FACULTY OF COMPUTING AND BUSINESS MANAGEMENT
Vila College
BMMK 5103
ENTERPRISE DEVELOPMENT
ASSIGNMENT
Date Assigned: 2nd t March 2013
Due Date: 6th April 2013
Lecturer: Mr.Hamid Sodique
Student ID: s111023248
Student name: Imad Mohamed
Imad MohamedACKNOWLEDGEMENT
First of all I would like to thank God as I am able to finish this assignment given by Mr.Hamid Sodique, lecture of the Module: Marketing Management.. This task cannot be completed without guidance and continued support of from lecture. Therefore I would like to take this opportunity to tank lecture, Mr.Hamid Sodique for his guidance for and explanation of the subject, and kind extension of deadline for submitting the assignment. I also appreciated those Villa College’s facilitations, to grant me late registration and extension for submitting the assignment.
I am a civil servant having heavy workload especially during the time there is much challenges for our work to uphold decentralization system in Maldives. My studies and work towards this assignment is completed because of the flexibility and support given by my office management and staff as well. I recognized the support of office management and thanks management of Local Government Authority
This task has been done with the help of and discussion with colleague students of the class, and I would address big thanks to all fellow students.
Finally I thanks to my beloved family and friends that always stick together and also work hard to produce good assignment.EXECUTIVE SUMMARY
The case presented discusses Singtrix’s activities that outline its strengths and weaknesses. This paper clearly identifies the company’s life in the industry. The paper also provides information that will help in depicting a clear picture in the company’s operations and activities.
This paper discusses the strengths and weaknesses of the company and the main reason behind these occurrences. This paper clearly explains the position of the company in the musical instrument industry. It will outline the main strategies that the company needs to adopt in order to ensure that the new product penetrates and is fully accepted into the market. The information provided best explains what the company needs to do and what it needs to change when introducing a new product into the market.
An analysis of the internal practices of the company help outlines the company's SWOT. The strengths related to the company are; producing quality, producing unique products with unique features, changing the unthinkable, that is, making bad singers good singers and producing user-friendly devices. The company's weaknesses include; poor marketing; its products get only known by a certain class of individuals and limited brands. Its opportunities include; its quality products help attract new clients, stands a great chance of becoming one of the best in the industry, its ability to make music stars acts as a way of advertisement and have a chance of creating new p ...
Running Head MARKETING COMMUNICATION AND BRAND STRATEGY .docxcowinhelen
Running Head: MARKETING COMMUNICATION AND BRAND STRATEGY 1
MARKETING COMMUNICATION AND BRAND STRATEGY 5
MARKETING COMMUNICATION AND BRAND STRATEGY
Regina Snedecor
MKT/571 Marketing Management
April 15, 2017
Heidi Kelley
Marketing Communication and Brand Strategy
Branding in business is the process by which goods or commodities of a company given names that can easily identify in the market. Branding is an essential thing when it comes to business; this is an active brand has a guaranteed long life; this is because will shift from the commodity itself but settle on the name. Various things attributed to a powerful brand that will ensure that the company will be able to have a product that will sell itself just by the mention of the name. This paper will come up with an efficient manner or rather strategy of setting a brand. Marketing communication, on the other hand, is defined as the plan established by the company so that it can be able to reach its desired customers. The company will have to pick as accurate communication that will help them achieve the market communication plan.
In coming up with a proper marketing plan it is fundamentally based on the objectives of the company, and there are the essential 4ps that are not to be forgotten, they are a place, promotion, price, and product. Situational analysis is used by managers in a collection of data to be able to analyze the internal and external environment to understand the capabilities of the customers and the business climate. The following are the situational analysis when coming up with a brand operational requirement to pick and analyze to be able to understand the dynamics of the environment and the expectations of the clients (Donthu, 2000).
Vision, mission, strategic objectives.
For any successful brand, the needs of the client ought to come first this is because they are the people in whom the business intends to consume the product. Therefore, the vision of any successful brand should be towards customer satisfaction and meet their needs. The objectives of a business are what firstly dictates its survival in the firm. The values and strategic goals of any business should be carried out with the thought of the client this will assist in fulfilling the desires of the customers and coming up with an effective brand.
Strength/weaknesses
For a successful brand to build a SWOT analysis should be conducted, this will be able to identify the place in which the business holds in the market. When strengths identified, the business will be able to capitalize on the power; this will be able to overshadow the weaknesses that identified when the company settled. For instance, a brand that is being set up in the clothing industry, if they had a strength of making clothes with better fabrics compared to their competitors and their weakness is that it would likely face a shortage of supply. The business n ...
