24
Chapter 3
Table 3-1 Screening Phase ................................................ 3-4
Table 3-2 Full On-site Evaluation ..................................... 3-5
Table 3-3 Detailed Evaluation .......................................... 3-5
Table 3-4 Vulnerability Rating ........................................ 3-15
Table 3-5A Nominal Example of Vulnerability Rating for a
Specific Multi-story Building (Building Function) ........ 3-16
Table 3-5B Nominal Example of Vulnerability Rating for a
Specific Multi-story Building (Building Infrastructure) 3-16
xiTABLE OF CONTENTS
Chapter 4
Table 4-1 Critical Functions Asset Value ......................... 4-4
Table 4-2 Critical Infrastructure Asset Value ................... 4-4
Table 4-3 Critical Functions Threat Rating ..................... 4-5
Table 4-4 Critical Infrastructure Threat Rating .............. 4-5
Table 4-5 Critical Functions Vulnerability Rating ........... 4-6
Table 4-6 Critical Infrastructure Vulnerability Rating .... 4-7
19. Table 4-7 Total Risk Scale Color Code ............................ 4-8
Table 4-8 Site Functional Pre-Assessment Screening Ma-
trix .....................................................................................
4-8
Table 4-9 Site Infrastructure Pre-Assessment Screening
Matrix .................................................................................
4-9
Table 4-10 Nominal Example of Observations in the
Building Vulnerability Assessment Checklist ................. 4-10
1-1STEP 1: THREAT IDENTIFICATION AND RATING
STEP 1: THREAT IDENTIFICATION AND RATING
OVERVIEW
The first step in the assessment process is to help you to
identify threats that
are a priority concern in your area and that may pose a risk to
your assets
(see Figure 1-1). The threat identification and rating process
involves the fol-
lowing tasks:
❍ Identifying the threats
❍ Collecting information
20. ❍ Determining the design basis threat
❍ Determining the threat rating
TASKS:
1.1 Identifying the threats
1.2 Collecting information
1.3 Determining the design basis
threat
1.4 Determining the threat rating
Step 1: Threat Identification and Rating
Step 4: Risk Assessment
Step 2: Asset Value Assessment
Step 3: Vulnerability Assessment
Figure 1-1 Steps and tasks
Identifying the Threats (Task 1.1)
For this document, threat is defined as any indication,
circumstance, or event
with the potential to cause loss of, or damage to an asset.
Within the military
services, the intelligence community, and law enforcement, the
term “threat”
is typically used to describe the design criteria for terrorism or
manmade di-
sasters. The Federal Emergency Management Agency (FEMA)
21. and other civil
Step 5: Consider Mitigation Options
1-2 STEP 1: THREAT IDENTIFICATION AND RATING
agencies use the term “hazard” in several different contexts.
“Natural hazard”
typically refers to a natural event such as a flood, wind, or
seismic disaster.
“Human-caused (or manmade) hazards” are “technological
hazards” and “ter-
rorism” and are distinct from natural hazards primarily in that
they originate
from human activity. “Technological hazards” (i.e., a HazMat
leak from a
railcar) are generally assumed to be accidental and that their
consequences
are unintended. (Note that protection against technological
hazards can also
serve for the protection against terrorist attacks.) “Terrorism” is
considered
an unlawful act of force and violence against persons or
property to intimi-
date or coerce a government, the civilian population, or any
segment thereof,
in furtherance of political or social objectives.
In this guide, only manmade terrorist threats will be used in the
critical func-
tions and infrastructure matrices. The importance of
technological hazards is
that they can become a threat if they are targets of malicious
attacks.
22. Identifying the threats can be a difficult task. Because manmade
hazards are
different from other hazards such as earthquakes, floods, and
hurricanes,
they are difficult to predict. Many years of historical and
quantitative data,
and probabilities associated with the cycle, duration, and
magnitude of
natural hazards exist. The fact that data for manmade hazards
are scarce and
that the magnitude and recurrence of terrorist attacks are almost
unpredict-
able makes the determination of a particular threat for any
particular site or
building difficult and largely subjective.
With any terrorist threats, it is important to understand who the
people are
with the intent to cause harm. The aggressors seek publicity for
their cause,
monetary gain (in some instances), or political gain through
their actions.
These actions include injuring or killing people; destroying or
damaging fa-
cilities, property, equipment, or resources; or stealing
equipment, material,
or information. In some cases, the threat may originate from
more than one
group, with differing methods and motives.
Aggressor tactics run the gamut: moving vehicle bombs;
stationary vehicle
bombs; bombs delivered by persons (suicide bombers); exterior
attacks
(thrown objects like rocks, Molotov cocktails, hand grenades, or
23. hand-placed
bombs); attack weapons (rocket propelled grenades, light
antitank weapons,
etc.); ballistic attacks (small arms handled by one individual);
covert entries
(gaining entry by false credentials or circumventing security
with or without
weapons); mail bombs (delivered to individuals); supply bombs
(larger
bombs processed through shipping departments); airborne
contamination
(chemical, biological, or radiological [CBR] agents used to
contaminate the
1-3STEP 1: THREAT IDENTIFICATION AND RATING
air supply of a building); and waterborne contamination (CBR
agents in-
jected into the water supply).
Domestic terrorism refers to activities that involve acts
dangerous to human
life that are a violation of the criminal laws of the United States
or of any
state; appear to be intended to intimidate or coerce a civilian
population;
to influence the policy of a government by mass destruction,
assassination,
or kidnapping; and occur primarily within the territorial
jurisdiction of the
United States.
International terrorism involves violent acts or acts dangerous
to human life
24. that are a violation of the criminal laws of the United States or
any state, or
that would be a criminal violation if committed within the
jurisdiction of the
United States or any state. These acts appear to be intended to
intimidate
or coerce a civilian population; influence the policy of a
government by
intimidation or coercion; affect the conduct of a government by
mass
destruction, assassination or kidnapping; and occur primarily
outside the
territorial jurisdiction of the United States or transcend national
boundaries
in terms of the means by which they are accomplished, the
persons they
appear intended to intimidate or coerce, or the locale in which
their
perpetrators operate or seek asylum. Totals for international
terrorism in
1998-2003 are shown by regions in Figure 1-2.
Figure 1-2 Total international attacks by
region, 1998-2003
1998
1999
2000
2001
2002
2003
OtherMilitaryGovernmentDiplomatBusiness
3
8
32. e
p
a
rt
m
e
n
t
o
f
S
ta
t e
8
7
2
1-4 STEP 1: THREAT IDENTIFICATION AND RATING
Explosive Blast Weapons
Two parameters are used to define the explosive blast design
threat: the
weapon size, measured in equivalent pounds of trinitrotoluene
(TNT), and
the stand-off. The stand-off is the distance measured from the
center of
gravity of the charge to the component of interest.
33. Figures 1-3 through 1-5 illustrate these principles. Figure 1-3
shows an ex-
ample of a blast range-to-effect chart that indicates the distance
or stand-off
to which a given size bomb will produce a given effect. Figure
1-4 is a quick
reference chart that provides recommended evacuation distances
for a given
explosive weight. Figure 1-5 provides a quick method for
predicting the
expected overpressure (expressed in pounds per square inch or
psi) on a
building for a specific explosive weight and stand-off distance.
For additional
information on overpressure and blast effects, see FEMA 426
and 427.
Figure 1-3 Explosive environments - blast range to effect
1-5STEP 1: THREAT IDENTIFICATION AND RATING
Explosive Blast Weapons
Two parameters are used to define the explosive blast design
threat: the
weapon size, measured in equivalent pounds of trinitrotoluene
(TNT), and
the stand-off. The stand-off is the distance measured from the
center of
gravity of the charge to the component of interest.
Figures 1-3 through 1-5 illustrate these principles. Figure 1-3
shows an ex-
34. ample of a blast range-to-effect chart that indicates the distance
or stand-off
to which a given size bomb will produce a given effect. Figure
1-4 is a quick
reference chart that provides recommended evacuation distances
for a given
explosive weight. Figure 1-5 provides a quick method for
predicting the
expected overpressure (expressed in pounds per square inch or
psi) on a
building for a specific explosive weight and stand-off distance.
For additional
information on overpressure and blast effects, see FEMA 426
and 427.
