1
Short title: Ethylene- and shade-induced stress escape1
Corresponding authors: Rashmi Sasidharan, Ronald Pierik2
Address: Padualaan 8, 3584 CH, Utrecht, The Netherlands3
Telephone number: +31 30 25368384
Email: r.sasidharan@uu.nl, r.pierik@uu.nl5
6
Ethylene- and shade-induced hypocotyl elongation share transcriptome7
patterns and functional regulators8
Das D.1
, St. Onge K.R.1,2
, Voesenek L.A.C.J.1
, Pierik R.1
* and Sasidharan R.1
*9
*shared senior and corresponding authors10
1
Plant Ecophysiology, Institute of Environmental Biology, Utrecht University, 3584CH Utrecht, The11
Netherlands12
2
Department of Biological Sciences, CW405 BioSci Building, University of Alberta, T6J2E9, Canada13
14
Summary: Ethylene and shade share a conserved set of molecular regulators to15
control plasticity of hypocotyl elongation in Arabidopsis.16
17
AUTHOR CONTRIBUTIONS18
R.P., R.S and L.A.C.J.V. conceived the original research plans and project. R.S.,19
R.P, L.A.C.J.V., K.R.S. supervised the experiments. D.D. performed most of the20
experiments. D.D., K.R.S., R.P. and R.S. designed the experiments. D.D. and21
K.R.S. analyzed the data. D.D. wrote the article with contributions of all the authors.22
FUNDING INFORMATION23
This research was supported by the Netherlands Organisation for Scientific24
Research (grant nos. ALW Ecogenomics 84410004 to L.A.C.J.V., ALW VENI25
86312013 and ALW 82201007 to R.S., ALW VIDI 86412003 to R.P.) and a Utrecht26
University Scholarship to D.D.27
28
CORRESPONDING AUTHOR EMAIL: r.sasidharan@uu.nl, r.pierik@uu.nl29
30
31
32
Plant Physiology Preview. Published on June 21, 2016, as DOI:10.1104/pp.16.00725
Copyright 2016 by the American Society of Plant Biologists
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
2
ABSTRACT33
Plants have evolved shoot elongation mechanisms to escape from diverse34
environmental stresses such as flooding and vegetative shade. The apparent35
similarity in growth responses suggests possible convergence of the signalling36
pathways. Shoot elongation is mediated by passive ethylene accumulating to high37
concentrations in flooded plant organs and by changes in light quality and quantity38
under vegetation shade. Here we study hypocotyl elongation as a proxy for shoot39
elongation and delineated Arabidopsis hypocotyl length kinetics in response to40
ethylene and shade. Based on these kinetics, we further investigated ethylene and41
shade-induced genome-wide gene expression changes in hypocotyls and cotyledons42
separately. Both treatments induced a more extensive transcriptome reconfiguration43
in the hypocotyls compared to the cotyledons. Bioinformatics analyses suggested44
contrasting regulation of growth promotion- and photosynthesis-related genes.45
These analyses also suggested an induction of auxin, brassinosteroid and gibberellin46
signatures and the involvement of several candidate regulators in the elongating47
hypocotyls. Pharmacological and mutant analyses confirmed the functional48
involvement of several of these candidate genes and physiological control points in49
regulating stress-escape responses to different environmental stimuli. We discuss50
how these signaling networks might be integrated and conclude that plants, when51
facing different stresses, utilise a conserved set of transcriptionally regulated genes52
to modulate and fine tune growth.53
54
INTRODUCTION55
All organisms, including plants, assess and respond to both biotic and abiotic factors56
in their environments (Pierik and De Wit, 2014; Pierik and Testerink, 2014; Franklin57
et al., 2011; Quint et al., 2016; Osakabe et al., 2014; Voesenek and Bailey-Serres,58
2015). However, unlike animals, plants, cannot move away from extremes in their59
surrounding environment but rather rely on various plastic morphological and60
metabolic responses. Such response traits include changes in plant architecture to61
escape the stress and optimize resource capture (Pierik and Testerink, 2014;62
Mickelbart et al., 2015). With energy reserves being invested in escape traits, plants63
often have lower plant biomass and crop yield (Casal, 2013). Molecular investigation64
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
3
of the different signalling pathways controlling these traits along with the65
characterization of underlying molecular components would not only enhance66
fundamental knowledge of stress-induced plasticity but also benefit crop67
improvement.68
Plants are highly sensitive to changes in their light environment. Young plants69
growing in a canopy experience changes in light quality and quantity due to70
neighbouring plants and compete to harvest optimum light (Pierik and De Wit, 2014;71
Casal et al., 2013). When a plant cannot outgrow its neighbours, it experiences72
complete vegetation shade (hereafter termed as “shade”) which, in addition to low73
red: far-red (R:FR), is marked by a significant decline in blue light and overall light74
quantity. These changes initiate so-called Shade Avoidance Syndrome (SAS)75
responses consisting of petiole, hypocotyl and stem elongation; reduction of76
cotyledon and leaf expansion; upward movement of leaves (hyponasty), decreased77
branching and increased apical dominance (Vandenbussche et al., 2005; Franklin,78
2008; Casal, 2012; Pierik and De Wit, 2014). Shade-induced elongation comprises a79
complex network of photoreceptor-regulated transcriptional and protein-level80
regulation involving BASIC HELIX LOOP HELIX (BHLH) and HOMEODOMAIN-81
LEUCINE ZIPPER, (HD-ZIP) transcription factors and auxin, gibberellin and82
brassinosteroid hormone genes (Casal, 2012; 2013). Flooding often leads to partial83
or complete submergence of plants. Water severely restricts gas diffusion and the84
consequent limited exchange of O2 and CO2 restricts respiration and photosynthesis.85
Another consequence is the rapid accumulation of the volatile hormone ethylene.86
Ethylene is considered an important regulator of adaptive responses to flooding,87
including accelerated shoot elongation responses that bring leaf tips from the water88
layer into the air (Sasidharan and Voesenek, 2015; Voesenek and Bailey-Serres,89
2015). In deepwater rice, this flooding-induced elongation response involves90
ethylene-mediated induction of members of the group VII Ethylene Response91
Factors (ERF-VII) family, a decline in active abscisic acid (ABA) and consequent92
increase in gibberellic acid (GA) responsiveness and promotion of GA biosynthesis93
(Hattori et al., 2009). In submerged Rumex palustris petioles, ethylene also rapidly94
stimulates cell wall acidification and transcriptional induction of cell wall modification95
proteins to facilitate rapid elongation (Voesenek and Bailey-Serres, 2015). Shade96
cues are reported to enhance ethylene production resulting in shade avoidance97
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
4
phenotypes (Pierik et al., 2004). However, these responses are mediated by98
ethylene concentrations of a much lower magnitude than that occuring in flooded99
plant organs (1µl L-1
) (Sasidharan and Voesenek, 2015).100
So far, it is largely unknown to what extent these growth responses to such highly101
diverse environmental stimuli, share physiological and molecular components102
through time. A preliminary study in R. palustris showed that GA is a common103
regulator of responses to both submergence and shade (Pierik et al. 2005). Although104
submergence is a compound stress, rapid ethylene accumulation is considered an105
early and reliable flooding signal triggering plant adaptive responses. High ethylene106
concentrations as occur within submerged plant organs, promote rapid shoot107
elongation (Voesenek and Bailey-Serres, 2015). This submergence response, which108
has been extensively characterised in rice and Rumex (Hattori et al. 2009; van Veen109
et al., 2013), can be almost completely mimicked by the application of saturating (1µl110
L-1
) ethylene concentrations (Sasidharan and Voesenek, 2015). Saturating ethylene111
concentrations were therefore used here as a submergence mimic. Shade was given112
as true shade which combines the three known key signals that trigger elongation113
(red and blue light depletion with relative far-red enrichment).114
A hypocotyl elongation assay in Arabidopsis thaliana (Col-0) was used as a proxy for115
shoot elongation under ethylene and shade in order to study to what extent ethylene116
and shade responses share molecular signalling components. Although ethylene117
suppresses Arabidopsis hypocotyl elongation in dark, high ethylene concentrations118
in light (as occurs during submergence) stimulate hypocotyl elongation in119
Arabidopsis (Smalle et al., 1997; Zhong et al., 2012). Also upon simulated shade,120
Arabidopsis demonstrates pronounced hypocotyl elongation (Morelli and Ruberti,121
2000). To capture early physiological responses and gene expression changes in122
response to ethylene and shade, Arabidopsis seedling hypocotyl elongation and123
cotyledon expansion were examined over time. The two treatments elicited124
characteristic hypocotyl growth kinetics. To uncover the transcriptomic changes125
regulating the elongation response to these signals, an organ-specific genome-wide126
investigation was carried out on hypocotyls and cotyledons separately at three time-127
points corresponding to distinct hypocotyl elongation phases. Clustering analyses in128
combination with biological-enrichment tests allowed identification of gene clusters129
with expression patterns matching the hypocotyl growth trends across the three time-130
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
5
points in both the treatments. Correlation of genome-wide hypocotyl and cotyledon-131
specific transcriptomic changes to publicly available microarray data on hormone132
treatments identified enriched hormonal signatures of auxin, brassinosteroid and133
gibberellin in hypocotyl tissues and several potential growth regulatory candidate134
genes. Using hormone mutants and chemical inhibitors, we confirmed the combined135
involvement of these hormones and candidate regulators in the hypocotyl elongation136
response to ethylene and shade. We suggest that growth responses to diverse137
environmental stimuli like ethylene and shade converge on a common regulatory138
module consisting of both positive and negative regulatory proteins that interact with139
a hormonal triad to achieve a controlled fine-tuned growth response.140
141
142
RESULTS143
Delineation of hypocotyl elongation kinetics under ethylene and shade in144
Arabidopsis seedlings145
Exogenous application of ethylene (1 µl L-1
) in light-grown seedlings resulted in thick,146
yet elongated hypocotyls and smaller cotyledons as compared to untreated controls.147
Shade, achieved by the use of a green filter, stimulated strong hypocotyl elongation148
in seedlings but resulted in mildly smaller cotyledons compared to controls (Fig. 1A).149
Hypocotyl length increments in the two treatments relative to control were around 2-150
fold under ethylene and greater than 3-fold under shade (Figs. 1, A and B). For both151
treatments growth stimulation was strongest in the first two days of treatment (Fig.152
1C) and faded out in the subsequent days. When combined, shade and ethylene153
exposure resulted in hypocotyl lengths that were intermediate to the individual154
treatments (Supplemental Fig. S1).155
To get a more detailed time-line of the early elongation kinetics, we performed a156
follow-up experiment with 3 h measurement intervals for the first 33 h (Fig. 1D).157
Ethylene-mediated stimulation of hypocotyl elongation started only in the middle of158
the dark period after 15 h. However, under shade, longer hypocotyls were recorded159
already after 3 h and this rapid stimulation continued until the start of the dark period.160
Interestingly, accelerated elongation was again observed at around 24 h after the161
start of the treatments (when the lights were switched on). Based on this time-line,162
we determined epidermal cell lengths at time-points 0, 3, 7.5, 15 and 27 h (Gendreau163
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
6
et al., 1997; Fig. 1E), the latter four of which are either prior to start of accelerated164
growth or during it in response to ethylene and shade. The rapid stimulation of165
elongation under shade starts at the base of the hypocotyl (3 h) and then progresses166
all along the hypocotyl with maximum elongation occurring in the middle segment167
while under ethylene accelerated elongation is observed at the middle-bottom of168
hypocotyl (27 h).169
170
Organ-specific transcriptomics in hypocotyl and cotyledon under ethylene and171
shade172
The transcriptome response to ethylene and shade in hypocotyl and cotyledon173