Running Head MARKETING COMMUNICATION AND BRAND STRATEGY .docxcowinhelen
Running Head: MARKETING COMMUNICATION AND BRAND STRATEGY 1
MARKETING COMMUNICATION AND BRAND STRATEGY 5
MARKETING COMMUNICATION AND BRAND STRATEGY
Regina Snedecor
MKT/571 Marketing Management
April 15, 2017
Heidi Kelley
Marketing Communication and Brand Strategy
Branding in business is the process by which goods or commodities of a company given names that can easily identify in the market. Branding is an essential thing when it comes to business; this is an active brand has a guaranteed long life; this is because will shift from the commodity itself but settle on the name. Various things attributed to a powerful brand that will ensure that the company will be able to have a product that will sell itself just by the mention of the name. This paper will come up with an efficient manner or rather strategy of setting a brand. Marketing communication, on the other hand, is defined as the plan established by the company so that it can be able to reach its desired customers. The company will have to pick as accurate communication that will help them achieve the market communication plan.
In coming up with a proper marketing plan it is fundamentally based on the objectives of the company, and there are the essential 4ps that are not to be forgotten, they are a place, promotion, price, and product. Situational analysis is used by managers in a collection of data to be able to analyze the internal and external environment to understand the capabilities of the customers and the business climate. The following are the situational analysis when coming up with a brand operational requirement to pick and analyze to be able to understand the dynamics of the environment and the expectations of the clients (Donthu, 2000).
Vision, mission, strategic objectives.
For any successful brand, the needs of the client ought to come first this is because they are the people in whom the business intends to consume the product. Therefore, the vision of any successful brand should be towards customer satisfaction and meet their needs. The objectives of a business are what firstly dictates its survival in the firm. The values and strategic goals of any business should be carried out with the thought of the client this will assist in fulfilling the desires of the customers and coming up with an effective brand.
Strength/weaknesses
For a successful brand to build a SWOT analysis should be conducted, this will be able to identify the place in which the business holds in the market. When strengths identified, the business will be able to capitalize on the power; this will be able to overshadow the weaknesses that identified when the company settled. For instance, a brand that is being set up in the clothing industry, if they had a strength of making clothes with better fabrics compared to their competitors and their weakness is that it would likely face a shortage of supply. The business n ...
Dear students get fully solved assignments
Send your semester & Specialization name to our mail id :
help.mbaassignments@gmail.com
or
call us at : 08263069601
Start Right -Finish Well Product Launch Processjerianasmith
A successful launch requires several elements coming together all at once.Forward Vision has developed a tried-and-true set of best practices to launch a product. Our aim is to provide the companies we work with the tools and a process that give them a competitive edge.
APPLIED MANAGERIAL MARKETING
NEW PRODUCT LAUNCH
STUDENT’S NAME
PROFESSOR’S NAME
25TH NOVEMBER’ 2013
MOBILE MANUFACTURING, Inc.
ABSTRACT
A marketing strategy illuminates the key marketing fundamentals of a business and maps out guidelines, principles and proceedings for the business and its employees. The marketing plan depicts on the extensive perceptions summarized in a firm's business plan. The business strategy illustrates the ways a company will seize a product thought and refurbish that into a commercially viable plan.
REFERENCES
Managing Product Management: Empowering Your Organization to Produce Competitive Products and Brands by Steven Haines (Sep 19, 2011)
The Market Planning Guide: Creating a Plan to Successfully Market Your Business, Products, or Service by David H. Bangs (Jan 1998)
The Lean Startup: How Today's Entrepreneurs Use Continuous Innovation to Create Radically Successful Businesses... by Eric Ries (Sep 13, 2011)
Approved Marketing Plans for New Products and Services by Ken K. Wong (Nov 23, 2010)
BRANDING STRATEGY
Branding is one of the major crucial attributes of any business, hefty or miniature, retail or B2B. Mobile Manufacturing Inc. fits in to the service industry; consequently the eminence of the merchandise and service they proffer must be of better-quality in order to achieve cutthroat benefit in the market. Therefore an effective brand stratagem for MM’s new product furnishes a prime periphery in increasingly more insistent markets. It elucidates them what they can foresee from MM’s goods and services, and it discriminates their proffering from their contenders. The brand subterfuge is by means of, what, anywhere, at what time and to whom the organization strategize on consequent and assigning on the brand communications. Wherever MM promotes is constituent of the brand stratagem. The distribution feeds are in addition component of the brand stratagem. And what the company commune visually and vocally are constituent of the brand subterfuge, as well. Unswerving, considered branding escorts to a strapping brand equity, which means the additional value conveyed to the company's products or services that permits to charge more for the brand than what indistinguishable, unbranded products grasp.
NEW PRODUCT LAUNCH GOALS OF MOBILE MANUFACTURING
Prospect goals: Mobile Manufacturing, Inc. has an elongated lead time for selling new products. A suitable goal may perhaps be to delineate how many prospects MM would be fond of to categorize as a consequence of the product launch.
Product consciousness goals: The sales progression generally commences with the market being conscious of the organization and its product. MM’s marketing endeavors can facilitate to put together that awareness. Even though the tactics may perhaps differ, one goal ought to incorporate being competent to determine the consciousness MM has built.