Figure 1-3 Explosive environments - blast range to effect
Hi
gh
E
xp
lo
siv
es
(T
NT
E
qu
iv
al
35. en
t)
Threat Description Explosive Mass1
(TNT Equivalent)
Building Evacuation
Distance2
Outdoor Evacuation
Distance3
Pipe Bomb 5 lbs
2.3 kg
70 ft
21 m
850 ft
259 m
Suicide Belt 10 lbs
4.5 kg
90 ft
27 m
1,080 ft
330 m
36. Suicide Vest 20 lbs
9 kg
110 ft
34 m
1,360 ft
415 m
Briefcase/Suitcase Bomb 50 lbs
23 kg
150 ft
46 m
1,850 ft
564 m
Compact Sedan 500 lbs
227 kg
320 ft
98 m
1,500 ft
457 m
37. Sedan 1,000 lbs
454 kg
400 ft
122 m
1,750 ft
534 m
Passenger/Cargo Van 4,000 lbs
1,814 kg
640 ft
195 m
2,750 ft
838 m
Small Moving Van/Delivery
Truck
10,000 lbs
4,536 kg
860 ft
263 m
38. 3,750 ft
1,143 m
Moving Van/Water Truck 30,000 lbs
13,608 kg
1,240 ft
375 m
6,500 ft
1,982 m
Semitrailer 60,000 lbs
27,216 kg
1,570 ft
475 m
7,000 ft
2,134 m
Figure 1-4 Explosive evacuation distance
1Based on the maximum amount of material that could
reasonably fit into a container or vehicle. Variations are
possible.
2Governed by the ability of an unreinforced building to
withstand severe damage or collapse.
39. 3Governed by the greater of fragment throw distance or glass
breakage/falling glass hazard distance. These distances
can be reduced for personnel wearing ballistic protection. Note
that the pipe bomb, suicide belt/vest, and briefcase/
suitcase bomb are assumed to have a fragmentation
characteristic that requires greater stand-off distances than an
equal
amount of explosives in a vehicle.
1-6 STEP 1: THREAT IDENTIFICATION AND RATING
Figure 1-5 Incident overpressure as a function of stand-off
distance
To put the weapon size into perspective, it should be noted that
thousands of
deliberate explosions occur every year within the United States,
but the vast
majority of them have weapon yields of less than 5 pounds. The
number of
large-scale vehicle weapon attacks that have used hundreds of
pounds of TNT
during the past 20 years is, by comparison, very small. In
general, the largest
credible explosive size is a function of the security measures in
place. Each
line of security may be thought of as a sieve, reducing the size
of the weapon
that may gain access. Therefore, the largest weapons are
considered in totally
40. unsecured public spaces (e.g., in a vehicle on the nearest public
street), and
the smallest weapons are considered in the most secured areas
of the building
(e.g., in a briefcase smuggled past the screening station). It
should also be
noted that the likely target is often not the building under
consideration by
the risk assessment, but a high-risk building that is nearby.
Historically, more
building damage has been due to collateral effects than direct
attack. Based
upon access to the agent, the degree of difficulty, and past
experience, it can
be stated that the chance of a large-scale explosive attack
occurring is ex-
tremely low and that a smaller explosive attack is far more
likely.
From the standpoint of structural design, the vehicle bomb is
the most impor-
tant consideration and has been a favorite tactic of terrorists.
Ingredients for
homemade bombs are easily obtained on the open market, as are
the tech-
niques for making bombs.
1-7STEP 1: THREAT IDENTIFICATION AND RATING
Vehicle bombs are able to deliver a sufficiently large quantity
of explosives
to cause potentially devastating structural damage. Security
design intended
to limit or mitigate damage from a vehicle bomb assumes that
41. the bomb is
detonated at a so-called critical location. The critical location is
a function
of the site, the building layout, the security measures in place,
and the posi-
tion of the weapon. For a vehicle bomb, the critical location is
taken to be at
the closest point that a vehicle can approach, assuming that all
security mea-
sures are in place. This may be a parking area directly beneath
the occupied
building, the loading dock, the curb directly outside the facility,
or at a ve-
hicle-access control gate where inspection takes place,
depending on the level
of protection incorporated into the design.
Another explosive attack threat is the small bomb that is hand
delivered.
Small weapons can cause large damage when they are brought
into vulner-
able and unsecured areas of the building. Greater damage may
be caused
when the weapon is brought into the interior, such as the
building lobby, mail
room, and retail spaces. Recent events around the world make it
clear that
there is an increased likelihood that bombs will be delivered by
persons (sui-
cide bombers or hand carried bombs) who are willing to
sacrifice their own
lives. Hand-carried explosives are typically on the order of 5 to
10 pounds
of TNT equivalent. However, larger charge weights, in the 50-
to 100-pound
TNT equivalent range, can be readily carried in rolling cases.
42. Mail bombs are
typically less than 10 pounds of TNT equivalent.
Chemical, Biological, and Radiological Weapons
Three parameters are used to define the CBR design basis
threat: the ex-
posure, the duration, and the concentration. Each of the CBR
agents has
different human effects and methods of attack.
Chemical, biological, and radiological attacks are an emerging
threat and of
great concern because of the large geographic area
contaminated, numbers
of people affected, and the high economic cost of response and
recovery. The
use of CBR weapons and the stated intent of terrorist groups to
acquire and
For design purposes, large-scale truck bombs typically contain
10,000 pounds or more of TNT
equivalent, depending on the size and capacity of the vehicle
used to deliver the weapon. Vehicle
bombs that utilize vans down to small sedans typically contain
5,000 to 100 pounds of TNT
equivalent, respectively. A briefcase bomb is approximately 50
pounds, and a pipe bomb is
generally in the range of 5 pounds of TNT equivalent. Suicide
bombers can deliver belts ranging
from 10 pounds (teenagers), 15-20 pounds (women), and 30-40
pounds (men).
1-8 STEP 1: THREAT IDENTIFICATION AND RATING
43. use the weapons increases the target set, and the weapons can
affect a single
building, an entire city, multiple counties, or even states.
Like explosive threats, CBR threats may be delivered externally
or internally
to the building. External ground-based threats may be released
at a stand-off
distance from the building or may be delivered directly through
an air intake
or other opening. Interior threats may be delivered to accessible
areas such as
the lobby, mailroom, loading dock, or egress route. Because
there may not be
an official or obvious warning prior to a CBR event, the best
defense is to be
alert to signs of a release occurring.
Chemical. Chemical agents are compounds with unique
chemical properties
that can produce lethal or damaging effects in humans, animals,
and plants.
Chemical agents can exist as solids, liquids, or gases, depending
on tempera-
ture and pressure. Most chemical agents are liquid and can be
introduced
into an unprotected population relatively easily using aerosol
generators, ex-
plosive devices, breaking containers, or other forms of covert
dissemination.
Dispersed as an aerosol or vapor, chemical agents have their
greatest potential
for inflicting mass casualties. There are two categories of
chemicals: lethal
and incapacitating. The lethal chemicals are subdivided into
44. industrial and
warfare.
Industrial chemicals are used extensively throughout the nation
on a daily
basis. Lethal industrial chemicals are listed as Toxic Industrial
Compounds
(TICs). Of concern is the use of TICs as a weapon (e.g.,
derailment of a chlo-
rine tanker car), especially in the urban environment.
Chemical agents can have an immediate effect (a few seconds to
a few min-
utes) or a delayed effect (several hours to several days).
Although potentially
lethal, chemical agents are difficult to deliver in lethal
concentrations. Out-
doors, the agents often dissipate rapidly. Chemical agents are
also difficult to
produce. There are six types of agents:
❍ Choking/lung-damaging (pulmonary) agents such as chlorine
and
phosgene
❍ Blood agents such as cyanide
❍ Vesicants or blister agents such as mustard
1-9STEP 1: THREAT IDENTIFICATION AND RATING
❍ Nerve agents such as GA (tabun), GB (sarin), GD (soman),
GF
(cyclohexyl sarin), and VX (phosphonothioic acid)
45. ❍ Incapacitating agents such as BZ (3-quinulidinyle benzilate)
❍ Riot-control agents similar to Mace
Biological. Biological agents pose a serious threat because of
their accessible
nature and the rapid manner in which they spread. These agents
are dis-
seminated by the use of aerosols, contaminated food or water
supplies, direct
skin contact, or injection. Several biological agents can be
adapted for use
as weapons by terrorists. These agents include anthrax
(sometimes found in
sheep and cattle), tularemia (rabbit fever), cholera, the plague
(sometimes
found in prairie dog colonies), and botulism (found in
improperly canned
food). A biological incident will most likely be first recognized
in the hospital
emergency room, medical examiner’s office, or within the
public health com-
munity long after the terrorist attack. The consequences of such
an attack may
present communities with an unprecedented requirement to
provide mass
protective treatment to exposed populations, mass patient care,
mass fatality
management, and environmental health cleanup procedures and
plans.
Biological agents are organisms or toxins that can kill or
incapacitate people,
livestock, and crops. The three basic groups of biological agents
that would
46. likely be used as weapons are bacteria, viruses, and toxins.
1. Bacteria are small free-living organisms that reproduce by
simple
division and are easy to grow. The diseases they produce often
respond
to treatment with antibiotics.
2. Viruses are organisms that require living cells in which to
reproduce
and are intimately dependent upon the body they infect. Viruses
produce diseases that generally do not respond to antibiotics;
however,
antiviral drugs are sometimes effective.