tissues was characterised using Affymetrix Arabidopsis Gene 1.1 ST arrays at three174
time points of hypocotyl length kinetics (1.5 h, 13.5 h and 25.5 h) (Fig. 1D). Principal175
component analysis (PCA) (Abdi and Williams, 2010) of all replicate samples for176
hypocotyl and cotyledon exposed to control, ethylene or shade conditions showed177
that replicate samples generally clustered together (Fig. 2A). The first principal178
component (34.2%) separates tissue-specific samples, whereas the second principal179
component (13.0%) showed separate clustering of the 13.5h samples which falls180
during the dark period.181
Hierarchical clustering (HC) (Eisen et al., 1998) of mean absolute expression182
intensities for the different main samples (combination of 3 replicates) revealed183
similar trends (Fig. 2B). Fig. 2C shows the distribution of up- and down-regulated184
differentially expressed genes (DEGs) (genes with adjusted p-value ≤ 0.01) in185
hypocotyl and cotyledon for ethylene and shade at the three harvest time points 1.5186
h, 13.5 h, 25.5 h respectively. In both the conditions and tissues, the number of both187
up- and down-regulated DEGs increased with time. Ethylene regulated substantially188
more DEGs in the hypocotyl as compared to shade at all harvest time points (Fig.189
2C). Data analysis identified 6668 and 4741 genes (hereafter termed as “total190
DEGs”) that were differentially expressed in hypocotyl at one or more of the three191
tissue harvest time points by ethylene and shade respectively. Interestingly, in the192
cotyledon, at 1.5 h, the number of significant DEGs under ethylene was higher than193
under shade but at the subsequent two time points, shade regulated more genes. In194
the cotyledon, 1197 and 2173 DEGs were identified that were differentially195
expressed at one or more of the three tissue harvest time points by ethylene and196
shade respectively.197
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
7
Interestingly, at 1.5 h, there was more transcriptional regulation in ethylene- than198
shade-exposed hypocotyls even though subsequent hypocotyl elongation was much199
more rapid in shade (Figs. 2C and 1D). For ethylene-specific downregulated DEGs200
at 1.5 h, the topmost enriched GO term was cell wall organization (containing 30201
genes), which suggested a repression of growth-promoting genes and possible lack202
of ethylene-mediated elongation at 1.5 h (Supplemental Fig. S2). We also found 6203
genes (AT1G65310, XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE204
17 (XTH17); AT5G23870, pectin acetyl esterase; AT3G06770, glycoside hydrolase;205
AT5G46240, POTASSIUM CHANNEL IN ARABIDOPSIS THALIANA 1 (KAT1);206
AT1G29460, SMALL AUXIN UPREGULATED RNA 65 (SAUR65) and AT3G02170,207
LONGIFOLIA 2 (LNG2)) in the shade-specific upregulated 32 genes at 1.5 h, with208
implied cell expansion roles and could possibly be associated with the rapid209
elongation response (Sasidharan et al., 2010; Philippar et al., 2004; Nozue et al.,210
2015; Chae et al., 2012; Lee et al., 2006).211
212
Different gene expression clusters contributing to hypocotyl growth in213
ethylene and shade214
In order to find specific genes regulating the elongation phenotype under both215
treatments, we used temporal clustering of DEGs based on expression values. Due216
to distinct hypocotyl length kinetics in response to ethylene and shade (Fig. 1D), we217
searched for a set of temporally co-expressed genes that could potentially contribute218
to this treatment-specific kinetics. Time-point based clustering was performed for the219
6668 ethylene and 4741 shade total DEGs based on the positive or negative220
magnitude of log2FC for DEGs at the three time points (Fig. 3, A and D). The gene221
expression patterns in clusters-1 and 5 across the three time points matched the222
ethylene hypocotyl growth kinetics closely (Fig. 3, B and C). Similarly, gene223
expression kinetics in clusters-1 and 3 matched the hypocotyl length kinetics in224
shade (Fig. 3, E and F). These growth pattern matching clusters were termed225
“positive”. All the clusters with mirror image of gene expression profiles to that of the226
positive clusters (clusters-8 and 4 in ethylene and clusters-8 and 6 in shade) were227
termed as “negative” clusters.228
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
8
Next, a hypergeometric over-representation test for selected MapMan bins (“stress”,229
“hormone”, “signalling”, “RNA.Regulation of transcription” and “cell wall”) was carried230
out for the temporal gene clusters (Fig. 3G). Interestingly, “cell wall”, “hormone” and231
“signalling” were highly co-enriched in positive clusters (cluster-1 and 5 for ethylene232
and cluster-1 for shade) which hints at co-regulation of genes mapped to these terms233
during transcriptomic response to ethylene and shade in the hypocotyl.234
To identify growth promotion related DEGs, we identified DEGs common to both the235
treatments in the clusters previously designated as ‘positive’ and ‘negative’ clusters236
(Fig. 3, H and I). 997 DEGs were obtained from a venn diagram between the237
treatment-specific positive clusters, upregulated at atleast two time-points, and238
hereafter called “Common Up”. Similarly, 824 DEGs were shared between ethylene239
and shade negative clusters, were downregulated at atleast two time points and240
hereafter called “Common Down”.241
Enriched functional categories in the different gene sets from Venn diagrams of242
positive and negative clusters, were identified using the GeneCodis tool (Tabas-243
Madrid et al., 2012) (Fig. 4). In the Common Up set, we found a variety of growth244
associated GO categories including cell wall modification, hormone (auxin and245
brassinosteroid) signaling and metabolism, transport processes, tropisms, response246
to abiotic stimuli and signal transduction. The ethylene-specific set for positive247
clusters was enriched for ethylene-associated terms as expected, but also for248
various sugar metabolic, endoplasmic reticulum (ER)-related and protein post-249
translational modification-related processes. Some of the enriched GO terms in the250
ethylene-specific set for positive clusters were also found in the Common Up set, but251
caused by different genes in the same GO category, including those associated with252
growth, hormones and transport processes. The shade-specific set for positive253
clusters showed only few clear GO enrichments such as trehalose metabolism,254
secondary cell wall biogenesis and amino acid metabolism, but also shared some255
with the Common Up set like shade avoidance and protein phosphorylation and with256
both Common Up and ethylene-specific set for positive clusters, such as response to257
auxin and unidimensional growth.258
In the Common Down set, GO terms associated with photosynthesis, primary and259
secondary metabolism, response to biotic and abiotic stress, as well as260
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
9
photomorphogenesis were enriched. The latter is striking given that ethylene does261
not alter the light environment. The ethylene-specific set for negative clusters262
included strong enrichment of circadian rhythm and a variety of photosynthesis-and263
chloroplast-associated GO terms, partially shared with the Common Down set. In the264
shade-specific set for negative clusters, flavonoid/anthocyanin biosynthesis and265
response to UV-B and heat were enriched. The shade-specific set for negative266
clusters shared terms from defence-associated GO categories and cadmium, karrikin267
response with Common Down set. Terms common to all three sets of negative268
clusters were related to photomorphogenesis and metabolic process.269
270
Functional characterization: shared components in ethylene -and shade-271
mediated regulation of hypocotyl length272
We classified Common Up and Down set genes into transcriptional regulators,273
hormone metabolism genes, signalling genes and cell wall genes and also applied a274
logFC filter (see “Materials and Methods” sub-section “LogFC Filter and Gene275
Classification”) to obtain a final list of 53 and 8 genes in the two sets respectively276
(Fig. 5, A and B). We selected a subset of candidate regulators for functional testing277
and made sure to include two transcription factors since these may be relatively278
upstream in the convergence of signaling pathways. Obvious targets for these279
regulators would be different plant hormones, and before zooming in on these, we280
ran a hormonometer analysis with our transcriptome data to further subset our281
candidate regulators.282
283
Transcription factor candidates:284
ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 28 (ATHB28) is a zinc-finger285
homeodomain (ZF-HD) transcription factor that showed upto 2-fold induction in the286
hypocotyls in ethylene and shade respectively. A homozygous null mutant287
(Supplemental Fig. S3, A-D), “athb28”, showed a significant reduction in hypocotyl288
lengths under both ethylene and shade (Fig. 6A), consistent with its induction upon289
both the treatments.290
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
10
Both shade and ethylene also significantly induced transcript levels of the bHLH291
transcription factor INCREASED LEAF INCLINATION1 BINDING bHLH1 like-1292
(IBL1) Arabidopsis hypocotyls. However, the ibl1 (SALK T-DNA insertion line)293
showed wild-type responses to the treatments (Fig. 6B). The bHLH transcription294
factors IBL1 and its homolog IBH1 have been implicated in repressing BR-mediated295
cellular elongation. In an ibl1 mutant, IBH1 is still present and may negatively296
regulate cell elongation independently of IBL1. The 35S overexpression line, IBL1OE297
(Zhiponova et al., 2014), had shorter hypocotyls than the wild-type under control298
conditions. IBL1OE also lacked ethylene and shade-induced hypocotyl elongation299
implying an inhibitory role for IBL1 (Fig. 6C).300
301
Hormone candidates: auxin, brassinosteroid and gibberellin302
To further investigate the significant hormone related changes amongst the growth303
related DEGs we analysed our data using Hormonometer (Volodarsky et al., 2009).304
For both treatments, the hormonal signatures across the three time-points for BR305
and GA most closely matched the hypocotyl elongation kinetics (Figs. 1D and 7A).306
The analysis also showed significant correlations with auxin responses for all data307
sets.308
In the Common Up set 49 genes were present that were all also auxin-regulated,309
whereas there were 14 that were also BR-regulated. In the Common Down set 16310
genes were present that can be regulated by auxin, 16 that can also be ABA-311
regulated and 13 genes that are also JA-regulated. Interestingly, there were no312
genes for BR in the Common Down set. In addition, genes involved in auxin-313
conjugation genes (GRETCHEN HAGEN 3 FAMILY PROTEIN 3.17 (GH3.17) and314
AT5G13370), GA catabolising genes (GIBBERELLIN 2 OXIDASE (GA2OX) 2,315
GA2OX4 and GA2OX7) and JA augmenting genes (LIPOXYGENASE (LOX) 1,316
LOX2 and LOX3) were down-regulated.317
In order to test the possible role of auxin, GA and BR, in mediating shade and318
ethylene-induced hypocotyl elongation, we first tested the effects of pharmacological319
inhibitors of these hormones on shade and ethylene-induced hypocotyl elongation.320
To visualize the auxin effect we treated the pIAA19:GUS auxin response marker line321
with the auxin transport inhibitor, 1-N-Naphthylphthalamic acid (NPA). As shown in322
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
11
Fig. 7B, application of NPA (25 µM) inhibited hypocotyl elongation and also strongly323
reduced staining in the hypocotyl region. This inhibition was rescued by IAA (10 µM).324
The auxin perception inhibitor, α-(phenylethyl-2-one)-indole-3-acetic acid, PEO-IAA325
(100 µM), strongly reduced staining in the whole pIAA19:GUS seedling and inhibited326
elongation in response to both treatments. The significant inhibition of ethylene and327
shade-induced hypocotyl elongation by the different auxin inhibitors is quantitated in328
Fig. 7,C-E. The addition of NPA, yucasin (auxin biosynthesis inhibitor) and α-329
(phenylethyl-2-one)-indole-3-acetic acid (PEO-IAA; auxin antagonist) inhibited330
hypocotyl elongation under both the treatments confirming that all three aspects of331
auxin are required for ethylene- and shade-induced hypocotyl elongation. BR332
biosynthesis inhibitor brassinazole (BRZ) and GA biosynthesis inhibitor paclobutrazol333
(PBZ) fully inhibited these elongation responses as well (Fig. 7, F and G).334
To further validate the involvement of auxin, BR and GA in ethylene and shade-335
induced hypocotyl elongation we tested hypocotyl elongation responses in a variety336