Customer goals: Since it is not the foremost product launch, MM may perhaps have goals to i.
Marketing is an organizational function and a set of processes for creating, communicating and delivering value to customers and for managing customers’ relationships in ways that benefit the organization and its stakeholder.
Introduction to performing an assessment of your company's product management...CompellingPM
The Product Management and Product Marketing Roles are some of the most strategically important roles in an organization and when well executed, can help the organization consistently deliver products and services that are successful in the market and result in increased revenue, market share and profitability. But unfortunately, these are also some of the most misunderstood roles and too often are relegated to tactical duties and miss out on delivering the strategic value and impact that they could deliver to the organization.
How do you ensure that your Product Management & Product Marketing team is consistently delivering strategic value? How do you know if the structure and process you have in place are right for your organization? How do you know if your team is doing all of the critical activities they should be doing? How do you know if you have the right people in these roles?
The starting point is to do an Assessment of Your Product & Market Management Practices.
Educaterer India is an unique combination of passion driven into a hobby which makes an awesome profession. We carve the lives of enthusiastic candidates to a perfect professional who can impress upon the mindsets of the industry, while following the established traditions, can dare to set new standards to follow. We don't want you to be the part of the crowd, rather we like to make you the reason of the crowd. Today's Effort For A Better Tomorrow
Kingston Ansah is working for Microsoft Excel, Negotiation, Customer Service, Microsoft Office, Business Strategy, Change Management, Financial Analysis. He is well known person for these skill and also awarded person. He is very simple and kindable personality person for people.
Rewiring marketing: a practice based approachBrowne & Mohan
Many marketing managers are not aware if they are leveraging marketing efforts correctly or getting the returns that they anticipated. Often people believe transforming marketing is all about creating some digital assets. Marketing transformation is not piece meal improvement. The primary purpose of a marketing transformation is to increase the ROI of marketing your company. In this white paper, Browne & Mohan consultants share a practice based approach to marketing transformation.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to FACULTY OF COMPUTING AND BUSINESS MANAGEMENTVILA COLLEGEBM.docx
Dear students get fully solved assignments
Send your semester & Specialization name to our mail id :
help.mbaassignments@gmail.com
or
call us at : 08263069601
Start Right -Finish Well Product Launch Processjerianasmith
A successful launch requires several elements coming together all at once.Forward Vision has developed a tried-and-true set of best practices to launch a product. Our aim is to provide the companies we work with the tools and a process that give them a competitive edge.
APPLIED MANAGERIAL MARKETING
NEW PRODUCT LAUNCH
STUDENT’S NAME
PROFESSOR’S NAME
25TH NOVEMBER’ 2013
MOBILE MANUFACTURING, Inc.
ABSTRACT
A marketing strategy illuminates the key marketing fundamentals of a business and maps out guidelines, principles and proceedings for the business and its employees. The marketing plan depicts on the extensive perceptions summarized in a firm's business plan. The business strategy illustrates the ways a company will seize a product thought and refurbish that into a commercially viable plan.
REFERENCES
Managing Product Management: Empowering Your Organization to Produce Competitive Products and Brands by Steven Haines (Sep 19, 2011)
The Market Planning Guide: Creating a Plan to Successfully Market Your Business, Products, or Service by David H. Bangs (Jan 1998)
The Lean Startup: How Today's Entrepreneurs Use Continuous Innovation to Create Radically Successful Businesses... by Eric Ries (Sep 13, 2011)
Approved Marketing Plans for New Products and Services by Ken K. Wong (Nov 23, 2010)
BRANDING STRATEGY
Branding is one of the major crucial attributes of any business, hefty or miniature, retail or B2B. Mobile Manufacturing Inc. fits in to the service industry; consequently the eminence of the merchandise and service they proffer must be of better-quality in order to achieve cutthroat benefit in the market. Therefore an effective brand stratagem for MM’s new product furnishes a prime periphery in increasingly more insistent markets. It elucidates them what they can foresee from MM’s goods and services, and it discriminates their proffering from their contenders. The brand subterfuge is by means of, what, anywhere, at what time and to whom the organization strategize on consequent and assigning on the brand communications. Wherever MM promotes is constituent of the brand stratagem. The distribution feeds are in addition component of the brand stratagem. And what the company commune visually and vocally are constituent of the brand subterfuge, as well. Unswerving, considered branding escorts to a strapping brand equity, which means the additional value conveyed to the company's products or services that permits to charge more for the brand than what indistinguishable, unbranded products grasp.
NEW PRODUCT LAUNCH GOALS OF MOBILE MANUFACTURING
Prospect goals: Mobile Manufacturing, Inc. has an elongated lead time for selling new products. A suitable goal may perhaps be to delineate how many prospects MM would be fond of to categorize as a consequence of the product launch.