3. Toxins are poisonous substances found in, and extracted
from, living
plants, animals, or microorganisms; some toxins can be
produced or
altered by chemical means. Some toxins can be treated with
specific
antitoxins and selected drugs.
Most biological agents are difficult to grow and maintain. Many
break down
quickly when exposed to sunlight and other environmental
factors, while
1-10 STEP 1: THREAT IDENTIFICATION AND RATING
others such as anthrax spores are very long lived. They can be
dispersed by
spraying them in the air, or by infecting animals or humans, as
well through
47. food and water contamination.
❍ Aerosols — Biological agents are dispersed into the air as an
aerosol that
may drift for miles. Inhaling the agent may cause disease in
people or
animals.
❍ Animals — Some diseases are spread by insects and animals,
such as fleas,
mice, flies, and mosquitoes. Deliberately spreading diseases
through
livestock is also referred to as agro-terrorism.
❍ Food and water contamination — Some pathogenic organisms
and toxins
may persist in food and water supplies. Most microbes can be
killed, and
toxins deactivated, by cooking food and boiling water.
Person-to-person spread of a few infectious agents is also
possible. Humans
have been the source of infection for smallpox, plague, and the
Lassa viruses.
In a 2002 report, Public Health Assessment of Biological
Terrorism Agents,
the Centers for Disease Control (CDC) has classified biological
agents as one
of three priority categories for initial public health preparedness
efforts: A, B,
or C (see Table 1-1). The CDC maintains a comprehensive list
of agents, dis-
eases, and other threats at www.bt.cdc.gov/agent/index.asp
Agents in Category A have the greatest potential for adverse
public health
48. impact with mass casualties, and most require broad-based
public health pre-
paredness efforts (e.g., improved surveillance and laboratory
diagnosis and
stockpiling of specific medications). Category A agents also
have a moderate
to high potential for large-scale dissemination or a heightened
general public
awareness that could cause mass public fear and civil
disruption.
Most Category B agents also have some potential for large-scale
dissemina-
tion with resultant illness, but generally cause less illness and
death, and,
therefore, would be expected to have lower medical and public
health im-
pacts. These agents also have lower general public awareness
than Category A
agents and require fewer special public health preparedness
efforts. Agents in
this category require some improvement in public health and
medical aware-
ness, surveillance, or laboratory diagnostic capabilities, but
present limited
additional requirements for stockpiled therapeutics beyond
those identified
for Category A agents. Biological agents that have undergone
some develop-
ment for widespread dissemination but do not otherwise meet
the criteria for
1-11STEP 1: THREAT IDENTIFICATION AND RATING
49. Category A, as well as several biological agents of concern for
food and water safety, are included
in this category.
Biological agents that are currently not believed to present a
high bioterrorism risk to public
health, but that could emerge as future threats (as scientific
understanding of these agents im-
proves) were placed in Category C.
Table 1-1: Critical Biological Agent Categories
Biological Agent(s) Disease
Category A
Variola major Smallpox
Bacillus anthracis Anthrax
Yersinia pestis Plague
Clostridium botulinum (botulinum toxins) Botulism
Francisella tulaensis Tularemia
Filoviruses and Arenaviruses (e.g., Ebola virus, Lassa virus)
Viral hemorrhagic fevers
Category B
Coxiella burnetii Q fever
Brucella spp. Brucellosis
Burkholderia mallei Glanders
50. Burkholderia pseudomallei Meliodosis
Alphaviruses Encephalitis
Rickettsia prowazekii Typhus fever
Toxins (e.g., Ricin) Toxic syndromes
Chlamydia psittaci Psittacosis
Food safety threats (e.g., Salmonella spp.)
Water safety threats (e.g., Vibrio cholerae)
Category C
Emerging threat agents (e.g., Nipah virus, hantavirus)
SOURCE: PUBLIC HEALTH ASSESSMENT OF POTENTIAL
BIOLOGICAL TERRORISM AGENTS (CDC, 2002)
Nuclear and Radiological. Nuclear threat is the use, threatened
use, or threatened detonation of
a nuclear bomb or device. At present, there is no known
instance in which any non-governmental
entity has been able to obtain or produce a nuclear weapon. The
most likely scenario is the deto-
nation of a large conventional explosive that incorporates
nuclear material or detonation of an
explosive proximate to nuclear materials in use, storage, or
transit. Of concern is the increasing
frequency of shipments of radiological materials throughout the
world.
Nuclear explosions can cause deadly effects: blinding light,
51. intense heat (thermal radiation), initial
nuclear radiation, blast, fires started by the heat pulse, and
secondary fires caused by the destruc-
1-12 STEP 1: THREAT IDENTIFICATION AND RATING
tion. They also produce radioactive particles called fallout that
can be carried
by wind for hundreds of miles.
Terrorist use of a radiological dispersion device (RDD) – often
called ”dirty
nuke” or “dirty bomb” – is considered far more likely than the
use of a nu-
clear device. These radiological weapons are a combination of
conventional
explosives and radioactive material designed to scatter
dangerous and sub-
lethal amounts of radioactive material over a general area. Such
radiological
weapons appeal to terrorists because they require very little
technical knowl-
edge to build and deploy compared to that of a nuclear device.
Also, these
radioactive materials, used widely in medicine, agriculture,
industry, and
research, are much more readily available and easy to obtain
compared to
weapons grade uranium or plutonium.
Terrorist use of a nuclear device would probably be limited to a
single smaller
“suitcase” weapon. The strength of such a nuclear weapon
would be in the
52. range of the bombs used during World War II. The nature of the
effects
would be the same as a weapon delivered by an inter-continental
missile, but
the area and severity of the effects would be significantly more
limited.
There is no way of knowing how much warning time there
would be before
an attack by a terrorist using a nuclear or radiological weapon.
A surprise at-
tack remains a possibility. The danger of a massive strategic
nuclear attack
on the United States involving many weapons receded with the
end of the
Cold War; however, some terrorists have been supported by
nations that have
nuclear weapons programs.
Other Threats. Other threats discussed in this manual include
armed attacks,
cyber attacks, high-altitude electromagnetic pulse, and high
power micro-
wave. These are discussed briefly in Table 1-2.
Table 1-2 provides selected threats that you may consider when
preparing
your risk assessment, some of which has not been discussed
previously in this
How-To Guide.
Table 1-2: Event Profiles
1-13STEP 1: THREAT IDENTIFICATION AND RATING
53. Threat Application Mode Duration Extent of Effects;
Static/Dynamic
Mitigating and Exacerbating
Conditions
Improvised Explosive
Device (Bomb)
- Stationary Vehicle
- Moving Vehicle
- Mail
- Supply
- Thrown
- Placed
- Suicide Bomber
Detonation of
explosive device on
or near target; via
person, vehicle, or
projectile.
Instantaneous;
additional
secondary devices
may be used,
lengthening the
duration of the
54. threat until the
attack site is
determined to be
clear.
Extent of damage
is determined by
type and quantity
of explosive. Effects
generally static
other than cascading
consequences,
incremental
structural failure,
etc.
Blast energy at a given stand-off
is inversely proportional to the
cube of the distance from the
device; thus, each additional
increment of stand-off provides
progressively more protection.
Exacerbating conditions include
ease of access to target; lack
of barriers/shielding; poor
construction; and ease of
concealment of device.
Armed Attack
- Ballistics (small
arms)
- Stand-off Weapons
(rocket propelled
grenades, mortars)
55. Tactical assault or
sniper attacks from
a remote location.
Generally minutes
to days.
Varies, based upon
the perpetrator’s
intent and
capabilities.
Inadequate security can allow
easy access to target, easy
concealment of weapons, and
undetected initiation of an attack.
Chemical Agent
- Blister
- Blood
- Choking/Lung/
Pulmonary
- Incapacitating
- Nerve
- Riot Control/Tear
Gas
- Vomiting
56. Liquid/aerosol
contaminants can
be dispersed using
sprayers or other
aerosol generators;
liquids vaporizing
from puddles/
containers; or
munitions.
Chemical agents
may pose viable
threats for hours to
weeks, depending
on the agent and
the conditions in
which it exists.
Contamination can
be carried out of
the initial target
area by persons,
vehicles, water, and
wind. Chemicals
may be corrosive or
otherwise damaging
over time if not
remediated.
Air temperature can affect
evaporation of aerosols. Ground
temperature affects evaporation
in pools of liquids. Humidity can
enlarge aerosol particles, reducing
the inhalation hazard. Precipitation
can dilute and disperse agents, but
57. can spread contamination. Wind
can disperse vapors, but also cause
target area to be dynamic. The
micro-meteorological effects of
buildings and terrain can alter travel
and duration of agents. Shielding in
the form of sheltering in place may
protect people and property from
harmful effects for a limited time.