of hormone mutants, including mutants for candidate genes from Figure 5.337
Both the auxin receptor (tir1-1) and biosynthesis (wei8-1) mutants showed338
significantly impaired hypocotyl elongation responses compared to the wild type339
ethylene and shade response (Fig. 8, A and B). A similar effect was seen in the340
auxin transport mutant pin3pin4pin7 which had severely reduced hypocotyl341
elongation in both treatments (Fig. 8C).342
The GA biosynthesis (ga1-3) and insensitive (gai) mutant both showed a complete343
lack of hypocotyl elongation in both treatments (Fig. 8, D and E). We also tested the344
GA biosynthesis mutant ga20ox1-3, since it was identified as a ‘common Up’ gene,345
induced in response to both treatments (Fig. 5A). The ga20ox1-3 mutant showed a346
significantly reduced elongation phenotype in both treatments compared to the wild347
type response (Fig. 8F).348
The BR receptor (bri1-116) and biosynthesis (dwf4-1) mutants both showed severe349
hypocotyl elongation phenotypes, and did not respond to either treatment (Fig. 8, G350
and I). In another biosynthesis mutant, rot3-1, while the ethylene elongation351
response was absent there was a severely reduced shade response (Fig. 8H). Two352
BR-metabolism related genes were identified in the common Up set (Fig. 5A):353
BR6OX1 and BAS1. The bas1-2 mutant showed constitutive elongation in all354
treatments ((Fig. 8J) confirming a negative role of BR catabolism through BAS1 in355
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
12
hypocotyl elongation control. Although the BR biosynthetic mutant br6ox1 (cyp85a1-356
2) mutant did not show any phenotypic alteration (Fig. 8K), a double mutant of357
BR6OX1 and BR6OX2 (cyp85a1cyp85a2) showed a complete lack of elongation in358
response to both ethylene and shade (Fig. 8L).359
360
361
Discussion362
Accelerated shoot elongation is a common mode of stress escape that allows plants363
to grow away from stressful conditions (Pierik and Testerink, 2014). Stress escape364
does, however, come at an energetic cost and is only beneficial if improved365
conditions are achieved. Here our goal was to establish to what extent shade and366
ethylene elicit similar responses through shared or distinct molecular pathways. In367
our study we found distinct elongation kinetics in ethylene and shade for Arabidopsis368
hypocotyls, differing in both temporal regulation and the degree of response. Shade369
treatment evoked a rapid, strong and persisting hypocotyl elongation, whereas370
ethylene initially inhibited elongation and only in the first night period started to371
promote hypocotyl length (Fig. 1). In both treatments, hypocotyl growth involved372
enhanced epidermal cell elongation. Previous studies have shown that low R:FR373
induces ethylene biosynthesis in Arabidopsis (Pierik et al., 2009) and it could be374
argued that the shade response might act through ethylene. However, ethylene375
marker genes were not induced in shade, and the ethylene-insensitive ein3eil1376
mutant retained a full response to shade (Supplemental Fig. S4), ruling out a role for377
ethylene in the shade response. Interestingly, combining shade and ethylene378
treatments did not lead to an additive response and instead dampened shade-379
induced hypocotyl elongation (Supplemental Fig. S1). The growth inhibitory effect of380
ethylene under shaded conditions could function similar to its effects in limiting381
hypocotyl elongation in the dark i.e. via induction of negative growth regulators such382
as ERF1 (Zhong et al., 2012). Transcriptome characterisation of the elongating383
hypocotyl upon exposure to single shade and ethylene stresses indicated384
considerable overlap between the two treatments. Thus, a large portion of DEGs385
under both treatments may contribute to similar processes implying that they target386
shared genetic components but have treatment-specific upstream regulatory factors.387
388
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
13
Hypocotyl growth promotion and photosynthesis repression occur389
concurrently under ethylene and shade390
By identifying gene clusters with expression patterns closely matching the distinct391
ethylene and shade growth kinetics, we identified positive and negative clusters for392
the respective treatments. These clusters were also among the bigger clusters that393
contributed to most of the transcriptomic changes, suggesting that a large part of394
transcriptomic response are associated with the hypocotyl growth and concurrent395
biological processes. Functional enrichment analysis for the Common Up set (shared396
between positive clusters of ethylene and shade) (Fig. 4), suggested an involvement397
of growth promoting genes. Cell wall genes are all involved in mediating cellular398
expansion in growing hypocotyls. However, they need to be controlled by either the399
environmental signal directly or by upstream factors in the signal transduction400
pathway. The Common Down set (shared between negative clusters of ethylene and401
shade) (Fig. 4), was highly enriched in photosynthesis-related terms and proteins.402
The effects of ethylene on photosynthesis can be positive or negative depending on403
the context (Iqbal et al., 2012; Tholen et al., 2007). Low R:FR treated stems of404
tomato showed reduced expression of photosynthetic genes (Cagnola et al., 2012).405
This reduction was mainly due to a decrease in expression of Calvin cycle genes,406
which we also observed for our Common Down set (Supplemental Table S1). In407
addition, under ethylene specifically, Photosystem II and I genes were mostly408
repressed. Thus acceleration of hypocotyl elongation is accompanied by repression409
of genes associated with non-elongation processes like metabolism and410
photosynthesis. This was also shown to be true for low R:FR treated elongating411
stems of tomato (Cagnola et al., 2012). Light capture and carbon fixation are412
minimized and energy is apparently invested in stimulating growth (Sulpice et al.,413
2014; Henriques et al., 2014; Lilley et al., 2012). It would be interesting to investigate414
how photomorphogenic responses are associated with and influence photosynthesis415
and growth promotion.416
417
Convergence of signaling pathways in response to ethylene and shade in418
control of hypocotyl elongation419
In shade avoidance responses, photoreceptors like phyB and cry1/2 would regulate420
the elongation phenotype via control of Phytochrome Interacting Factor (PIF) levels.421
However, since these are photoreceptors, it seems unlikely that these proteins422
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
14
themselves would integrate information from the ethylene pathway as well (Park et423
al., 2012; Li et al., 2012). It was shown by van Veen et al. (2013), that in the424
submerged petioles of R. palustris (which displays petiole elongation under complete425
submergence), early molecular components of light signalling (KIDARI, COP1, PIFs,426
HD-ZIP IIs) are induced by ethylene independently of any change in light quality.427
Over expression of PIF5 on the other hand leads to increased ethylene production in428
etiolated Arabidopsis seedlings, causing inhibition of hypocotyl length (Khanna et al.,429
2007). Interestingly, the downstream ethylene signal transduction protein EIN3 was430
shown to physically interact with PIF3 (Zhong et al., 2012). We, therefore, suggest431
that ethylene and shade might both induce this shared gene pool by, for example,432
targeting (different) members of the PIF family of transcription factors. Since different433
PIFs likely regulate the expression of at least partly shared target genes (Leivar and434
Monte, 2014), this would explain our observed partial overlap in the transcriptional435
response to shade and ethylene. PIFs are also known to directly bind and regulate436
expression of other transcription factors like homeodomain (HD) TFs (Capella et al.,437
2015; Kunihiro et al. 2011) in the control of shade avoidance responses. Indeed, our438
TAIR motif analysis hinted towards the presence of significantly enriched binding439
signatures of PIF/MYC proteins (CACATG) as well as HD proteins (TAATTA) in the440
upstream promoter sequences of the Common Up set genes (Pfeiffer et al., 2014;441
Kazan and Manners, 2013; Supplemental Fig. S5).442
Several potential transcriptional regulators were identified in the narrowed down443
Common Up gene set. A growth-promoting role of KIDARI in regulating elongation in444
response to shade and ethylene was suggested previously (Hyun and Lee 2006; van445
Veen et al., 2013). Upregulation of another bHLH encoding gene and a negative446
regulator of elongation, IBL1 was observed for both treatments (Fig. 6C)). While447
PIF4 induces IBH1 and IBL1, IBH1 represses PIF4 targets (Zhiponova et al., 2014).448
IBH1 and its homolog IBL1 collectively regulate expression of a large number of BR-,449
GA- and PIF4-regulated genes and this might their mode of action in shade- and450
ethylene-induced hypocotyl elongation. In addition to these bHLH proteins, we show451
that the ZF-HD transcription factor ATHB28 is also involved in regulating hypocotyl452
elongation under ethylene and shade (Fig. 6A). Hong et al. (2011) showed that453
another ZF-HD protein, MIF1 interacts strongly with four other ZF-HD proteins454
including ATHB33 and ATHB28. This leads to non-functional MIF1-ATHB455
heterodimers and inhibition of e.g. ATHB33-regulated expression and growth456
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
15
promotion. Transcriptomics data for 35S:MIF1 (displaying short hypocotyl457
phenotype), shows downregulation of auxin, BR and GA responsive genes and458
upregulation of ABA genes (Hu and Ma, 2006). We can speculate that MIF1 on one459
hand and ATHB33 and ATHB28 on the other hand, might target the same set of460
hormone genes, but in an opposite manner, to control growth. What remains to be461
studied is how ethylene and shade regulate ZF-HD transcription factors and this will462
be an important topic for future studies.463
Well-established targets for above-mentioned PIFs and HD TFs are various aspects464
of auxin signalling and homeostasis, such as YUCCA biosynthetic enzymes and465
AUX/IAA proteins for signalling (Kunihiro et al. 2011; Li et al., 2012; Sun et al., 2012;466
De Smet et al., 2013). Our list of candidate genes (Fig. 5) contained auxin-467
responsive transcriptional regulator IAA3 and many of the auxin-responsive SAUR468
genes which have been shown to positively modulate hypocotyl elongation (Kim et469
al., 1998; Sun et al., 2012; Chae et al., 2012; Spartz et al., 2012) and may act470
individually or in concert to regulate the phenotype. With reference to elongation471
responses under shade in Arabidopsis seedlings, auxin seems to play a major role.472
An increase in free auxin levels and its transport towards epidermal cells in hypocotyl473
is necessary for low R:FR-mediated hypocotyl elongation (Tao et al., 2008;474
Keuskamp et al., 2010; Zheng et al., 2016). The importance of YUCCAs and TAA1 in475
low R:FR responses has been previously demonstrated (Li et al., 2012). It is476
generally assumed that auxin synthesized in the cotyledons is required to regulate477
hypocotyl elongation in response to e.g. low R:FR light conditions (Procko et al.478
2014). Indeed, cotyledons are key regulators of hypocotyl elongation in a479
phytochrome-dependent way (Endo et al., 2005; Warnasooriya and Montgomery,480
2009; Estelle, 1998; Tanaka et al., 2002). In our data, hormonometer analysis481
identified strong induction of auxin-associated genes in the cotyledons in both482
treatments (Fig. 7). We speculate that the physiological regulation of hypocotyl483
elongation in our study depends on cotyledons via auxin dynamics. However, we484
also show that auxin is certainly not the only shared physiological regulator between485
the ethylene and shade response.486
GA20OX1 and BR6OX1 expression were up-regulated in patterns that closely487
matched the hypocotyl elongation profiles (Fig. 5A), and hormonometer analysis also488
revealed enrichment of GA and BR hormonal signatures in ethylene and shade489
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
16
exposed hypocotyls. (Fig. 7). The positive role of GA in flooding-associated shoot490
elongation (Voesenek and Bailey-Serres, 2015) and shade avoidance (Djakovic-491
Petrovic et al., 2007) is well established. It is well known that GA20OX1 specifically492
affects plant height without having any other major phenotypic effects (Barboza et493
al., 2013; Rieu et al., 2008), and it has been shown to be involved in shade494
avoidance (Nozue et al. 2015; Hisamatsu et al. 2005). In our data, ga20ox1 knockout495