Product consciousness goals: The sales progression generally commences with the market being conscious of the organization and its product. MM’s marketing endeavors can facilitate to put together that awareness. Even though the tactics may perhaps differ, one goal ought to incorporate being competent to determine the consciousness MM has built.
Customer goals: Since it is not the foremost product launch, MM may perhaps have goals to i.
Marketing is an organizational function and a set of processes for creating, communicating and delivering value to customers and for managing customers’ relationships in ways that benefit the organization and its stakeholder.
Introduction to performing an assessment of your company's product management...CompellingPM
The Product Management and Product Marketing Roles are some of the most strategically important roles in an organization and when well executed, can help the organization consistently deliver products and services that are successful in the market and result in increased revenue, market share and profitability. But unfortunately, these are also some of the most misunderstood roles and too often are relegated to tactical duties and miss out on delivering the strategic value and impact that they could deliver to the organization.
How do you ensure that your Product Management & Product Marketing team is consistently delivering strategic value? How do you know if the structure and process you have in place are right for your organization? How do you know if your team is doing all of the critical activities they should be doing? How do you know if you have the right people in these roles?
The starting point is to do an Assessment of Your Product & Market Management Practices.
Educaterer India is an unique combination of passion driven into a hobby which makes an awesome profession. We carve the lives of enthusiastic candidates to a perfect professional who can impress upon the mindsets of the industry, while following the established traditions, can dare to set new standards to follow. We don't want you to be the part of the crowd, rather we like to make you the reason of the crowd. Today's Effort For A Better Tomorrow
Kingston Ansah is working for Microsoft Excel, Negotiation, Customer Service, Microsoft Office, Business Strategy, Change Management, Financial Analysis. He is well known person for these skill and also awarded person. He is very simple and kindable personality person for people.
Rewiring marketing: a practice based approachBrowne & Mohan
Many marketing managers are not aware if they are leveraging marketing efforts correctly or getting the returns that they anticipated. Often people believe transforming marketing is all about creating some digital assets. Marketing transformation is not piece meal improvement. The primary purpose of a marketing transformation is to increase the ROI of marketing your company. In this white paper, Browne & Mohan consultants share a practice based approach to marketing transformation.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Normal Labour/ Stages of Labour/ Mechanism of LabourWasim Ak
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
FACULTY OF COMPUTING AND BUSINESS MANAGEMENTVILA COLLEGEBM.docx
1. FACULTY OF COMPUTING AND BUSINESS
MANAGEMENT
Vila College
BMMK 5103
ENTERPRISE DEVELOPMENT
ASSIGNMENT
Date Assigned: 2nd t March 2013
Due Date: 6th April 2013
Lecturer: Mr.Hamid Sodique
Student ID: s111023248
Student name: Imad Mohamed
Imad MohamedACKNOWLEDGEMENT
First of all I would like to thank God as I am able to finish this
assignment given by Mr.Hamid Sodique, lecture of the Module:
Marketing Management.. This task cannot be completed without
guidance and continued support of from lecture. Therefore I
would like to take this opportunity to tank lecture, Mr.Hamid
Sodique for his guidance for and explanation of the subject, and
kind extension of deadline for submitting the assignment. I also
appreciated those Villa College’s facilitations, to grant me late
registration and extension for submitting the assignment.
I am a civil servant having heavy workload especially during
the time there is much challenges for our work to uphold
decentralization system in Maldives. My studies and work
towards this assignment is completed because of the flexibility
and support given by my office management and staff as well. I
2. recognized the support of office management and thanks
management of Local Government Authority
This task has been done with the help of and discussion with
colleague students of the class, and I would address big thanks
to all fellow students.
Finally I thanks to my beloved family and friends that always
stick together and also work hard to produce good
assignment.EXECUTIVE SUMMARY
The case presented discusses Singtrix’s activities that outline its
strengths and weaknesses. This paper clearly identifies the
company’s life in the industry. The paper also provides
information that will help in depicting a clear picture in the
company’s operations and activities.
This paper discusses the strengths and weaknesses of the
company and the main reason behind these occurrences. This
paper clearly explains the position of the company in the
musical instrument industry. It will outline the main strategies
that the company needs to adopt in order to ensure that the new
product penetrates and is fully accepted into the market. The
information provided best explains what the company needs to
do and what it needs to change when introducing a new product
into the market.
An analysis of the internal practices of the company help
outlines the company's SWOT. The strengths related to the
company are; producing quality, producing unique products
with unique features, changing the unthinkable, that is, making
bad singers good singers and producing user-friendly devices.