1-14 STEP 1: THREAT IDENTIFICATION AND RATING
Threat Application Mode Duration Extent of Effects;
Static/Dynamic
Mitigating and Exacerbating
Conditions
Biological Agent
- Anthrax
- Botulism
- Brucellosis
- Plague
- Smallpox
- Tularemia
- Viral Hemorrhagic
Fevers
58. - Toxins (Botulinum,
Ricin, Staphylococ-
cal Enterotoxin B,
T-2 Mycotoxins)
Liquid or solid
contaminants can
be dispersed using
sprayers/aerosol
generators or by
point or line sources
such as munitions,
covert deposits, and
moving sprayers.
May be directed
at food or water
supplies.
Biological agents
may pose viable
threats for hours to
years, depending
on the agent and
the conditions in
which it exists.
Depending on the
agent used and the
effectiveness with
which it is deployed,
contamination can be
spread via wind and
water. Infection can
be spread via human
or animal vectors.
59. Altitude of release above
ground can affect dispersion;
sunlight is destructive to many
bacteria and viruses; light to
moderate winds will disperse
agents, but higher winds can
break up aerosol clouds; and
the micro-meteorological effects
of buildings and terrain can
influence aerosolization and
travel of agents.
Radiological Agent
- Alpha
- Beta
- Gamma
Radioactive
contaminants can
be dispersed using
sprayers/aerosol
generators, or by
point or line sources
such as munitions,
covert deposits, and
moving sprayers.
Contaminants may
remain hazardous
for seconds to
years, depending on
material used.
60. Initial effects will be
localized to site of
attack; depending
on meteorological
conditions,
subsequent behavior
of radioactive
contaminants may be
dynamic.
Duration of exposure, distance
from source of radiation, and
the amount of shielding between
source and target determine
exposure to radiation.
Cyber Attacks Electronic attack using
one computer system
against another.
Minutes to days. Generally no direct
effects on built
environment.
Inadequate security can facilitate
access to critical computer
systems, allowing them to be used
to conduct attacks.
High-Altitude
Electromagnetic Pulse
(HEMP)
An electromagnetic
energy field produced
61. in the atmosphere
by the power and
radiation of a nuclear
explosion. It can
overload computer
circuitry with effects
similar to, but causing
damage much
more swiftly than a
lightning strike.
It can be induced
hundreds to a few
thousand kilometers
from the detonation.
Affects electronic
systems. There is
no effect on people.
It diminishes with
distance, and
electronic equipment
that is turned off
is less likely to be
damaged.
To produce maximum effect,
a nuclear device must explode
very high in the atmosphere.
Electronic equipment may be
hardened by surrounding it with
protective metallic shielding that
routes damaging electromagnetic
fields away from highly sensitive
electrical components.
62. Table 1-2: Event Profiles (continued)
1-15STEP 1: THREAT IDENTIFICATION AND RATING
Threat Application Mode Duration Extent of Effects;
Static/Dynamic
Mitigating and Exacerbating
Conditions
High Power Microwave
(HPM) EMP
It is a non-nuclear
radio frequency
energy field. Radio
frequency weapons
can be hidden in
an attaché case,
suitcase, van, or
aircraft. Energy can
be focused using an
antenna, or emitter,
to produce effects
similar to HEMP, but
only within a very
limited range.
An HPM weapon has
a shorter possible
range than HEMP, but
it can induce currents
large enough to melt
circuitry, or it can
63. cause equipment to
fail minutes, days,
or even weeks
later. HPM weapons
are smaller-scale,
are delivered at a
closer range to the
intended target, and
can sometimes be
emitted for a longer
duration.
Vulnerable
systems include
electronic ignition
systems, radars,
communications,
data processing,
navigation, electronic
triggers of explosive
devices. HPM
capabilities can cause
a painful burning
sensation or other
injury to a person
directly in the path
of the focused power
beam, or can be fatal
if a person is too close
to the microwave
emitter.
Very damaging to electronics
within a small geographic area.
A shockwave could disrupt many
computers within a 1-mile range.
64. Radio frequency weapons have
ranges from tens of meters
to tens of kilometers. Unlike
HEMP, however, HPM radiation is
composed of shorter wave forms
at higher-frequencies, which
make it highly effective against
electronic equipment and more
difficult to harden against.
Note: Cyber attack focuses on denial of service, worms, and
viruses designed to attack or destroy critical infrastructure
related systems such as energy management, supervisory control
and data acquisition systems, security, control valves,
and voice over internet protocol telephones, which are critical
systems that support multiple functions and are becoming
increasingly connected to the internet.
It is important to indicate that commercial buildings have been
the preferred target of recent
terrorist attacks. Figure 1-6 illustrates such actions. Between
1998 and 2003, 1,566 commercial fa-
cilities were struck by terrorists while only 97 government, 170
diplomat facilities, and 41 military
facilities were affected during the same period.
Table 1-2: Event Profiles (continued)
1-16 STEP 1: THREAT IDENTIFICATION AND RATING
Figure 1-6 Total facilities affected by international terrorism
65. and weapons of
choice, 1998-2003
Collecting Information (Task 1.2)
When collecting information for your threat assessment, you
may ask the fol-
lowing questions: What groups or organizations exist/are
known? Do they
have capability among themselves or is that capability readily
obtainable lo-
cally? Do they have a history of terrorist acts and what are their
tactics? What
are the intentions of the aggressors against the government,
commercial
enterprises, industrial sectors, or individuals? Has it been
determined that
targeting (planning a tactic or seeking vulnerabilities) is
actually occurring or
being discussed?
Western
Europe
North
America
Middle
East
Latin
America
EurasiaAsiaAfrica
1998
74. e
p
a
rt
m
e
n
t
o
f
S
ta
te
1-17STEP 1: THREAT IDENTIFICATION AND RATING
For technological hazards, these same questions take a different
perspec-
tive. Does anything that can be a hazard (or be attacked, causing
collateral
damage) exist within a given distance of the building in
question? What is the
capability of that incident to cause harm? Is there a history of
this type of ac-
cident occurring?
Many security and intelligence organizations are a good source
of informa-
tion and data for threat assessments. These organizations
include the police
75. department (whose jurisdiction includes the building or site),
the local State
police office, and the local office of the Federal Bureau of
Investigation
(FBI.) In many areas of the country, there are threat
coordinating commit-
tees, including FBI Joint Terrorism Task Forces, that facilitate
the sharing
of information. In addition, the CDC, the U.S. Department of
Homeland
Security (DHS), and the Homeland Security Offices (HSOs) at
the State
level are good sources of information. For technological
hazards, it is impor-
tant to gather information from the local fire department and
hazardous
materials (HazMat) unit, Local Emergency Planning Committee
(LEPC),
and State Emergency Response Commission (SERC). LEPC and
SERC are
local and State organizations established under a U.S.
Environmental Pro-
tection Agency (EPA) program. They identify critical facilities
in vulnerable
zones and generate emergency management plans. Additionally,
most fire
departments understand which industries in the local area
handle the most
combustible materials and the HazMat unit understands who
handles mate-
rials that could have a negative impact upon people and the
environment. In
many jurisdictions, the HazMat unit is part of the fire
department.
Other good sources of information include the Department of
76. Homeland
Security Information Analysis and Infrastructure Protection
(IA/IP) Di-
rectorate and, under the Director, Central Intelligence Agency
(CIA), the
Terrorist Threat Integration Center (TTIC). The IA/IP
Directorate and the
TTIC enhance intelligence fusion to bring together all terrorist
information
in one place, enabling America’s best intelligence analysts and
investigators
from multiple departments to work as a team to put together the
pieces of the
puzzle.
Threat information is communicated through The Homeland
Security Infor-
mation Network. This communications system delivers real-time
interactive
connectivity among State and local partners and with the DHS
Homeland
Security Operations Center (HSOC) through the Joint Regional
Informa-
tion Exchange System (JRIES). Other DHS agencies participate
through
seats at the HSOC and their own operations centers, and the
system will be
further expanded within DHS operations. Each State and major
urban area’s
1-18 STEP 1: THREAT IDENTIFICATION AND RATING
Homeland Security Advisor and other points of contact will
receive software
77. licenses, technology, and training to participate in the
information sharing
and situational awareness that JRIES already brings to State and
local home-
land security personnel across the United States. Examples of
other points
of participation include State National Guard offices,
Emergency Operations
Centers (EOCs), and first responder and Public Safety
departments.
The network significantly strengthens the flow of real-time
threat information
to State, local, and private sector partners at the Sensitive-but-
Unclassified
level (SBU), and provides a platform for communications
through the clas-
sified SECRET level to State offices. The program is built upon
the JRIES
platform, a secure network and a suite of applications currently
operating
at the SBU level. Participants currently include approximately
100 organi-
zations, including Federal agencies, States, municipalities, and
other local
government entities, with a significant law enforcement user
base. All par-
ticipating entities have a certified counterterrorism mission.
Approximately
1,000 users currently have access to the system.