showed reduced elongation to shade as well as ethylene, extending its function from496
controlling shade avoidance to ethylene mediated elongation responses (Fig. 8F).497
GA biosynthesis via GA20OX1 can be induced by brassinosteroids, suggesting a498
possible cross-talk between the two growth-promoting hormones (Unterholzner et499
al., 2015). Although future studies are needed to establish if this crosstalk occurs500
under the conditions tested here, we do confirm that BR is an important hormone501
involved in both the responses since several BR mutants showed disturbed502
elongation responses to ethylene and shade (Fig. 8G-8L). Interestingly, also auxin503
and brassinosteroids have partially overlapping roles in hypocotyl elongation control504
(Chapman et al., 2012; Nemhauser et al., 2004), further extending the crosstalk505
towards a tripartite network. Among the BR mutants tested is the cyp85a1cyp85a2506
mutant, encoding a double mutant for BR6OX2 and BR6OX1 which showed a507
complete lack of elongation to both treatments (Fig. 8L) similar to a BRZ treatment508
(Figs. 7F). BR6OX1 was one of the direct candidate genes identified from the509
transcriptomics analysis (Figure 5A). A tripartite bHLH transcription factor module510
consisting of IBH1, PRE and HBI1, has been previously implicated in regulating cell511
elongation in response to hormonal and environmental signals (Bai et al., 2012).512
Several BR biosynthesis and signaling genes are direct targets of HBI1, including513
BR6OX1 (Fan et al. 2014), indicating the possible involvement of this bHLH514
regulatory module in promoting BR responses during shade and ethylene exposure.515
Why is there be such an elaborate network of regulators and even hormones516
involved in controlling unidrectional cell expansion in hypocotyl growth responses?517
To achieve a controlled growth, feedback loops are likely required, and crosstalk518
between different routes are probably a necessity to deal with multiple environmental519
inputs simultaneously. We found BAS1 transcriptional upregulation in hypocotyls in520
response to ethylene and shade. BAS1 may act to balance the hypocotyl growth521
promotion mediated by brassinosteroids (castasterone (CS) and brassinolide (BL))522
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
17
as it inactivates both CS and BL (Neff et al., 1999; Turk et al., 2005). In shade523
avoidance research, likewise, HFR1 is induced by PIFs to suppress the growth524
promotion induced the same PIF proteins, and putative control of DELLAs would525
modulate GA responses.526
Conclusion527
Hypocotyl elongation in response to ethylene and shade treatments is likely528
regulated at the upstream level by (a) a bHLH module consisting of positive growth529
regulators, PIFs (PIF3 in ethylene and PIF4 and PIF5 in shade) and inhibitory factors530
like IBL1 and (b) a homeodomain module, where ZF-HD TFs like ATHB28 may531
either act in parallel to the bHLH TFs or are regulated by PIFs (similar to induction of532
HD-ZIP TFs) to transcriptionally target genes related to the growth promoting533
hormone module (auxin, BR and GA), as hinted by promoter motif analysis. We534
hypothesize that in Arabidopsis seedlings, shade and ethylene stimulate auxin535
synthesis in the cotyledons, which is then transported to the hypocotyl to epidermal536
cell layers where it interacts with both GA and BR to co-ordinately induce hypocotyl537
elongation. This increased auxin response, indicated by elevated SAUR levels, and538
likely increased levels of GA and BR as indicated by increased GA20OX1 and539
BR6OX expression in the hypocotyl, likely act to induce unidirectional epidermal cell540
wall elongation via upregulation of genes encoding cell-wall modifying proteins,541
which promote cellular expansion leading to hypocotyl elongation.542
543
MATERIALS AND METHODS544
Plant Material and Growth Conditions545
Around 30 Arabidopsis thaliana (Col-0) and mutant seeds were sown per agar plate546
containing 1.1 g L-1
Murashige-Skoog (1/4 MS) and 8 g L-1
Plant-agar (0.8%w/v)547
(both Duchefa Biochemie, The Netherlands). Mutants or overexpression lines used548
in this work were: pin3pin4pin7 (Blilou et al., 2005); wei8-1 (Stepanova et al., 2008),549
tir1-1 (Ruegger et al., 1998), dwf4-1 (Azpiroz et al., 1998), rot3-1 (Kim et al., 1998),550
ga1-3 (Wilson et al., 1992), gai (Talon et al., 1990), ein3eil1 (Binder et al., 2004);551
bri1-116 (van Esse et al., 2012); ibl1 and IBL1OE (Zhiponova et al., 2014);552
cyp85a1/cyp85a2 and cyp85a1-2 (Nomura et al., 2005); bas1-2 (Turk et al., 2005);553
ga20ox1-3 (Hisamatsu et al., 2005).554
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
18
ibl1 (N657437), cyp85a1 (N681535), wei8-1 (N16407) and ga20ox1-3 (N669422)555
were obtained from NASC seed-stock centre; bri1-116 was kindly provided by Sacco556
de Vries Lab, Wageningen University while cyp85a1/cyp85a2 and dwf4-1 were557
kindly provided by Sunghwa Choe Lab, Seoul National University. IBL1OE558
overexpression lines were kindly provided by the Jenny Russinova lab (VIB Ghent,559
Belgium). bas1-2 mutant was kindly provided by Michael Neff lab (Washington State560
University, USA). Some GA mutants used were in the Ler background. All other561
mutants were in the Col-0 background. After stratification at 4°C for 3 d in the dark,562
seeds were transferred for 2 h to control light conditions (see below) and then kept in563
dark (at 20°C) again for another 15 h. Subsequently seedlings were allowed a period564
of 24 h growth under control light conditions in Short-Day photoperiod conditions (15565
h dark/9h light) before being transferred to 22.4 L glass desiccators with air-tight lids566
for specific treatments. Col-0 genotypes were grown at 21 ± 1 °C. Ler genotypes567
were grown at 19 ± 1 °C (Supplemental Figure S6).568
For athb28 (GK-326G12), lines were obtained from NASC (UK). Genotyping was569
performed using the following primers: for athb28, athb28_fwd570
(CTAAGTACCGGGAATGTCAGAAG); athb28_rev (TAACCAACTGAGCTATTCC571
AGCTA) and LB primer o8474: (ATAATAACGCTG CGGA CATCTACATTTT). For572
verifying transcript levels, ATHB28_fwd (GGAGAAGATGAAGGAATTTGCA) and573
ATHB28_rev (TGTTTCTCTTCA TTGCTTGCT) were used.574
575
Treatments576
Control and ethylene desiccators were kept in control light conditions577
(Photosynthetically Active Radiation, PAR = 140 μmol m-2
s-1
, blue light (400 nm-500578
nm) = 29 μmol m-2
s-1
and R:FR = 2.1). Ethylene treatments were started by injecting579
ethylene into the desiccators (with 1 µl L-1
final concentration in the dessicator) and580
levels were verified with a Gas Chromatograph (GC955; Synspec, The Netherlands).581
Shade treatment was started by putting desiccators under a single layer of Lee Fern582
Green Filter (Lee Hampshire, UK) (PAR = 40 μmol m-2
s-1
, blue light (400 nm-500583
nm) = 3 μmol m-2
s-1
and R:FR = 0.45). For growth curve experiments, two plates584
with 15 seedlings per treatment per genotype distributed over two desiccators were585
used. For mutant analyses, one plate with 15 seedlings per treatment per genotype586
was used.587
588
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
19
Imaging and Hypocotyl Length Measurements589
For hypocotyl elongation assays, experiments were replicated twice. Seedling plates590
were collected from the dessicators. Seedlings were flattened on the agar plates to591
reveal the full extent of their hypocotyl, and images of the seedlings were obtained592
by scanning the plates using EPSON Perfection v370 Photo scanner (Epson Europe593
BV, The Netherlands). Hypocotyl lengths were measured from these images using594
ImageJ (http://rsbweb.nih.gov/ij/) and values (per data point) were obtained for n ≥595
30-60 seedlings. Final values for the data was obtained by taking mean ± S.E. for596
values from the two independent experiments.597
598
Epidermal Cell Length Measurements599
Seedlings were mounted on microscopic slides and covered with a cover slip.600
Hypocotyl epidermal cells were imaged using Olympus AX70 (20x objective, Nikon601
DXM1200 camera), after which cell lengths were measured using ImageJ software602
tool (http://rsbweb.nih.gov/ij/).603
604
Microarray Tissue Harvest, RNA Isolation and Array Hybridization605
Seedlings were dissected using BD PrecisionGlide Hypodermic 27 Gauge 1 1/4"606
Grey Needle with outer diameter = 0.41 mm (Becton Dickinson B.V., The607
Netherlands) to separately harvest the hypocotyl and cotyledon + shoot apical608
meristem (hereafter termed “cotyledon”). The roots were discarded. Samples were609
harvested at 1.5 h, 13.5 h and 25.5 h after the start of the treatments. For 13.5 h time610
point, which occurs during the dark period, dissection was carried out under low611
intensity green safelight (≈ 5 μmol m-2
s-1
). For minimizing the effects of green light612
on gene expression, seedlings were kept in the dark until dissected and dissection613
was carried out in several rounds with each round involving maximum 2-3 seedlings.614
In total, 3 replicate experiments were carried out. In each replicate experiment,615
tissues were harvested from two independent technical replicates (each with 25616
seedlings from the two technical replicate plates as mentioned in “Treatments”617
section above). Harvested material was immediately frozen in liquid nitrogen and618
stored at -80°C until further use.619
Frozen tissue was ground using tissue lyser and total RNA was isolated using620
RNeasy Mini Kit (QIAGEN, Germany). QIAGEN RNase-Free DNase set was used to621
eliminate Genomic DNA contamination by performing on-column DNase digestion.622
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
20
Extracted RNA was verified (for quality check) and quantified using NanoDropTM
ND-623
1000 Spectrophotometer (Isogen Life Science, De Meern, The Netherlands).624
RNA samples were sent to AROS (AROS Applied Biotechnology A/S, Aarhus,625
Denmark). RNA was repurified on low-elution QIAGEN RNeasy columns, re-626
quantified with NanoDropTM
8000 UV-Vis Spectrophotometer and checked for quality627
with Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA samples628
with RNA Integrity Number (RIN) value of > 7.5 were considered for further use. 50629
ng RNA from each of the two independent technical replicates was mixed in the ratio630
1:1 and the pooled sample was considered as one biological replicate for631
hybridization experiments. Thus, 3 biological replicates were obtained for the 3632
replicate experiments. 100 ng of RNA sample was processed for cDNA synthesis,633
fragmentation and labelling was carried out for the RNA samples. The samples were634
hybridized to the Affymetrix Gene 1.1 ST Arabidopsis Array Plate and washed on an635
Affymetrix GeneAtlas system followed by scanning of arrays at AROS Applied636
Biotechnology (http://arosab.com/services/microarrays/gene-expression/).637
638
Microarray Data Analysis639
Scanned arrays in the form of .cel files (provided by AROS) were checked for quality640
control using Affymetrix Expression Console Software and an in-house script in R641
and Bioconductor (http://www.r-project.org./; http://www.bioconductor.org/)642
(Bioconductor “oligo” and “pd.aragene.1.1.st” ). Bioconductor was used for Robust643
Multi-array Average (RMA) normalization of raw data at Gene level to obtain644
summarized signal intensity values for all genes present on the array (log2 format).645
Principal component analysis was carried out using Affymetrix Expression Console646
Software (http://www.affymetrix.com/) and dendrogram of all microarray samples647
according to the mean signal intensity values was generated using R (“plot”648
package). Bioconductor (“Limma” package) was used for carrying out differential649
expression analysis.650
651
Temporal Clustering And Bioinformatics Analysis652
We clustered the list of total DEGs (defined as number of DEGs that were regulated653
at atleast one of the three time points) under ethylene and shade based on positive654
or negative regulation at each of the three time-points. With three time-points and655
two directions of expression (positive or negative), 23
= 8 possible trends can occur656
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
21
and accordingly as many clusters were obtained. DEGs were clustered temporally657
based on log2FC.658
659
MapMan bin overrepresentation using hypergeometric test was done using R (“stats”660
package) and adjusted p-values for the statistical significance of enrichment were661
converted into negative logarithm score and plotted as a heatmap. A score above662
1.3 for this score was considered significant.663
GeneCodis (http://genecodis.cnb.csic.es/compareanalysis) webtool was used for GO664
analysis of different sets obtained from venn of Positive clusters and of Negative665