The company's weaknesses include; poor marketing; its
products get only known by a certain class of individuals and
limited brands. Its opportunities include; its quality products
help attract new clients, stands a great chance of becoming one
3. of the best in the industry, its ability to make music stars acts as
a way of advertisement and have a chance of creating new
products. Its threats include; the company has limited brands; it
is likely to drag behind if marketing strategies get not changed,
and it may lose customers due to its limited brads. The main
problem for the company's weaknesses and threats are its
limited brands and its poor marketing strategies. In order to
improve the existing marketing strategies, Singtrix LLC should
emphasize on quality. Quality is number one technique of
attaining a speed in a new product project. A product can only
move fast if it is of the best quality offered. It is advisable for
Singtrix LLC to invest more efforts and time on products to get
released in the market for quality purposes. Quality on new
products creates a long-term impression of quality on the
customer.
Singtrix LLC has to engage in marketing research and target
market. It will enable them put the right product at the right
place, with the right price tag at the right time. Market research
is fundamental in setting up or running a company. The reason
behind this is without a shadow of the doubt. If a company does
not have research done on the targeted market, and has
intelligence on the wants, needs and preferences of the intended
target market for the goods or services that it is offering, then,
the business venture is likely to be unsuccessful.
In order to take an alternative marketing strategy for its new
product, the company should adopt client-based strategy that
entirely focuses on the customer. Company managers all over
the global have insisted on the importance of focusing on the
customer, give them good value and better customer
satisfaction. A successful customer-based strategy considers
both sides of customer value, which is, the value offered by the
company to the client and the customer's value to the
organization. This strategy recognizes that, offering value to the
client needs marketing investment, and that the organization
4. must regain the investments.
In conclusion, it is important to note that, the crucial goal of the
product planning is meant to ensure that, the product gets
created. It should deliver a few business values to a particular
set of clients so as to meet specific financial goals that get
based on a corporate strategy that get defined. Successive plan
should help increase the effectiveness of the new product. The
plan should define the market target clients, opportunity,
specifies pricing, financial goals identification, indicate core
priorities for enhancement and development, and offers a guide
for delivery for about four years that follow.
Contents
2ACKNOWLEDGEMENT
3EXECUTIVE SUMMARY
71. INTRODUCTION
72. CASE SYNOPSIS
73. INTERNAL ANALYSIS
83.1 SWOT INTERNAL ANALYSIS
9Sstrength
9Weakness
10Opportunities
10Threats
103.2 MARKETING MIX
114. INDUSTRY ANALYSES
114.1 PORTER FIVE FORCES ANALYSIS
11Threats of new entry
12Threats of substitution
12Buyer’s power
12Suppliers’s power
12Competitive rivalry
125. KEY PROBLEMS
136. LESSONS LEARNED
147. HOW TO OVERCOME THESE PROBLEMS
5. 158. ALTERNATIVES
169. RECOMMENDED ALTERNATIVE
179.1 MARKETING CHANNELS
179.2 SUPPLY CHAIN
179.3 SOCIAL RESPONSIBILITY MARKETING
17Commitment to people
17Commitment to corporate governance
17Commitment to the environment
189.4 MARKET SEGMENTATION
18Geographical
18Demographical
189.5 TARGETING - CONSUMER'S HEART
189.6 MARKET POSITIONING
199.7 MARKETING MIX
19Product
19Price
19Place
19Promotion
19People
20Process
20Physical Evidence
2010. IMPLEMENTATION SCHEDULE OR TIME LINE
2111. EVALUATION- MEASURES OF EFFECTIVENESS
2112. CONCLUSION
2313. REFERENCE
1. INTRODUCTION
Planning in an organization enables it come up with a course for
the accomplishment of its objectives and goals. The process
begins with the evaluation of the present operations within the
organization and pointing out the things that need operational
improvement in the years that follow. From there, planning
engages envisioning the outcomes expected by the organization,
and establishing the stages needed in order to get at the aimed
destination, which is a success. Here, it does not matter whether
success if measured in terms of finances or objectives, which
may include making the organization one of the highest rated
6. companies in regards to customer fulfillment. Planning helps in
organizing use of resources, determining goals, managing
uncertainty and risk, team building and creating competitive
advantage.
New products are an important asset of an organization’s
competitive development strategy. Preparation for a new
product development sets a base for product sales, dominance of
a potential marketing and product positioning. Proper
preparation is critical for the interest of long-term success.
Advertising is the most critical aspect in the preparation of a
new product development, for it provides opportunities that help
overcome customer mistrust through exposure of the new
product. By first examining, the potential customers in order to
know the reactions of the customers would help set the proper
advertising message. Samples should also get provided for
proper exposure and usage know how of the new product.
Companies are feeling the pressure of bringing new products in
the market quickly to help compete with other companies,
satisfy the customer's demand and keep up with a new and
advanced technology. New products introduced by companies in
the market are of better quality than the old ones, which help
satisfy the needs of their users and consumers.
In early marketing, products are introduced into the market
before they get released. It usually applies to services or
product lines that are new. It gets done in order to help in
creating a market for them, obtain a customer input that is not
cost oriented and drive sales. It gets aimed at creating a product
that will not require readjustments, since the customers will
have already given their views about the product before it gets
released. This form of marketing offers a chance for rewards but
gets also risky, as compared to late marketing.