Determining the Design Basis Threat (Task 1.3)
Stopping a terrorist or physical attack on a building is very
difficult; any
building or site can be breached or destroyed. Weapons, tools,
78. and tactics
can change faster than a building can be modified against a
particular threat.
However, the more secure the building or site and the better the
building is
designed to withstand an attack, the better the odds the building
will not be
attacked or, if attacked, it will suffer less damage. Terrorists
generally select
targets that have some value as a target, such as an iconic
commercial prop-
erty, symbolic government building, or structure likely to inflict
significant
emotional or economic damage such as a shopping mall or
major seaport.
The type and size of the weapons to be considered in the threat
assessment
are usually selected by the building stakeholders in
collaboration with the
Assessment Team (i.e., engineers who specialize in the design
of structures
to mitigate the effects of explosions - see Step 3 of this How-To
Guide). The
threat assessment and analysis for any building can range from
a general
threat scenario to a very detailed examination of specific
groups, individuals,
and tactics that the building may need to be designed to repel or
defend
against. For this How-To Guide, a simplified method has been
selected to
help the Assessment Team and building stakeholders to identify
the primary
threats to their buildings (see Selecting Primary Threats below
and Table 1-
79. 3).
1-19STEP 1: THREAT IDENTIFICATION AND RATING
It is important to indicate that there are other sophisticated
methods and
criteria that can be used for more detailed threat analysis,
including the
TM5-853 Army-Air Force Security Engineering Manual, the
State of Florida HLS-
CAM vulnerability and criticality matrix, the Department of
Defense (DoD)
CARVER process, and the FEMA 386-7 Site/Building Inherent
Vulnerability
Assessment Matrix. The determination of which method to be
used should be
left to the Assessment Team and building owners.
The methodology presented in this How-To Guide is based upon
several
methodologies, including some of the ones listed above. It
provides a simple
and straightforward approach to focus on the primary threats
using se-
lected criteria. These primary threats will help the Assessment
Team and
stakeholders complete the risk assessment and focus on proper
mitigation
measures.
Selecting Primary Threats
Unlike natural disasters, terrorists continually evaluate, plan,
and seek to ex-
80. ploit the weakest building protective design features. Therefore,
it becomes
impossible both from a technical and benefit/cost point to try to
protect ev-
erything from every type of attack. The building stakeholders
have to make a
determination as to what the design basis threat is for their
building and what
level of protection they can afford. As the terrorist threat
changes over time,
the building stakeholders may wish to revisit this part of the
risk assessment
process.
To select your primary threats, the criteria described below
have been pro-
vided. The selected criteria are part of Table 1-3, which is
designed to help
you to determine your potential threat. Scores from 1 to 10 (10
being the
greater threat) are described.
❍ Access to Agent. The ease by which the source material can
be acquired to
carry out the attack. Consideration includes the local materials
of HazMat
inventory, farm and mining supplies, major chemical or
manufacturing
plants, university and commercial laboratories, and
transportation
centers.
❍ Knowledge/Expertise. The general level of skill and training
that
combines the ability to create the weapon (or arm an agent) and
the
81. technical knowledge of the systems to be attacked (heating,
ventilation,
and air conditioning (HVAC), nuclear, etc.). Knowledge and
expertise
can be gained by surveillance, open source research, specialized
training,
or years of practice in industry.
1-20 STEP 1: THREAT IDENTIFICATION AND RATING
❍ History of Threats (Building Functions/Tenants). What has
the potential
threat element done in the past, how many times, and was the
threat
local, regional, national, or international in nature? When was
the most
recent incident and where, and against what target? Are the
building
functions and tenants attractive targets for the terrorist?
❍ Asset Visibility/Symbolic. The economic, cultural, and
symbolic
importance of the building to society that may be exploited by
the
terrorist seeking monetary or political gain through their
actions.
❍ Asset Accessibility. The ability of the terrorist to become
well-positioned
to carry out an attack at the critical location against the
intended target.
The critical location is a function of the site, the building
layout, and the
security measures in place.
82. ❍ Site Population/Capacity. The population demographics of
the building
and surrounding area.
❍ Collateral Damage/Distance to the Building. The potential of
the threat
to cause collateral damage or disruption to the building of
interest. The
building of interest is not considered the primary target.
Table 1-3 is used in conjunction with Table 1-2 to create a
general Threat Sce-
nario for the site or building. Table 1-4 illustrates the use of the
threat scoring
matrix for a typical multi-story commercial office building in an
urban area
with underground parking, internet enabled environmental
energy manage-
ment system, Voice over Internet Protocol (VoIP)
telecommunications system,
Internal Protocol/Transmission Control Protocol (IP/TCP)
enabled security
system using local area network (LAN) and wireless
connectivity for closed-
circuit televisions (CCTVs) and entry access control, and
standard hard wire
connectivity for the fire alarm system. Your potential threats
will be selected
from those reaching the highest scores.
1-21STEP 1: THREAT IDENTIFICATION AND RATING
❍ History of Threats (Building Functions/Tenants). What has
83. the potential
threat element done in the past, how many times, and was the
threat
local, regional, national, or international in nature? When was
the most
recent incident and where, and against what target? Are the
building
functions and tenants attractive targets for the terrorist?
❍ Asset Visibility/Symbolic. The economic, cultural, and
symbolic
importance of the building to society that may be exploited by
the
terrorist seeking monetary or political gain through their
actions.
❍ Asset Accessibility. The ability of the terrorist to become
well-positioned
to carry out an attack at the critical location against the
intended target.
The critical location is a function of the site, the building
layout, and the
security measures in place.
❍ Site Population/Capacity. The population demographics of
the building
and surrounding area.
❍ Collateral Damage/Distance to the Building. The potential of
the threat
to cause collateral damage or disruption to the building of
interest. The
building of interest is not considered the primary target.
Table 1-3 is used in conjunction with Table 1-2 to create a
general Threat Sce-
84. nario for the site or building. Table 1-4 illustrates the use of the
threat scoring
matrix for a typical multi-story commercial office building in an
urban area
with underground parking, internet enabled environmental
energy manage-
ment system, Voice over Internet Protocol (VoIP)
telecommunications system,
Internal Protocol/Transmission Control Protocol (IP/TCP)
enabled security
system using local area network (LAN) and wireless
connectivity for closed-
circuit televisions (CCTVs) and entry access control, and
standard hard wire
connectivity for the fire alarm system. Your potential threats
will be selected
from those reaching the highest scores.
Table 1-3: Criteria to Select Primary Threats
Criteria
Scenario Access to
Agent
Knowledge/
Expertise
History of Threats
(Building Functions/
Tenants)
Asset
Visibility/
Symbolic
86. 6-8 Easy to
produce
Bachelor’s
degree or
technical school/
open scientific
or technical
literature
Regional/State incident,
occurred a few years ago,
caused substantial damage;
building functions and
tenants were one of the
primary targets
Existence
locally
known/
landmark
Open access,
restricted
parking
1,001-5,000 Within 1-
mile radius
3-5 Difficult to
produce or
acquire
Advanced
training/rare
87. scientific or
declassified
literature
National incident, occurred
some time in the past,
caused important damage;
building functions and
tenants were one of the
primary targets
Existence
publish/well-
known
Controlled
access,
protected
entry
251-1,000 Within 2-
mile radius
1-2 Very
difficult to
produce or
acquire
Advanced degree
or training/
classified
information
International incident,
occurred many years ago,
caused localized damage;
88. building functions and
tenants were not the
primary targets
Existence not
well-known/
no symbolic
importance
Remote
location,
secure
perimeter,
armed
guards,
tightly
controlled
access
1-250 Within 10-
mile radius
1-22 STEP 1: THREAT IDENTIFICATION AND RATING
Table 1-4: Nominal Example to Select Primary Threats for a
Specific Urban Multi-story Building
Criteria Score
Scenario Access
to
Agent
Knowledge/
93. Capacity” are constants because a single building is being
analyzed.
For the nominal example, the five primary threats that will be
examined in
more detail and the assumptions are:
❍ Suicide Bomber. 50-lb. satchel or vest detonating in interior
space or near
primary structural member
Table 1-4: Nominal Example to Select Primary Threats for a
Specific Urban Multi-story Building (continued)
Scenario Access
to
Agent
Knowledge/
Expertise
History of
Threats
(Building
Functions/
Tenants)
Asset
Visibility/
Symbolic
Asset
Accessibility
Site
Population/
94. Capacity
Collateral
Damage/
Distance
to
Building
Criteria Score
1-24 STEP 1: THREAT IDENTIFICATION AND RATING
❍ Vehicle Bomb. 500-lb. car bomb detonating within 15 feet of
building exterior
❍ Chemical Agent. Sarin gas most toxic of the listed agents;
assumed worst case
❍ Biological Agent. Recent mail attacks with Ricin; no
antidote, high economic productivity loss
❍ Cyber Attack. Impact on Emergency Management Systems
(EMS), VoIP telecommunications,
security systems
The “dirty bomb” and armed assault are other potential threats
that could be considered, but are
left out of this analysis for simplicity.