Clusters. A score above 1.3 for negative log of adjusted p-values was considered666
significant.667
668
LogFC Filter and Gene Classification669
In order to narrow down the genes for functional characterization (from the list of670
classified genes), we utilised a logFC filter. To narrow down the Common Up set, a671
filter of log2FC < 0.5 at 1.5 h and log2FC ≥ 0.5 at both 13.5 h and 25.5 h for ethylene672
and log2FC ≥ 0.5 at both 1.5 h and 25.5 h for shade was applied. To narrow down673
the Common Down set, we applied a filter of log2FC > - 0.5 at 1.5 h and log2FC ≤ -674
0.5 at both 13.5 h and 25.5 h under ethylene and of log2FC ≤ - 0.5 at both 1.5 h and675
25.5 h under shade. These resulting group of genes were then classified based on676
MapMan based classification for the terms: “RNA.regulation of transcription”, “Cell677
wall”, “Signalling” and “Hormone metabolism”. Genes from Plant TFDB678
(http://planttfdb.cbi.pku.edu.cn/index.php?sp=Ath) and Potsdam TFDB679
(http://plntfdb.bio.uni-potsdam.de/v3.0/index.php?sp_id=ATH) were also included as680
a source for gene-classification to select for additional transcriptional regulators.681
682
Hormone Correlational Analysis683
Hormonometer software (http://genome.weizmann.ac.il/hormonometer/) was used to684
evaluate transcriptional similarities between the transcriptome data obtained here685
and the published, indexed list of those elicited by exogenous application of plant686
hormones. Arabidopsis gene locus IDs were converted to Affymetrix GeneChip687
identifiers using the “at to AGI converter” tool (The Bio-Analytic Resource for Plant688
Biology, http://bar.utoronto.ca/). We used the new Affymetrix aragen1.1st arrays (28k689
genes) for transcriptomics but the hormonometer data is based on 3’ ATH1 arrays690
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
22
(22k genes). Accordingly, many locus IDs could not be included (those which were691
newly incorporated in the aragene1.1st arrays) in this analysis. In few other cases692
where multiple ATH1 GeneChip IDs for one locus ID was obtained, all IDs were693
retained.694
695
Pharmacological Treatments696
Auxin transport was inhibited by use of 25 µM NPA (Duchefa Biochemie, The697
Netherlands) (Petrásek et al., 2003). Auxin perception was blocked by use of 100 µM698
PEO-IAA (Hayashi et al., 2008). Auxin biosynthesis was blocked by use of 50 µM699
yucasin (Nishimura et al., 2014). 2 µM brassinazole (TCI Europe, Japan) was used700
to inhibit BR biosynthesis (Asami et al., 2000). 2 µM paclobutrazol (Duchefa701
Biochemie, The Netherlands) was used to inhibit GA biosynthesis (Rademacher,702
2000). All chemicals were dissolved in respective solvents (DMSO or ETOH) with703
final solvent concentration in media < 0.1% to prevent toxicity due to solvents. All704
chemicals were applied by pipetting 150 µl of chemical solutions or mock solvents as705
a thin film over the MS-agar media in the petri plates and then allowing the solution706
to diffuse through the medium before starting the treatments.707
708
GUS Staining and Imaging709
For GUS assays, seedlings were transferred immediately from treatments to a GUS710
staining solution (1 mM X-Gluc (5-bromo-4-chloro-3-indolyl-D-glucoronide) (Duchefa711
Biochem, The Netherlands) in 100 mM Sodium phosphate buffer (pH=7.0) along with712
0.1 % Triton X-100, 0.5 mM each of Potassium ferrocyanide (K4Fe(CN)6 and713
Potassium ferricyanide (K3Fe(CN)6 and 10 mM of EDTA (Merck Darmstadt,714
Germany)) and kept at 37°C overnight. Seedlings were bleached in 70% ethanol for715
1 day before capturing images.716
717
Statistical Analysis and Graphing718
1-way ANOVAs followed by Tukey's HSD Post-Hoc tests were performed on the719
measurements obtained in hypocotyl length/cotyledon area kinetics to assess720
statistically significant differences between mean hypocotyl length/cotyledon area721
under ethylene or shade relative to control at the same time point.722
A two-way ANOVA followed by a Tukey's HSD Post-Hoc test was used for pairwise723
multiple comparison. For hypocotyl elongation assays, statistical significance was724
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
23
indicated by the use of different letters. All statistical analyses were done in the R725
software environment. Graphs were plotted using Prism 6 software (GraphPad726
Software, USA).727
728
Accession numbers729
.CEL files utilised in the organ-specific transcriptomics for hypocotyl and cotyledon730
tissues are posted with the GEO accession series GSE83212.731
732
Supplemental data733
The following materials are available in the online version of this article.734
Supplemental Figure S1. Hypocotyl elongation response in wild-type Col-0 under735
control, ethylene, shade and combination (ethylene + shade) treatments.736
Supplemental Figure S2. Venn diagram of gene intersection between up- and737
down- regulated DEGs of ethylene and shade separately at 1.5 h.738
Supplemental Figure S3. Genotyping and transcript level verification for (A)-(D)739
athb28.740
Supplemental Figure S4. Hypocotyl elongation response in ethylene signalling741
mutant, ein3eil1 under ethylene and shade.742
Supplemental Figure S5. TAIR motif analysis for Common Up and Down genesets.743
Supplemental Figure S6. Hypocotyl length of Ler under control and ethylene744
conditions when grown at 220 C day / 200 C night and 200 C day / 180 C night745
temperature regime.746
Supplemental Table S1. Photosynthesis gene proportion in genesets from Venn of747
negative clusters.748
ACKNOWLEDGMENTS749
We would like to thank all the group members of Plant Ecophysiology, Utrecht750
University, The Netherlands for their help in the harvest for the transcriptomics751
experiment.752
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
24
753
FIGURE LEGENDS754
Figure 1. Physiological responses, hypocotyl length and epidermal cell length755
kinetics under ethylene and shade in Arabidopsis (Col-0) seedlings. 1-day old756
seedlings were exposed to control conditions (PAR = 140 μmol m-2
s-1
, blue light =757
29 μmol m-2
s-1
and R:FR = 2.1), elevated ethylene (1 µl L-1
, PAR = 140 μmol m-2
s-1
,758
blue light = 29 μmol m-2
s-1
and R:FR = 2.1) or shade (PAR = 40 μmol m-2
s-1
, blue759
light = 3 μmol m-2
s-1
and R:FR = 0.45). A, Figure shows representative seedlings760
displaying typical phenotypes after 96 h of exposure to control, ethylene or shade761
conditions. B, Mean hypocotyl lengths at 0 h, 24 h, 48 h, 72 h and 96 h under control762
(open circle), ethylene (closed circle) and shade (open triangle) are shown. C, Rate763
of increase in hypocotyl length. Differences between mean hypocotyl lengths of764
subsequent time points averaged over 1 d time interval for control, ethylene and765
shade are shown. D, Detailed hypocotyl length kinetics. 1-day old seedlings were766
exposed to control (open circle), ethylene (closed circle) and shade (open triangle)767
and measured at 3 h time intervals (s, e: first time point at which shade (s) or768
ethylene (e) treatment lead to significantly longer hypocotyls). Data are mean ± S.E.769
(n=60) for (A)-(D). Shaded area denotes the 15 h dark period in the 15 h dark/9 h770
light photoperiodic growth condition. e and s denote the first point of statistically771
significant differences in hypocotyl length or cotyledon area relative to control for772
ethylene and shade respectively. E, Epidermal cell length kinetics. 1-day old773
seedlings were exposed to control, ethylene or shade. Mean cell length ± S.E. (n ≥774
10) for epidermal cells of the Arabidopsis hypocotyl at 0 h control (black line) and at775
3 h, 7.5 h, 15 h and 27 h control (orange line), ethylene (blue line) and shade (green776
line) is shown. Apex denotes the hypocotyl-cotyledon junction and base denotes the777
hypocotyl-root junction.778
Figure 2. Overall description of microarray data. A, Principal component analysis779
(PCA) and hierarchical clustering (HC) was used to describe the structure in the780
microarray data. Expression intensities for all genes on the array for all 54 hypocotyl781
and cotyledon samples (3 time points, 3 treatments and 3 replicates) were projected782
onto the first three principal components. B, Hierarchical clustering was used to783
group 18 main samples (according to mean expression intensity of 3 replicates for784
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
25
each main sample) into a dendrogram. C, Distribution of differentially expressed785
genes (DEGs) in hypocotyl and cotyledon samples at three time-points in response786
to ethylene and shade. DEGs obtained for each time-point were plotted separately787
as up-regulated, down-regulated (adjusted p-value ≤ 0.01 and log2FC > or < 0) or788
non-significant (adjusted p-value > 0.01). Bar length denotes total DEGs obtained789
after combining DEGs from all 3 time points.790
Figure 3. Temporal gene expression clusters for ethylene (A) and shade (D);791
hypocotyl growth curve for ethylene (B) and shade (E); clusters with gene expression792
matching hypocotyl growth kinetics in ethylene (C) and shade (F). Heatmap for793
temporal clusters (A, D) based on the log2FC at the three microarray time points794
(grey box represents dark; arrows indicate heatmap time-points and treatments795
include control (open circle), ethylene (closed circle), shade (open triangle)). Yellow796
denotes up-regulation and blue denotes down-regulation. Two gene expression797
clusters (C, F) with mean log2FC temporal pattern resembling the hypocotyl length798
kinetics (B, E) were named positive clusters. G, Heatmap for hypergeometric799
enrichment of selected MapMan bins for temporal clusters under ethylene and800
shade. Horizontal-axis denotes the cluster number. More intense colours indicate801
higher statistical significance. Grey color indicates non-significant score or absence802
of genes in the bin. H, Venn intersection for positive clusters (clusters with gene803
expression pattern matching the hypocotyl length kinetics) from ethylene and shade804
to obtain “Common Up” genes. I, Venn intersection for negative clusters (mirror805
image to Positive clusters) from ethylene and shade to obtain “Common Down”806
genes.807
Figure 4. Gene Ontology (GO) enrichment analysis using GeneCodis for positive808
and negative clusters. Adjusted p-values for statistical significance of GO enrichment809
were converted into negative logarithm score (base10) (> 1.3 are considered810
significant). Heatmap colours denote this score and more intense colours indicate811
higher statistical significance. White color indicates non-significant score or absence812
of genes in the GO terms.813
814
Figure 5. Heatmap of (A) Common Up and (B) Common Down set of genes815
classified into the categories: transcriptional regulator, hormone metabolism,816
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
26
signalling and cell wall genes after application of a log2fold-change (log2FC) filter.817
Log2FC at the three time-points 1.5 h, 13.5 h, 25.5 h for ethylene and shade818
microarray dataset identified in the color scheme of the heatmap. Genes were819
categorized according to Mapman bin gene classification (shown on left side).820
821
Figure 6. Hypocotyl length measurements for (A) athb28 (B) ibl1 (C) IBL1-OE822
following 96 h of control, ethylene and shade treatments. Data represents mean ±823
S.E. (n=30 seedlings). Different letters above the bars indicate significant differences824
(2-way ANOVA followed by Tukey’s HSD Post-Hoc pairwise comparison).825
826
Figure 7. A, Identification of enriched hormonal signatures in the ethylene- and827
shade-induced Arabidopsis transcriptome. Ethylene and shade-induced hypocotyl828
and cotyledon transcriptomes were analyzed for hormonal signatures using the tool829
Hormonometer (Valdorsky et al., 2009) to establish correlations with expression data830
in an established hormonal transcriptome database. Positive correlations were831
colored yellow and negative correlations blue. Significant correlations were identified832
with absolute correlation values of 0.3 and higher. Numbers in the cells represent the833
exact correlation values. Rows denote hormone treatments that are indicated by the834
name of the hormone and the duration of hormone treatment. Columns denote835
ethylene and shade transcriptome in the hypocotyl and cotyledon at the three time-836
points of tissue harvest. The magnitude of correlation in gene expression is indicated837
by the color scale at top right side. B, Effect of auxin transport inhibitor NPA (25 µM),838
IAA (10 µM), NPA (25 µM) + IAA (10 µM) and auxin perception inhibitor PEO-IAA839
(100 µM) on GUS staining of the pIAA19:GUS lines. For NPA and PEO-IAA effect in840
GUS assay, seedlings were exposed to 2 days of treatment conditions. Arabidopsis841