7. Late marketing is the kind of marketing that involves marketing
a product that is already in the market, but which is not
performing well in the market, or as a way of maintaining the
market grip of a product. It works better in sustaining the
market penetration of the product. It is beneficial in that it
markets a product that consumers have interacted with.
2. CASE SYNOPSIS
This paper discuses the process of product planning and the
factors that influence the process. It will also discuss the
possible challenges and their solutions. This paper clearly
explains the position of the company in the musical instrument
industry. It will outline the main strategies that the company
needs to adopt in order to ensure that the new product
penetrates and is fully accepted into the market. The
information provided best explains what the company needs to
do and what it needs to change when introducing a new product
into the market.
3. INTERNAL ANALYSIS
An internal analysis is an assessment of the company that is
closely connected to a SWOT analysis. SWOT stands for;
strengths, weaknesses and opportunities, threats.
3.1 SWOT INTERNAL ANALYSIS
A SWOT analysis gets carried out in order to show the
company's position in the market. It involves four activities that
help depict the necessary information. The four elements in a
SWOT analysis are strengths, weaknesses, opportunities, and
threats. These four elements are fundamental in showing the
current position of the company and areas it needs to work on
so as to achieve a competitive advantage.
Strengths
8. · Manufacturing quality.
· Manufacturing unique products with unique features.
· Changing the unthinkable, that is, making bad singers good
singers,
· User-friendly devices.
Opportunities
· Their qualities products help attract new clients.
· Stands a great chance of becoming one of the best in the
industry,
· Its ability to make music stars acts as a way of advertisement.
· Have a chance of creating new products.
Weaknesses
· Poor marketing.
· Its products get only known by a certain class of individuals
· Limited brands.
Threats
· The company has limited brands.
· It is likely to drag behind if marketing strategies get not
changed.
· It may lose customers due to its limited brands.Sstrength
Manufacturing quality is one of the strengths that Singtrix LLC
enjoys. The company has quality products and that are long
lasting. Manufacturing unique products with unique features is
strength of the company. Singtrix manufactures unique products
that have unique features, something that its competitors lack.
Another strength is to change the unthinkable; that is, making
bad singers good singers and producing user-friendly devices. It
is commonly unthinkable to bad singers. However, the company
can manufacture gadget that ensures that this goal gets
accomplished.
Weakness
9. The company's weaknesses include; poor marketing, which is
evident with their poor sales. Its products get only known by a
certain class of individuals; this means that, the goods are not
popular to the majority population. It has limited brands as
compared to its competitors such as Yamaha.
Opportunities
Their qualities products help attract new clients; this is an
opportunity that they can maintain and get the most out of it. It
stands a great chance of becoming one of the best in the
industry; this is because of its quality goods. Its ability to make
music stars acts as a way of advertisement. It has a chance of
creating new products, as the brands it manufactures are
limited.
Threats
Its threats include; limited brands. Thus, it is likely to drag
behind if marketing strategies get not changed. It may lose
customers due to its limited brands. 4. INDUSTRY ANALYSES
Industry Analysis is defined as
a market assessment tool designed to provide a business with an
idea of the complexity of a particular industry.
Industry analysis involves reviewing the economic, political
and market factors that influence the way the
industry develops. Major factors can include the power wielded
by suppliers and buyers, the condition of competitors, and
the likelihood of new market entrants.(
http://www.businessdictionary.com).
4.1 PORTER FIVE FORCES ANALYSIS
Porter five forces analysis is a framework for industry analysis
and business strategy development which draws upon industrial
organization (IO) economics to derive five forces that determine
the competitive intensity and therefore attractiveness of
a market.
10. Threats of new entry
With product differentiation, it is very easy for a new
competitor to open a restaurant and therefore the barriers to
entry are very low.
Threats of substitution
The competitors offer a different slant to providing fast food
but are obviously irritating to gain market share by targeting
children. Companies like McDonalds and Burger King offer
lower prices and toys to children to try to gain customers who
have young children while some others have a broader approach
that includes everyone and will be profitable for many years.
Buyer’s power
Buyer power is very strong since the customers are having
variety of choices when it comes to eating out.
Suppliers’s power
Companies like McDonalds and Burger King rely heavily on
their suppliers to be able to provide their product to the public
and hence supplier power is relatively strong
Ccompetitive rivalry
There is very heavy competition in the fast food industry among
various restaurants and their target markets, which includes
McDonalds, Burger King, Yum Brand, Darden Restaurant,
Starbucks, Brinker International, and Jack in the Box, CBRL
Group, Wendy’s International and Bob Evans Farms.5.