These examples reveal subjective estimates and summed scores
and provide a first level analysis of
the primary threats that may affect your site or building. To
complete this portion of your risk as-
sessment, you should use Worksheet 1-1.
95. Determining the Threat Rating (Task 1.4)
Having selected the primary threats for your site or building,
the next step is to determine how
the threat will affect the functions and critical infrastructure.
The threat rating is an integral part
of the risk assessment and is used to determine, characterize,
and quantify a loss caused by an ag-
gressor using a weapon or agent and tactic against the target
(asset). The threat rating deals with
the likelihood or probability of the threat occurring and the
consequences of its occurrence.
For determining the threat rating, this How-To Guide provides a
methodology based on consensus
opinion of the building stakeholders, threat specialists, and
engineers. (This group could be ex-
panded as necessary to help refine the scoring process.) Table
1-5 provides a scale to help you
with this process. The scale is a combination of a 7-level
linguistic scale and a 10-point numerical
scale (10 being the greater threat). The key elements of this
scale are the likelihood/credibility of
a threat, potential weapons to be used during a terrorist attack,
and information available to deci-
sion-makers. The primary objective is to look at the threat, the
geographic distribution of functions
and critical infrastructure, redundancy, and response and
recovery to evaluate the impact on the
organization should a primary threat attack occur. Tables 1-6A
and 1-6B display a nominal example
of applying these ratings for an urban multi-story building.
96. 1-25STEP 1: THREAT IDENTIFICATION AND RATING
Table 1-5: Threat Rating
Threat Rating
Very High 10
Very High – The likelihood of a threat, weapon, and tactic
being used against the site or
building is imminent. Internal decision-makers and/or external
law enforcement and intel-
ligence agencies determine the threat is credible.
High 8-9
High – The likelihood of a threat, weapon, and tactic being used
against the site or building is
expected. Internal decision-makers and/or external law
enforcement and intelligence agen-
cies determine the threat is credible.
Medium High 7
Medium High – The likelihood of a threat, weapon, and tactic
being used against the site or
building is probable. Internal decision-makers and/or external
law enforcement and intel-
ligence agencies determine the threat is credible.
Medium 5-6
Medium – The likelihood of a threat, weapon, and tactic being
used against the site or
building is possible. Internal decision-makers and/or external
law enforcement and intel-
ligence agencies determine the threat is known, but is not
verified.
Medium Low 4
97. Medium Low – The likelihood of a threat, weapon, and tactic
being used in the region is prob-
able. Internal decision-makers and/or external law enforcement
and intelligence agencies
determine the threat is known, but is not likely.
Low 2-3
Low – The likelihood of a threat, weapon, and tactic being used
in the region is possible. In-
ternal decision-makers and/or external law enforcement and
intelligence agencies determine
the threat exists, but is not likely.
Very Low 1
Very Low – The likelihood of a threat, weapon, and tactic being
used in the region or against
the site or building is very negligible. Internal decision-makers
and/or external law enforce-
ment and intelligence agencies determine the threat is non-
existent or extremely unlikely.
Worksheet 1-2 helps you organize and determine the threat
rating in terms of building functions
and infrastructure (see Task 2.3). The purpose is to produce a
more informed opinion regarding
the manmade hazards that affect your assets.
As a starting point, use a value of 5 and assume a medium level
of threat; then adjust the threat
rating up or down based on consensus. Note that the threat
rating is independent of the building
function and infrastructure because it is assumed to be
ubiquitous to the entire building and the
same threat numeric value is used vertically for each function or
infrastructure component (see
Tables 1-6A and 1-6B).
98. 1-26 STEP 1: THREAT IDENTIFICATION AND RATING
Table 1-6A: Nominal Example of Threat Rating for an Urban
Multi-story Building (Building Function)
Function Cyber Attack Vehicle Bomb
Suicide
Bomber
Chemical
(Sarin)
Biological
(Ricin)
Administration 8 4 5 2 2
Engineering 8 4 5 2 2
Warehousing 8 4 5 2 2
Data Center 8 4 5 2 2
Food Service 8 4 5 2 2
Security 8 4 5 2 2
Housekeeping 8 4 5 2 2
Day Care 8 4 5 2 2
Table 1-6B: Nominal Example of Threat Rating for an Urban
Multi-story Building (Building Infrastructure)
99. Infrastructure Cyber Attack Vehicle Bomb
Suicide
Bomber
Chemical
(Sarin)
Biological
(Ricin)
Site 8 4 5 2 2
Architectural 8 4 5 2 2
Structural Systems 8 4 5 2 2
Envelope Systems 8 4 5 2 2
Utility Systems 8 4 5 2 2
Mechanical Systems 8 4 5 2 2
Plumbing and Gas Systems 8 4 5 2 2
Electrical Systems 8 4 5 2 2
Fire Alarm Systems 8 4 5 2 2
IT/Communications Systems 8 4 5 2 2
1-27STEP 1: THREAT IDENTIFICATION AND RATING
WORKSHEET 1-1: SELECTION OF PRIMARY THREATS
100. Criteria Score
Scenario Access
to
Agent
Knowlege/
Expertise
History of
Threats
(Building
Functions/
Tenants)
Asset
Visibility/
Symbolic
Asset
Accessibility
Site
Population/
Capacity
Collateral
Damage/
Distance
to
Building
Improvised Explosive Device (Bomb)
1-lb. Mail Bomb
101. 5-lb. Pipe Bomb
50-lb. Satchel Bomb/
Suicide Bomber
500-lb. Car Bomb
5,000-lb. Truck Bomb
20,000-lb. Truck Bomb
Natural Gas
Worksheet 1-1 will help you to select your primary threats.
Building stakeholders and the Assessment
Team should review criteria provided in Task 1.3 of this How-
To Guide to fill out this Worksheet.
After ranking each threat against the provided criteria (Table 1-
2), the threat scores should be
summed. The top scoring threats (select three to ten of the
threats based on score dispersion) become
the major threats that you will use for the preparation of your
risk assessment.
1-28 STEP 1: THREAT IDENTIFICATION AND RATING
Criteria Score
Scenario Access
to
Agent
Knowlege/
106. Site
Population/
Capacity
Collateral
Damage/
Distance
to
Building
WORKSHEET 1-1: SELECTION OF PRIMARY THREATS
(CONTINUED)
1-30 STEP 1: THREAT IDENTIFICATION AND RATING
Worksheet 1-2 can be used to complete your risk assessment
and will be used in conjunction with Worksheets 4-1 and
4-2. It can be used to discuss priority threats with building
stakeholders and among the members of the Assessment
Team. To fill out this table, analyze the impact of a
particular threat on the building core functions and building
infrastructure components of your building. Use the results
of Worksheet 1-1 to assist you in this process. Building core
functions and building infrastructure components are defined
in Section 2.3 of this How-To Guide.
Threat Rating
Very High 10
High 8-9
Medium High 7
107. Medium 5-6
Medium Low 4
Low 2-3
Very Low 1
Function
Threat Rating (one column
for each threat)
Infrastructure
Threat Rating (one column
for each threat)
Administration Site
Engineering Architectural
Warehousing Structural Systems
Data Center Envelope Systems
Food Service Utility Systems
Security Mechanical Systems
Housekeeping Plumbing and Gas Systems
Day Care Electrical Systems
Other Fire Alarm Systems
108. Other IT/Communications Systems
WORKSHEET 1-2: THREAT RATING
STEP 2: ASSET VALUE ASSESSMENT
STEP 2: ASSET VALUE ASSESSMENT 2-1
OVERVIEW
The second step in the assessment process is to identify the
assets of your
area, site, and building that may be affected by a threat (see
Figure 2-1). Asset
value can be defined as a degree of debilitating impact that
would be caused
by the incapacity or destruction of an asset. An asset refers to a
resource
of value requiring protection. It can be tangible (i.e., buildings,
facilities,
equipment activities, operations, and information) or intangible
(i.e.,
processes or a company’s information and reputation).
The asset value assessment process involves the following
tasks:
❍ Identifying the layers of defense
❍ Identifying the critical assets
❍ Identifying the building core functions and infrastructure
❍ Determining the asset value rating
109. In this How-To Guide, the identification of the assets is done
within the
concept of layers of defense. The objective of layers of defense
is to create
a succeeding number of security layers more difficult to
penetrate, provide
additional warning and response time, and allow building
occupants to move
into defensive positions or designated safe haven protection.
This approach
will be especially helpful for identifying your mitigation
options after you
conclude your risk assessment.