(Col-0) seedlings were treated with chemical inhibitors for (C) auxin transport (NPA),842
(D) auxin biosynthesis (Yucasin), (E) auxin perception (PEO-IAA), (F)843
brassinosteroid biosynthesis (BRZ) and (G) gibberellin biosynthesis (PBZ) at the844
indicated concentrations in the legend and length was measured following 96h of845
ethylene and shade. Hypocotyl length was measured following 96 h of ethylene and846
shade. Mean ± S.E. was calculated for 30 seedlings. Different letters above the bars847
indicate significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-848
Hoc pairwise comparison. Abbreviations: PEO-IAA is α-(phenylethyl-2-one)-indole-3-849
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
27
acetic acid; NPA is 1-N-Naphthylphthalamic acid; BRZ is Brassinazole; PBZ is850
Paclobutrazol.851
852
Figure 8. Hypocotyl elongation response in response to ethylene and shade in (B)–853
(D) auxin, (E)–(G) gibberellin (GA) and (H)–(J) brassinosteroid (BR) mutants. Mean854
± S.E. was calculated for 30 seedlings. Different letters above the bars indicate855
significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-Hoc856
pairwise comparison.857
858
LITERATURE CITED859
860
Abdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley861
Interdisciplinary Reviews: Computational Statistics, 2(4), 433-459.862
Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T.,863
Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant864
Responses to Environmentally Activated Phytohormonal Signals. Science 311:865
91–94.866
Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S.,867
Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of868
brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant869
Physiol. 123: 93–100.870
Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis871
brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell872
10: 219–230.873
Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic874
helix-loop-helix cascade controls cell elongation downstream of multiple875
hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:876
4917-4929877
Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and878
Koornneef, M. (2013). Arabidopsis semidwarfs evolved from independent879
mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and880
barley. Proc. Natl. Acad. Sci. U. S. A. 110: 15818–15823.881
Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B.882
(2004). Short-Term Growth Responses to Ethylene in Arabidopsis. Plant883
Physiol. 136: 2921–2927.884
Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R.,885
Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator886
network controls growth and patterning in Arabidopsis roots. Nature, 433(7021),887
39-44.888
Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J.889
J. (2012). Stem transcriptome reveals mechanisms to reduce the energetic cost890
of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.891
Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis892
thaliana HomeoBox 1 (AtHB1), a Homedomain‐Leucine Zipper I (HD‐Zip I)893
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
28
transcription factor, is regulated by PHYTOCHROME‐INTERACTING FACTOR894
1 to promote hypocotyl elongation. New Phytologist, 207, 669-682.895
Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade.896
Annu. Rev. Plant Biol. 64: 403–27.897
Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157.898
Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P.,899
and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes900
hypocotyl and stamen filament elongation. Plant J. 71: 684–697.901
Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and902
Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-903
promoting genes through GA-dependent and -independent pathways. PLoS904
One 7: e36210.905
De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers,906
D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS by HD-907
ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009–3019.908
Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007).909
DELLA protein function in growth responses to canopy signals. Plant J. 51: 117–910
126.911
Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster912
analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci.913
U. S. A. 95: 14863–14868.914
Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005).915
Phytochrome B in the Mesophyll Delays Flowering by Suppressing916
FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant917
Cell 17: 1941–1952.918
Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant919
Cell 10: 1775–1778.920
Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S.,921
Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor922
HBI1 mediates the trade-off between growth and pathogen-associated923
molecular pattern–triggered immunity in Arabidopsis. The Plant Cell Online,924
26(2), 828-841.925
Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu,926
P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011).927
Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high928
temperature. Proc. Natl. Acad. Sci. U. S. A. 108: 20231–5.929
Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930–944.930
Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H.931
(1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol.932
114: 295–305.933
Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu,934
J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H.,935
Ashikari, M. (2009). The ethylene response factors SNORKEL1 and936
SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030.937
Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki,938
H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate939
interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A.940
105: 5632–5637.941
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
29
Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:942
Matching growth with environment by the TOR signalling pathway. J. Exp. Bot.943
65: 2691–2701.944
Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The945
involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole946
elongation of Arabidopsis. Plant Physiol. 138: 1106–1116.947
Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear948
import and DNA binding of the ZHD5 transcription factor is modulated by a949
competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659–1668.950
Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene951
MIF1: Involvement in multiple hormonal regulation of Arabidopsis development.952
Plant J. 45: 399–422.953
Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein,954
represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61:955
283–96.956
Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated957
photosynthesis results from increased nitrogen and sulfur assimilation in958
mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84–959
90.960
Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6:961
686–703.962
Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik,963
R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade964
avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107:965
22740–22744.966
Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J.,967
and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined968
auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208–217.969
Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E.,970
and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts971
on ethylene biosynthesis and phytochrome signaling by distinct mechanisms.972
Plant Cell. 19: 3915-3929.973
Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998).974
Photomorphogenic development of the Arabidopsis shy2-1D mutation and its975
interaction with phytochromes in darkness. Plant J. 15: 61–68.976
Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and977
Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4978
and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in979
the coincidence mechanism underlying photoperiodic control of plant growth of980
Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315–1329.981
Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006).982
LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate983
longitudinal cell elongation in Arabidopsis. Development 133: 4305–4314.984
Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development.985
The Plant Cell 26: 56–78.986
Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture.987
Genes Dev. 26: 785–790.988
Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An989
Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and990
Hypocotyl Elongation. Plant Physiol. 160: 2261–2270.991
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
30
Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic992
mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat.993
Rev. Genet. 16: 237–251.994
Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000).995
Update on Light Signaling Shade Avoidance Responses. Driving Auxin along996
Lateral Routes. Plant Physiol. 122: 621–626.997
Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H.,998
Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999).999
BAS1: A gene regulating brassinosteroid levels and light responsiveness in1000
Arabidopsis. Proc. Natl. Acad. Sci. 96: 15316–15323.1001
Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of1002
brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2: E258.1003
Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y.,1004
Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba,1005
T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin1006
biosynthesis. Plant J. 77: 352–366.1007
Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi,1008
S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome1009
P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280:1010
17873–17879.1011
Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R.,1012
Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance1013
Components and Pathways in Adult Plants Revealed by Phenotypic Profiling.1014
PLOS Genet. 11: e1004953.1015
Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of1016
plants to water stress. Front. Plant Sci. 5(86): 10-3389.1017
Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012).1018
Phytochrome B inhibits binding of phytochrome-interacting factors to their target1019
promoters. Plant J. 72: 537–546.1020
Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and1021
Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux by impairing vesicle1022
traffic? Plant Physiol. 131: 254–263.1023
Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014).1024
Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in1025
Arabidopsis. Mol. Plant 7: 1598–1618.1026
Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and1027
Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes1028
expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815–827.1029
Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions1030
between ethylene and gibberellins in phytochrome-mediated shade avoidance1031
responses in tobacco. Plant Physiol. 136: 2928-2936.1032
Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek,1033
L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor1034
proximity signals independent of gibberellin and DELLA proteins in Arabidopsis.1035
Plant Physiol. 149: 1701–1712.1036
Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New1037
perspectives in flooding research: The use of shade avoidance and Arabidopsis1038
thaliana. Ann. Bot. 96: 533–540.1039
Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from1040
shade, salt and drought. Plant Physiol. 166: 5–22.1041
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
31
Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and1042
other aboveground neighbour detection cues. J. Exp. Bot. 65: 2815–2824.1043
Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014).1044
Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in1045
Brassica rapa. Plant Physiol. 165: 1285–1301.1046
Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van1047
Zanten, M. (2016). Molecular and genetic control of plant1048
thermomorphogenesis. Nature Plants. 2: 15190.1049
Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin1050
Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant1051
Mol. Biol. 51: 501–531.1052
Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong,1053
F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L.,1054
and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and1055
AtGA20ox2 act, partially redundantly, to promote growth and development1056
throughout the Arabidopsis life cycle. Plant J. 53: 488–504.1057
Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M.1058