CURRENT SITUATION
The current situation of Singtrix gets discussed in the SWOT
section. It gets noted that, the company stands at a great chance
of becoming one of the best companies in the musical
instrument industry if it improves its marketing strategy. Its
marketing strategy and its limited brands are the main
11. weaknesses of the company. If this issue gets not carefully
reviewed, it might cause the company to drag behind its
competitors. In addition, if the company continues to work with
its limited brands, it might not be able to stand at a competitive
advantage as compared to those others in the industry. In order
to get a new product into the market, Singtrix should ensure that
its marketing strategy is effective. In case a new product gets
accepted into the market, it only means that, the number of
Singtrix brands is increasing in the market. Therefore; the
number of customers will increase, thus; profits.
5.1 Current Business Model
EXISTING MODEL (PLEASE INCERT CANVAS
/GRAPHICAL PRESENTATION OF THE BUSINESS MODEL
OF THE COMPANY). 7.1 MARKETING MIX
The goal of the marketing will be on the basis of the mission
and vision statement of the company, as well as, its short and
long term plans. The ultimate marketing objective of Singtrix is
to successfully introduce a new product into the market with the
hope that it will get accepted. The four features in the
marketing mix are the 4ps, that is, product, price place, and
promotion.
Product
Companies like McDonaldsPrice
Companies like McDonalds
Place
Companies like McDonaldsPromotion
Companies like McDonalds7. KEY ALTERNATIVE
RECOMMENDED
As the process of product, planning can be complex, and in
some cases, the efforts engaged may fail to bring forth expected
results. As a result, it is important that Singtrix LLC
12. incorporate new strategies and strategies for improvement,
which will aid in perfecting product planning. The ultimate
result after incorporating these new strategies will increase the
chances of a successful plan. To do this, Singtrix LLC can opt
to adopt the client-based marketing strategy. This strategy
focuses on the customer and customer satisfaction.
Integrating a market strategy and technology got proven as the
best way of ensuring that marketing strategies used penetrates
the marketing arena. It can, therefore, get done without
compromising on the design elements. The two major ways of
enhancing this is through the use of teamwork, where teams are
sent out there into the market, and out of their experiences, a
marketing strategy can be either improved or maintained. In the
modern world, the two technologies that get used in market
integration are the use of database services, where businesses
can acquire a track and retain its customers. Use of consultancy
services gets also practiced in helping integrate markets.
Test marketing is the kind of marketing where different
marketing designs are rolled out, as a way of identifying which
one works the best for a given product. It involves the use of
pairs of market that get split into control and test groups. It can
get done through evaluating changes to brands that get already
established in the market. Test marketing can be done using
controlled market tests, matched market test and electronic store
tests. Roll out is the initial exhibition or inauguration of a new
product, policy or service. The roll out is scheduled, and how
well it get done determines how the consumers will embrace the
product. Roll out incorporates a number of activities, such as
advertisement, promotions, and marketing (“New Product”,
n.d.).
For decades, company managers all over the global have
insisted on the importance of focusing on the customer, give
13. them good value and better customer satisfaction. In recent
days, aspects such as market share and customer satisfaction
have turned up to be prime aspects. Many organizations not
only check them on a regular basis, but also reward their
workers basing on the measures. However, this focus on
customer lacks one vital component, which is the customer's
value to the organization. A successful customer-based strategy
considers both sides of customer value, which is, the value
offered by the company to the client and the customer's value to
the organization. This strategy recognizes that, offering value to
the client needs marketing investment, and that the organization
must regain the investments. In general, this marketing
approach brings together, the traditional marketing perspective,
in which the customer gets considered as the king, and the
finance perspective, in which cash is the king.
Social network site is web media where one can create a
customer based marketing strategy due to its many users. A
successful Client-Based Marketing Strategy begins by
determining the target market. When developing a client based
marketing strategy in social network site the target market
should be the youths or people aged between sixteen and thirty-
five. It is because this age group is a frequent user of social
sites. It will ensure that; the product's information reaches them
(IOWA State University, n.d.).
The second stage of creating a Client-Based Marketing Strategy
is by building networks. Building networks involves exchanging
services and information among institutions, individuals, and
groups. In a social network site, one should create a company
page where people, institutions or groups can like the page. The
page will act as an informer. Once a person likes the page, he,
or she will be viewing any information related to the company
14. or product. It will serve as a communication platform between
the company and the client. Here the client will be able to
contact the company at any given time and location. Clients can
request or comment on the company's services or products.
The third stage in developing a Client-Based Marketing Strategy
is ensuring that one adheres to proper advertising. It means that,
the product or the service gets well advertised through all types
of media so that clients get well informed of the product. Proper
advertisement ensures that the client is well informed and gets
convinced to use the product.
7.1 PROPOSED BUSINESS MODEL
(PLEASE INCERT CANVAS /GRAPHICAL PRESENTATION
OF THE BUSINESS MODEL OF THE COMPANY)7.2
MARKETING MIX
The goal of the marketing will be on the basis of the mission
and vision statement of the company, as well as, its short and
long term plans. The ultimate marketing objective of Singtrix is
to successfully introduce a new product into the market with the
hope that it will get accepted. The four features in the
marketing mix are the 4ps, that is, product, price place, and
promotion.