TASKS:
2.1 Identifying the layers of defense
2.2 Identifying the critical assets
2.3 Identifying the building core functions and
infrastructure
2.4 Determining the asset value rating
Step 4: Risk Assessment
Step 2: Asset Value Assessment
Step 3: Vulnerability Assessment
Step 1: Threat Identification and Rating
Figure 2-1 Steps and tasks
Step 5: Consider Mitigation Options
110. STEP 2: ASSET VALUE ASSESSMENT2-2
To identify and prioritize a building’s critical assets is a vital
step in the
process to improve its level of protection prior to a terrorist
attack. Recog-
nizing that people are a building’s most critical asset, the
process described
throughout this step will help you to identify and prioritize
those assets where
people are most at risk and require protection.
Identifying the Layers of Defense (Task 2.1)
The layers of defense is a traditional approach in security
engineering and
use concentric circles extending out from an area or site to the
building or
asset that requires protection. They can be seen as demarcation
points for
different security strategies. Identifying the layers of defense
early in the as-
sessment process will help you to understand better the assets
that require
protection and determine your mitigation options. Figure 2-2
shows the layers
of defense described below.
First Layer of Defense. This involves understanding the
characteristics of the
surrounding area, including construction type, occupancies, and
the nature
and intensity of adjacent activities. It is specifically concerned
111. with buildings,
installations, and infrastructure outside the site perimeter. For
urban areas, it
also includes the curb lane and surrounding streets.
Second Layer of Defense. This refers to the space that exists
between the
site perimeter and the assets requiring protection. It involves
the placement
of buildings and forms in a particular site and understanding
which natural
or physical resources can provide protection. It entails the
design of access
points, parking, roadways, pedestrian walkways, natural
barriers, security
lighting, and signage. For urban areas, it refers specifically to
the building
yard.
Third Layer of Defense. This deals with the protection of the
asset itself. It
proposes to harden the structures and systems, incorporate
effective HVAC
systems and surveillance equipment, and wisely design and
locate utilities and
mechanical systems. Note that, of all blast mitigation measures,
distance is the
most effective measure because other measures vary in
effectiveness and can
be more costly. However, often it is not possible to provide
adequate stand-
off distance. For example, sidewalks in many urban areas may
be less than 10
meters (33 feet), while appropriate stand-off may require a
minimum of 25
meters (82 feet).
112. Designers should consider providing adequate stand-off distance
when pos-
sible. In this case, the hardening of the building is a second
choice.
STEP 2: ASSET VALUE ASSESSMENT 2-3
Figure 2-2 Layers of defense
Urban versus Rural
The layers of defense are not predetermined and they may vary
from site to
site and from building to building. If a particular building
requiring protec-
tion is part of a campus or located in a rural, semi-rural, or
urban area, a
similar analysis may be applicable for all cases when
determining the impor-
tance of the asset. However, the security elements necessary to
protect the
building can be entirely different, depending on its location.
The approach
suggests establishing different demarcation points in order to
identify sound
security strategies. The layers of defense concept proposes that
each designer
study a particular site and determine critical assets that need to
be protected
and how protection should take place.
Figure 2-3 depicts the security elements that may be considered
in an urban
113. setting. It shows how the second layer of defense becomes
extremely impor-
tant to protect a building in an urban area. Note that the
elements described
below may require a different method of protection for a
campus or a rural
site. Major layers for an urban setting include:
❍ Curb Lane (First Layer of Defense). This area refers to the
lane of the
street closest to the sidewalk. Typically it is used for curbside
parking,
passenger drop-off, loading, and service vehicles. Curbside
parking should
not be removed unless additional stand-off distance is
absolutely required
First Layer of Defense
Entry Control Point
Perimeter (site property line
or fence)
1
Second Layer of Defense
Third Layer of Defense
3 2
1
2
114. 3
STEP 2: ASSET VALUE ASSESSMENT2-4
for high-target buildings. When required, sidewalks can be
widened to
incorporate the area devoted to the curb lane.
❍ Sidewalk (First Layer of Defense). This area serves as the
common space
for pedestrian interaction, moment, and activity. If possible,
sidewalks
should be left open and accessible to pedestrians and security
elements
should not interfere with the circulation. The streetscape could
include
hardened versions of parking meters, streetlights, benches,
planters, and
trash receptacles. The use of retractable bollards is a great
solution when
the width of the street does not allow the placement of security
elements.
❍ Building Yard (Second Layer of Defense). This area refers to
the exterior
space between the building and the sidewalk. It consists of a
grassy
area adjacent to the building flush with the sidewalk or a
planted bed
raised above the level of the sidewalk. It also includes
pedestrian entries
and loading docks. For the building yard, security components
should
complement the building architecture and landscaping. Security
115. elements
should be located near the outer edge of the yard. A planter or
raised
plinth wall provides a good security barrier in this layer.
Figure 2-4 shows the layers of defense in a campus or
rural/semi-rural setting
that may be required for a campus when a particular building is
considered a
critical asset. Protection entails considering access points,
parking, roadways,
pedestrian walkways, natural and physical barriers, security
lighting, and sig-
nage. Similar situations can be encountered in a campus setting
or in a rural
or semi-rural area.
STEP 2: ASSET VALUE ASSESSMENT 2-5
Figure 2-3 Layers of defense in a urban setting
Figure 2-4 Layers of defense when a particular building is
considered a critical
asset
Second Layer of Defense
for a campus
First Layer of Defense
for a campus
Second Layer of Defense
for a campus
116. Highly Secured Building
First, Second, and Third
Layers of Defense for a
structure of interest
Building
Interior
Building Yard
Second Layer of Defense
Third Layer
of Defense
First Layer of Defense
Sidewalk Curb
Lane
Street
STEP 2: ASSET VALUE ASSESSMENT2-6
Identifying the Critical Assets (Task 2.2)
This task involves identifying critical assets within the layers of
defense
described in Task 2.1. The purpose is to help you determine
those assets es-
sential to the minimum operation of your building, and to
ensure the health
and safety of the building and its occupants. Table 2-1 is a
starting point for
117. this exercise. Appendix A of this How-To Guide -- the Building
Vulnerability
Assessment Checklist -- provides detailed information regarding
the vulner-
ability of your assets.
Identifying Critical Assets for the First Layer of Defense. One
of the first
steps when identifying your critical assets is to understand your
surrounding
areas and how construction types, occupancies, functions, and
activities
adjacent to your asset can pose a threat or serve to protect your
asset. It is es-
sential to understand the interdependencies and distance that
separate your
building and off-site facilities. Off-site facilities can include:
❍ Landmarks and iconic buildings
❍ Law enforcement, fire departments, and hospital buildings
❍ Federal facilities
❍ Embassies
❍ Key commercial properties
❍ HazMat storage areas and chemical manufacturing plants
❍ Transportation (roads, avenues of approach, bridges,
railroads, tunnels,
airports, and ports)
❍ Telecommunications and utility services
118. To assess your assets, you may want to consider different
scenarios. For ex-
ample, a car bomb may be able to carry 200 pounds of TNT and
a truck
bomb may be able to carry 11,000 pounds of TNT. If it is
possible that these
bombs could be placed proximate to your building, you may
want to deter-
mine potential damages that they could cause, as well as
protective actions for
your building. To assess potential damage, the use of
Geographic Information
Systems (GISs) can be an invaluable resource. Figures 2-5 and
2-6 depict this
process. There are several powerful GIS systems available that
can help you to
determine your critical asset within the first layer of defense.
For this How-To
Guide, we suggest the use of HAZUS-MH, described in Figure
2-7. Note that
the use of GIS is not required to prepare assessment studies; it
is only a tool to
facilitate the process.
STEP 2: ASSET VALUE ASSESSMENT 2-7
Figure 2-5 Potential blast effects – 200-lb car bomb
Figure 2-6 Potential blast effects – 11,000-lb truck bomb
STEP 2: ASSET VALUE ASSESSMENT2-8
119. HAZUS-MH is a GIS based software developed to esti-
mate losses from earthquakes, floods, and hurricane
winds.
HAZUS-MH takes into account various impacts of a
hazard event such as:
• Physical damage: damage to residential and
commercial buildings, schools, critical facilities,
and infrastructure
• Economic loss: lost jobs, business interruptions,
and repair and reconstruction costs
• Social impacts: impacts to people, including requirements for
shelters and medical aid
HAZUS-MH includes the largest compilation of
geo-reference data made available by the Fed-
eral Government at no cost. The HAZUS-MH
provided inventory data are gathered from the
nationally available data sources and include the
following:
General Building Stock includes residential,
commercial, and industrial building types.
HAZUS-MH groups the general building stock
into 39 specific model building types and 33 spe-
cific occupancy classes.
Essential Facilities include hospitals and other medical
facilities, police and fire stations,
EOCs, and schools that are often used as shelters.
Hazardous Material Facilities include storage facilities for
industrial or hazardous materials
120. such as corrosives, explosives, flammable materials, radioactive
materials, and toxins.
High Potential Loss Facilities include nuclear power plants,
dams, levees, and military installa-
tions.