(1998). The TIR1 protein of Arabidopsis functions in auxin response and is1059
related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198–207.1060
Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R.,1061
Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-1062
mediated petiole elongation in Arabidopsis during shade avoidance involves cell1063
wall modification by xyloglucan endotransglucosylase/hydrolases. Plant Physiol.1064
154: 978–990.1065
Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to1066
flooding stress. Plant Physiol.: pp.00387.1067
Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997).1068
Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl.1069
Acad. Sci. U. S. A. 94: 2756–2761.1070
Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A.,1071
Murphy, A.S., Overvoorde, P.J., and Gray, W.M. (2012). The SAUR191072
subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70:1073
978–990.1074
Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y.,1075
Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-1076
Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant1077
Development. Cell 133: 177–191.1078
Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil,1079
R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal1080
regulation of carbon allocation and growth across a wide range of Photoperiods.1081
Mol. Plant 7: 137–155.1082
Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of1083
YUCCA8 expression integrates temperature into the auxin pathway in regulating1084
Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594.1085
Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012).1086
GeneCodis 3: a non-redundant and modular enrichment analysis tool for1087
functional genomics. Nucleic Acids Res. 40: W478–W483.1088
Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-1089
gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis1090
thaliana (L.) Heynh. Planta 182: 501–505.1091
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
32
Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome1092
in cotyledons regulates the expression of genes in the hypocotyl through auxin-1093
dependent and -independent pathways. The Plant Cell Physiol. 43: 1171–1181.1094
Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno,1095
J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballaré, C.L.,1096
Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a1097
New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in1098
Plants. Cell 133: 164–176.1099
Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene1100
insensitivity results in down-regulation of rubisco expression and photosynthetic1101
capacity in tobacco. Plant Physiol. 144: 1305–1315.1102
Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis1103
photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant1104
J. 42: 23–34.1105
Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler,1106
K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015).1107
Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in1108
Arabidopsis. The Plant Cell 27: 2261–2272.1109
Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de1110
Vries, S.C. (2012). A Mathematical Model for BRASSINOSTEROID1111
INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation.1112
Plant Physiol. 160: 523–532.1113
Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der1114
Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8: 462–1115
468.1116
van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-1117
Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R.,1118
Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two1119
Rumex species from contrasting hydrological niches regulate flooding tolerance1120
through distinct mechanisms. The Plant Cell 25: 4691–707.1121
Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and1122
processes : an overview. New Phytol. 206: 57–73.1123
Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009).1124
HORMONOMETER: a tool for discerning transcript signatures of hormone1125
action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796–1805.1126
Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific1127
phytochrome responses using targeted expression of biliverdin reductase in1128
Arabidopsis. Plant Physiol. 149: 424–33.1129
Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required1130
for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100: 403–1131
408.1132
Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K.,1133
Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014).1134
Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell1135
elongation in Arabidopsis through an apparent incoherent feed-forward loop.1136
Proc. Natl. Acad. Sci. U. S. A. 111: 2824–9.1137
Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J.1138
(2016). Local auxin metabolism regulates environment-induced hypocotyl1139
elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.251140
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
33
Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and1141
Guo, H. (2012). A molecular framework of light-controlled phytohormone action1142
in Arabidopsis. Curr. Biol. 22: 1530–1535.1143
1144
1145
1146
1147
1148
1149
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Parsed Citations
Abdi, H., and Williams, L. J. (2010). Principal component analysis. WileyInterdisciplinaryReviews:Computational Statistics, 2(4),
433-459.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., Straeten, D. Van Der, Peng, J., and Harberd, N.P.
(2006). Integration of Plant Responses to EnvironmentallyActivated Phytohormonal Signals. Science 311:91-94.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000).
Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123:93-100.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis brassinosteroid-dependent mutant is blocked in cell
elongation. The Plant Cell 10:219-230.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) Atriple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation
downstreamof multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:4917-4929
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and Koornneef, M. (2013). Arabidopsis semidwarfs
evolved fromindependent mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and barley. Proc. Natl. Acad.
Sci. U. S. A. 110:15818-15823.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. (2004). Short-TermGrowth Responses to Ethylene
in Arabidopsis. Plant Physiol. 136:2921-2927.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., Aida M., Palme K. & Scheres, B. (2005). The PIN
auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 39-44.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. J. (2012). Stemtranscriptome reveals mechanisms to
reduce the energetic cost of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine
Zipper I (HD-Zip I) transcription factor, is regulated byPHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl
elongation. NewPhytologist, 207, 669-682.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. Annu. Rev. Plant Biol. 64:403-27.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10:e0157.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP
RNA63 promotes hypocotyl and stamen filament elongation. Plant J. 71:684-697.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcriptome reveals
auxin regulation of growth-promoting genes through GA-dependent and -independent pathways. PLoS One 7:e36210.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, D., and Jurgens, G. (2013). Transcriptional repression
of BODENLOS byHD-ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64:3009-3019.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). DELLAprotein function in growth responses to canopy
signals. Plant J. 51:117-126.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis and displayof genome-wide expression patterns.
Proc. Natl. Acad. Sci. U. S. A. 95:14863-14868.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). Phytochrome B in the Mesophyll Delays Flowering by
Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant Cell 17:1941-1952.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Estelle, M. (1998). Polar Auxin Transport:NewSupport for an Old Model. The Plant Cell 10:1775-1778.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., KimS., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH
transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunityin
Arabidopsis. The Plant Cell Online, 26(2), 828-841.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray,
W.M. (2011). Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U. S.
A. 108:20231-5.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Franklin, K. A. (2008). Shade avoidance. NewPhytol. 179:930-944.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H. (1997). Cellular basis of hypocotyl growth in
Arabidopsis thaliana. Plant Physiol. 114:295-305.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, J., Matsumoto, T., Yoshimura, A., Kitano, H.,
Matsuoka, M., Mori, H., Ashikari, M. (2009). The ethylene response factors SNORKEL1 and SNORKEL2 allowrice to adapt to deep
water. Nature 460:1026-1030.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008). Small-molecule agonists and antagonists
of F-box protein-substrate interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 105:5632-5637.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:Matching growth with environment bythe TOR
signalling pathway. J. Exp. Bot. 65:2691-2701.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The involvement of Gibberellin 20-Oxidase genes in
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
phytochrome-regulated petiole elongation of Arabidopsis. Plant Physiol. 138:1106-1116.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear import and DNAbinding of the ZHD5 transcription
factor is modulated bya competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286:1659-1668.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene MIF1:Involvement in multiple hormonal regulation
of Arabidopsis development. Plant J. 45:399-422.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNABinding bHLH protein, represses light signal transduction in Arabidopsis
thaliana. Plant Mol. Biol. 61:283-96.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated photosynthesis results fromincreased nitrogen
and sulfur assimilation in mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78:84-90.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Kazan, K. and Manners, J.M. (2013). MYC2:The master in action. Mol. Plant 6:686-703.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2010). Auxin transport through PIN-FORMED 3
(PIN3) controls shade avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107:22740-22744.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J., and Pierik, R. (2011). Blue-light-mediated shade
avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67:208-217.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E., and Quail, P.H. (2007). The basic helix-loop-helix
transcription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling bydistinct mechanisms. Plant Cell. 19:3915-
3929.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998). Photomorphogenic development of the Arabidopsis shy2-1D
mutation and its interaction with phytochromes in darkness. Plant J. 15:61-68.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR
4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanismunderlying
photoperiodic control of plant growth of Arabidopsis thaliana. The Plant Cell Physiol. 52:1315-1329.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006). LONGIFOLIA1 and LONGIFOLIA2, two homologous
genes, regulate longitudinal cell elongation in Arabidopsis. Development 133:4305-4314.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Leivar, P. and Monte, E. (2014). PIFs:systems integrators in plant development. The Plant Cell 26:56-78.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture. Genes Dev. 26:785-790.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An Endogenous Carbon-Sensing PathwayTriggers
Increased Auxin Flux and Hypocotyl Elongation. Plant Physiol. 160:2261-2270.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic mechanisms of abiotic stress tolerance that translate to
crop yield stability. Nat. Rev. Genet. 16:237-251.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000). Update on Light Signaling Shade Avoidance Responses.
Driving Auxin along Lateral Routes. Plant Physiol. 122:621-626.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H., Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S.,
and Chory, J. (1999). BAS1:Agene regulating brassinosteroid levels and light responsiveness in Arabidopsis. Proc. Natl. Acad.