Product
There are various techniques that are used to attain a speed in a
new product project. Quality is number one technique of
attaining a speed in a new product project. A product can only
move fast if it is of the best quality offered. It is advisable for
Singtrix LLC to invest more efforts and time on products to get
15. released in the market for quality purposes. Quality on new
products creates a long-term impression of quality on the
customer. Producing quality products that are of different make
or model will bring a new division between the older products
that are produced by the company (Hutchens, 2008).
Price
In order to determine the price of the product, Singtrix needs to
carry out marketing research in order to determine the target
market. Market research is fundamental in setting up or running
a company. The reason behind this is without a doubt, that is, if
a company does not have research done on the targeted market,
and has intelligence on the wants, needs and preferences of the
intended target market for the goods or services that it is
offering, then, the business venture is likely to be unsuccessful.
When Singtrix LLC is introducing a new product, it will need
to identify the targeted group in the market. It will help in
measuring the results of the existing marketing in the market. It
will also help in determining the best price for this group of
individuals.
Place
In order to determine the right place to sell a product, the
company should engage in marketing where people will get
made aware of the product. As a result, the new product will get
sold in almost all regions in the country.
Promotion
16. Promotion is a way of advertising or making known of the
product. Advertising, promotions, and marketing is a technique
that works best in speeding up a new product's projects.
Advertising is done by posting a new product on the internet,
where internet users can see it, by use of media, which are
television, radio, and newspapers and word of mouth.
Promotions are done by offering free samples and price
discounts. Marketing get done through E-marketing that is over
the internet, the use of media and flairs.
When advertising, it is important to be sure of the product being
advertised. One should stick to the core competencies, as
customers want to be sure that one knows what one is talking
about or advertising. Clients want to rely on one's expertise. If
the information given is wrong, one creates doubt in the
customer, thus; making it difficult for the client to have trust on
the product.
Sponsoring events is also a technique used in speeding up a
new product project. By sponsoring events in the community,
offers an advertising foundation to the local people, thus a
showcase of the new product. Most of the event attendees try
and sample the new products, speeding up the sales.
10. IMPLEMENTATION SCHEDULE OR TIME LINE
An action plan developed carries the key steps that should be
considered to make the company’s position better. Along with
this, the business growth and development should be targeted
accordingly. It would ensure that the business conditions should
not be made overlooked at any cost. Under this action plan, the
respective steps are detailed in a proper form. This turns out to
be very much helpful in drawing the most favorable and positive
response. It is highly significant to go for managing conditions
in an effective way (Rosenbloom, 2011). With this, it can also
17. be understood that the business growth would be ascertained.
The action plan would cover the key activities:
The above stated action plan covers up the key activities that
should be considered to help the business to recreate its image
and standing in the market. It comprises of the key activities
that allows the business to come forth with new energy and
positive force. The reestablishment of the marketing strategy
covers up the significant strategies that allow the business to
grow and excel accordingly. Ad campaigns carry the most
influential and leading promotional practices that would help in
making brand awareness successful. The store designs lead to
making the store more convenient and favorable place for the
visitors. Menu change and product quality help in making
offerings top-notch. The remaining activities are evaluation of
the plan, implementation, and control and monitoring. All these
are termed to be very much helpful in making an action plan
successful. At the same time, the company Burger King is
helped to reach the destined level of position (Rosenbloom,
2011).
11. EVALUATION- MEASURES OF EFFECTIVENESS
Since objectives are set by enumerating them, Burger King will
track the performance of the company's marketing
determinations and see if the objectives are being met by the
strategy that is engaged. The company wills controls its
employee for whom the authority and responsibility are
assigned over certain tasks, in order to make sure these tasks
fulfill the its aims and objectives, therefore the company will
either reward them for better performance or continue to
motivate them, or make them to responsible for some faults.
12. CONCLUSION
In conclusion, when developing a client base marketing
strategy, one should be able to meet the promises they give. A
customer-based marketing strategy should be able to meet the
promises given when advertising the product. How closely the
18. actions meet promises helps in gaining and restoring customer
respect and trust. Keeping one's promises may get more vital to
customers than personality, competence, and price. The product
planning process gets summarized as follows
13. REFERENCE
“Consumer behavior”. (2011). Consumer behavior. Retrieved
from http://www-rohan.sdsu.edu/~renglish/370/notes/chapt05/
“New Product.” (n.d.). New Product Planning and development
[Pdf Document]. Retrieved from
http://ipm.ge/article/New%20Product%20Planning%20and%20d
evelopment_ENG.pdf
Hutchens, S.P. (2008). The Marketing Mix and Product.
Retrieved from
https://people.creighton.edu/~shu02225/nps_c_05.html
Singtrix LLC. (2014). Singtrix. Retrieved from
http://www.singtrix.com/
Singtrix LLC