Figure 2-7 Using HAZUS-MH to identify the criticality of
assets
STEP 2: ASSET VALUE ASSESSMENT 2-9
Transportation Lifeline Systems include the following types of
infrastructure inventory data:
• Airways – airport facilities, airport runways, heliport
facilities, and heliport landing
pads
• Highways – bridges, tunnels, and road segments
• Railways – tracks, tunnels, bridges, and facilities (railyards
and depots)
• Waterways – ports (locks, seaports, harbors, dry docks, and
piers) and ferries
• Bus Stations
Utility Lifeline Systems include potable water, wastewater, oil,
natural gas, electric power, and
communications systems.
Demographics include people assets of the inventory data
regarding total population; age,
gender, and race distribution; income distribution; number of
owners and renters; building
121. age; and other data obtained from the U.S. Census Bureau and
Dun & Bradstreet. The de-
mographic data are aggregated at the Census block or Census
tract level.
The database sets in HAZUS-
MH are easily converted
into visual charts, maps, and
graphics for a given site or
building.
Training is necessary to run
HAZUS-MH and other GIS
software. In case of HAZUS-
MH, the user must be
familiarized with Windows-
based environments, GIS
software (ArcGIS® 8.3), and
data manipulation.
HAZUS-MH is a non-pro-
prietary software that can
be ordered at no charge at:
http://www.fema.gov/hazus
Figure 2-7 Using HAZUS-MH to identify the criticality of
assets (continued)
STEP 2: ASSET VALUE ASSESSMENT2-10
Identifying Critical Assets for the Second Layer of Defense. To
identify your
critical assets, you need to understand how important they are in
terms of
122. protecting people and key operations. Table 2-1 provides a
nominal example
of the components that may be of concern when establishing
your critical
asset. The elements across the top include the different threats
that you may
have identified. The column to the left provides a list of
concerns related to
your site. This process can be further expanded by consulting
the Building
Vulnerability Assessment Checklist in Appendix A. When
determining your
asset value, you may ask the following questions:
❍ Are perimeter fences or other types of barrier controls in
place?
❍ What are the access points to the site or building?
❍ Is there vehicle and pedestrian access control at the perimeter
of the site?
❍ Does site circulation prevent high-speed approaches by
vehicles?
❍ Is there a minimum setback distance between the building and
parked
vehicles?
❍ In dense, urban areas, does curb lane parking allow
uncontrolled vehicles
to park unacceptably close to a building in public rights-of-
way?
❍ What are the existing types of vehicle anti-ram devices for
the site or
123. building?
❍ Do existing landscape measures/features (walls, fountains,
berms, etc.)
deflect or dissipate the blast pressure?
❍ Are these devices at the property boundary or at the building?
Identifying Critical Assets for the Third Layer of Defense.
When estimating
your critical assets within the third layer of defense, you need
to consider
the structural and non-structural soundness of your building, as
well as the
possibility of mechanical, plumbing, and electrical systems
continuing opera-
tions after an attack. Given the evolving nature of the terrorist
threat, it is
hard to estimate the value of your assets. For example, due to
the catastrophic
consequences of progressive collapse, evaluating the structural
components
of your building can become a high priority. Windows that are
the weakest
part of a building can become a crucial issue. Other important
elements for
blast design may include hardening of mechanical and electrical
systems and
creating appropriate redundancies. The location of air-intakes
and limiting
the access of the public to main systems can become critical for
reducing po-
tential damage from terrorist attacks. The upgrade of HVAC
systems and the
adoptions of efficient filtering systems can become a key
consideration when
124. establishing critical assets.
STEP 2: ASSET VALUE ASSESSMENT 2-11
Table 2-1 is provided to assist you in assessing your critical
assets. As previously
stated, you may also want to consult the Building Vulnerability
Assessment
Checklist provided in Appendix A to further analyze your
concerns. When
determining your critical assets for the third layer of defense,
you may ask the
following questions:
❍ What is the designed or estimated protection level of the
exterior walls
against the postulated explosive threat?
❍ Is the window system design on the exterior façade balanced
to mitigate
the hazardous effects of flying glazing following an explosive
event?
(glazing, frames, anchorage to supporting walls, etc.)
❍ Do non-window openings, such as mechanical vents and
exposed
plenums, provide the same level of protection required for the
exterior
wall?
❍ Is the incoming water supply in a secure location? Is there a
secure
alternate drinking water supply?
125. ❍ Are the incoming air intakes in a secure location?
❍ How much fuel is stored on the site or at the building and
how long
can this quantity support critical operations? How is it stored?
How is it
secured?
❍ Is roof access limited to authorized personnel by means of
locking
mechanisms?
❍ What are the types and level of air filtration?
❍ Are there provisions for air monitors or sensors for CBR
agents?
Identifying the Building Core Functions and
Infrastructure (Task 2.3)
The identification of the building core functions and
infrastructure is one of
the key elements of the assessment. These functions are the
basis for the analysis
described in this How-To Guide. The functions and
infrastructure analyses
identify the geographic distribution within the building and
interdependencies
between critical assets. Ideally, the functions should have
geographic dispersion
as well as a pre-determined recovery site or alternate work
location. Similarly,
critical infrastructure should have geographic dispersion and
backup. For ex-
ample, a bomb or CBR attack entering through the loading dock
could impact
126. the telecommunications, data, uninterruptible power supply
(UPS), generator,
and other key infrastructure systems. The core functions and
infrastructure are
described below.
STEP 2: ASSET VALUE ASSESSMENT2-12
FIRST LAYER OF DEFENSE
Effects of off-property development have not been considered ■
■ ■ ■
Site is within view of other occupied facilities ■
Site is adjacent to high terrain or structures ■
Site is close to adjacent dense vegetation ■
Site is not within low-lying topographic areas ■
Lack of fencing and physical barriers ■ ■ ■ ■
Lack of active monitoring for fences and entry points ■ ■ ■ ■
Insecure access roads to the site ■ ■ ■
Lack of entry control and vehicular access ■ ■ ■ ■
Lack of pull-over lanes at checkpoints to inspect vehicles ■
Ineffective straight-line vehicular access to high-risk resources
■
127. Insecure straight-line entry approach roads ■
Lack of distance from sidewalk to building yard ■
SECOND LAYER OF DEFENSE
Lack of distance from perimeter fence and developed areas ■ ■
■
High-risk resources are not away from primary roads ■ ■
High-risk land uses are not considered in the interior of the site
■
Lack of sufficient stand-off ■
Lack of exclusive zone/non-exclusive zones ■
Facilities with similar threat levels have not been clustered ■ ■
Controlled access zones have not been established ■ ■ ■ ■
Site critical facilities have not been set on higher ground ■ ■
High surrounding terrain for protected area has not been
established ■
Lack of earth berms used for protection or barriers ■
Lack of bodies of water used for protection or barriers ■
Lack of physical obstruction screens ■ ■
Lack of dense thorn-bearing vegetation ■
■ The symbols indicate which debilitating conditions shown in
128. the left hand column apply to the
types of threats indicated across the top of the chart.
Cy
be
r A
tt
ac
k
Ve
hi
cle
B
om
b
Su
ici
de
B
om
be
r
Ch
em
ica
129. l (
Sa
rin
)
Bi
ol
og
ica
l
(R
ici
n)
O
th
er
s
Table 2-1: Correlation of the Layers of Defense Against Threats
STEP 2: ASSET VALUE ASSESSMENT 2-13
Lack of vegetation screens ■ ■
Lack of landscape planting to conceal aboveground systems ■ ■
Areas that provide unwanted concealment exist ■ ■ ■
130. Unwanted surveillance is possible ■ ■ ■ ■
Lack of clear zone for surveillance ■ ■ ■ ■
Parking surveillance or viewing does not exist ■ ■ ■ ■
Parking is allowed near high-risk areas ■ ■ ■ ■
Parking is allowed in exclusive zone ■ ■ ■ ■
One-way circulation exists ■
Vehicular access to high-risk resources is not limited ■ ■
Lack of complexes to enhance surveillance opportunities ■ ■
Lack of building yard to place security barriers ■
Extremely narrow sidewalks that do not permit introducing
security elements ■
Lack of active barriers ■
Lack of passive barriers ■
Lack of bollards ■
Anti-ram street furniture is not in use ■
Lack of protection in curbs and sidewalks ■
Lack of enhanced protection close to building entrances ■
Lack of physical security lighting ■ ■ ■ ■
131. Lack of discrete directional signs for high-risk buildings ■ ■ ■
■
Lack of major routing corridors away from high-risk resources
■ ■ ■ ■
High-risk resources are not located far from vehicle parking ■ ■
■ ■
Lack of appropriate stand-off zones ■ ■
Lack of separation between facilities ■ ■ ■
Cy
b
er
A
tt
ac
k
Ve
hi
cle
B
om
b
Su
ici