Sci. 96:15316-15323.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependencyof brassinosteroid and auxin signaling in Arabidopsis. PLoS
Biol. 2:E258.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y., Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I.,
Kamiya, Y., and Koshiba, T. (2014). Yucasin is a potent inhibitor of YUCCA, a keyenzyme in auxin biosynthesis. Plant J. 77:352-366.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi, S. (2005). The last reaction producing brassinolide is
catalyzed bycytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280:17873-17879.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade
Avoidance Components and Pathways in Adult Plants Revealed byPhenotypic Profiling. PLOS Genet. 11:e1004953.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of plants to water stress. Front. Plant Sci. 5(86):10-
3389.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012). Phytochrome B inhibits binding of phytochrome-
interacting factors to their target promoters. Plant J. 72:537-546.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux
byimpairing vesicle traffic? Plant Physiol. 131:254-263.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014). Combinatorial Complexityin a TranscriptionallyCentered
Signaling Hub in Arabidopsis. Mol. Plant 7:1598-1618.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and Hedrich, R. (2004). Auxin activates KAT1 and KAT2,
two K+-channel genes expressed in seedlings of Arabidopsis thaliana. Plant J. 37:815-827.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions between ethylene and gibberellins in
phytochrome-mediated shade avoidance responses in tobacco. Plant Physiol. 136:2928-2936.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek, L.A.C.J. (2009). Auxin and ethylene regulate elongation
responses to neighbor proximitysignals independent of gibberellin and DELLAproteins in Arabidopsis. Plant Physiol. 149:1701-
1712.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). Newperspectives in flooding research:The use of shade
avoidance and Arabidopsis thaliana. Ann. Bot. 96:533-540.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Pierik, R. and Testerink, C. (2014). The art of being flexible:howto escape fromshade, salt and drought. Plant Physiol. 166:5-22.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Pierik, R. and De Wit, M. (2014). Shade avoidance:Phytochrome signalling and other aboveground neighbour detection cues. J.
Exp. Bot. 65:2815-2824.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014). Cotyledon-Generated Auxin Is Required for Shade-Induced
Hypocotyl Growth in Brassica rapa. Plant Physiol. 165:1285-1301.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van Zanten, M. (2016). Molecular and genetic control of plant
thermomorphogenesis. Nature Plants. 2:15190.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Rademacher, W. (2000). GROWTH RETARDANTS:Effects on Gibberellin Biosynthesis and Other Metabolic Pathways. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 51:501-531.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong, F., Linhartova, T., Eriksson, S., Nilsson, O.,
Thomas, S.G., Phillips, A.L., and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially
redundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant J. 53:488-504.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M. (1998). The TIR1 protein of Arabidopsis functions in
auxin response and is related to human SKP2 and yeast Grr1p. Genes Dev. 12:198-207.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R., Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010).
Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification byxyloglucan
endotransglucosylase/hydrolases. Plant Physiol. 154:978-990.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to flooding stress. Plant Physiol.:pp.00387.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V(1997). Ethylene can stimulate Arabidopsis hypocotyl
elongation in the light. Proc. Natl. Acad. Sci. U. S. A. 94:2756-2761.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A., Murphy, A.S., Overvoorde, P.J., and Gray, W.M.
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
(2012). The SAUR19 subfamilyof SMALL AUXIN UP RNAgenes promote cell expansion. Plant J. 70:978-990.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y., Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M.
(2008). TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development. Cell 133:177-191.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil, R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis
coordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods. Mol. Plant 7:137-155.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of YUCCA8 expression integrates temperature into the
auxin pathwayin regulating Arabidopsis hypocotyl growth. PLoS Genet. 8:e1002594.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). GeneCodis 3:a non-redundant and modular enrichment
analysis tool for functional genomics. Nucleic Acids Res. 40:W478-W483.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant
gai of Arabidopsis thaliana (L.) Heynh. Planta 182:501-505.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome in cotyledons regulates the expression of genes in
the hypocotyl through auxin-dependent and -independent pathways. The Plant Cell Physiol. 43:1171-1181.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno, J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao,
Y., Ballaré, C.L., Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a NewTryptophan-Dependent Pathway
Is Required for Shade Avoidance in Plants. Cell 133:164-176.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene insensitivityresults in down-regulation of rubisco
expression and photosynthetic capacityin tobacco. Plant Physiol. 144:1305-1315.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantlyto modulate Arabidopsis photomorphogenesis via unique brassinosteroid
inactivation mechanisms. Plant J. 42:23-34.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler, K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B.
(2015). Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis. The Plant Cell 27:2261-2272.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de Vries, S.C. (2012). AMathematical Model for
BRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation. Plant Physiol. 160:523-532.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der Straeten, D. (2005). Reaching out of the shade. Curr.
Opin. Plant Biol. 8:462-468.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive,
C.K., Pierik, R., Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two Rumex species fromcontrasting hydrological
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
niches regulate flooding tolerance through distinct mechanisms. The Plant Cell 25:4691-707.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Voesenek L.A.C.J.;and Bailey-serres, J. (2015). Flood adaptive traits and processes?:an overview. NewPhytol. 206:57-73.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009). HORMONOMETER:a tool for discerning transcript signatures
of hormone action in the Arabidopsis transcriptome. Plant Physiol. 150:1796-1805.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific phytochrome responses using targeted expression
of biliverdin reductase in Arabidopsis. Plant Physiol. 149:424-33.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short
Days. Plant Physiol. 100:403-408.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K., Revalska, M., Van Montagu, M., Grotewold, E., and
Russinova, E. (2014). Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsis
through an apparent incoherent feed-forward loop. Proc. Natl. Acad. Sci. U. S. A. 111:2824-9.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J. (2016). Local auxin metabolismregulates environment-
induced hypocotyl elongation. Nat. Plants. 21:16025. doi:10.1038/nplants.2016.25
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and Guo, H. (2012). Amolecular framework of light-
controlled phytohormone action in Arabidopsis. Curr. Biol. 22:1530-1535.
Pubmed: Author and Title
CrossRef: Author and Title
Google Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from
Copyright © 2016 American Society of Plant Biologists. All rights reserved.

Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional regulators.

  • 1.
    1 Short title: Ethylene-and shade-induced stress escape1 Corresponding authors: Rashmi Sasidharan, Ronald Pierik2 Address: Padualaan 8, 3584 CH, Utrecht, The Netherlands3 Telephone number: +31 30 25368384 Email: r.sasidharan@uu.nl, r.pierik@uu.nl5 6 Ethylene- and shade-induced hypocotyl elongation share transcriptome7 patterns and functional regulators8 Das D.1 , St. Onge K.R.1,2 , Voesenek L.A.C.J.1 , Pierik R.1 * and Sasidharan R.1 *9 *shared senior and corresponding authors10 1 Plant Ecophysiology, Institute of Environmental Biology, Utrecht University, 3584CH Utrecht, The11 Netherlands12 2 Department of Biological Sciences, CW405 BioSci Building, University of Alberta, T6J2E9, Canada13 14 Summary: Ethylene and shade share a conserved set of molecular regulators to15 control plasticity of hypocotyl elongation in Arabidopsis.16 17 AUTHOR CONTRIBUTIONS18 R.P., R.S and L.A.C.J.V. conceived the original research plans and project. R.S.,19 R.P, L.A.C.J.V., K.R.S. supervised the experiments. D.D. performed most of the20 experiments. D.D., K.R.S., R.P. and R.S. designed the experiments. D.D. and21 K.R.S. analyzed the data. D.D. wrote the article with contributions of all the authors.22 FUNDING INFORMATION23 This research was supported by the Netherlands Organisation for Scientific24 Research (grant nos. ALW Ecogenomics 84410004 to L.A.C.J.V., ALW VENI25 86312013 and ALW 82201007 to R.S., ALW VIDI 86412003 to R.P.) and a Utrecht26 University Scholarship to D.D.27 28 CORRESPONDING AUTHOR EMAIL: r.sasidharan@uu.nl, r.pierik@uu.nl29 30 31 32 Plant Physiology Preview. Published on June 21, 2016, as DOI:10.1104/pp.16.00725 Copyright 2016 by the American Society of Plant Biologists www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 2.
    2 ABSTRACT33 Plants have evolvedshoot elongation mechanisms to escape from diverse34 environmental stresses such as flooding and vegetative shade. The apparent35 similarity in growth responses suggests possible convergence of the signalling36 pathways. Shoot elongation is mediated by passive ethylene accumulating to high37 concentrations in flooded plant organs and by changes in light quality and quantity38 under vegetation shade. Here we study hypocotyl elongation as a proxy for shoot39 elongation and delineated Arabidopsis hypocotyl length kinetics in response to40 ethylene and shade. Based on these kinetics, we further investigated ethylene and41 shade-induced genome-wide gene expression changes in hypocotyls and cotyledons42 separately. Both treatments induced a more extensive transcriptome reconfiguration43 in the hypocotyls compared to the cotyledons. Bioinformatics analyses suggested44 contrasting regulation of growth promotion- and photosynthesis-related genes.45 These analyses also suggested an induction of auxin, brassinosteroid and gibberellin46 signatures and the involvement of several candidate regulators in the elongating47 hypocotyls. Pharmacological and mutant analyses confirmed the functional48 involvement of several of these candidate genes and physiological control points in49 regulating stress-escape responses to different environmental stimuli. We discuss50 how these signaling networks might be integrated and conclude that plants, when51 facing different stresses, utilise a conserved set of transcriptionally regulated genes52 to modulate and fine tune growth.53 54 INTRODUCTION55 All organisms, including plants, assess and respond to both biotic and abiotic factors56 in their environments (Pierik and De Wit, 2014; Pierik and Testerink, 2014; Franklin57 et al., 2011; Quint et al., 2016; Osakabe et al., 2014; Voesenek and Bailey-Serres,58 2015). However, unlike animals, plants, cannot move away from extremes in their59 surrounding environment but rather rely on various plastic morphological and60 metabolic responses. Such response traits include changes in plant architecture to61 escape the stress and optimize resource capture (Pierik and Testerink, 2014;62 Mickelbart et al., 2015). With energy reserves being invested in escape traits, plants63 often have lower plant biomass and crop yield (Casal, 2013). Molecular investigation64 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 3.
    3 of the differentsignalling pathways controlling these traits along with the65 characterization of underlying molecular components would not only enhance66 fundamental knowledge of stress-induced plasticity but also benefit crop67 improvement.68 Plants are highly sensitive to changes in their light environment. Young plants69 growing in a canopy experience changes in light quality and quantity due to70 neighbouring plants and compete to harvest optimum light (Pierik and De Wit, 2014;71 Casal et al., 2013). When a plant cannot outgrow its neighbours, it experiences72 complete vegetation shade (hereafter termed as “shade”) which, in addition to low73 red: far-red (R:FR), is marked by a significant decline in blue light and overall light74 quantity. These changes initiate so-called Shade Avoidance Syndrome (SAS)75 responses consisting of petiole, hypocotyl and stem elongation; reduction of76 cotyledon and leaf expansion; upward movement of leaves (hyponasty), decreased77 branching and increased apical dominance (Vandenbussche et al., 2005; Franklin,78 2008; Casal, 2012; Pierik and De Wit, 2014). Shade-induced elongation comprises a79 complex network of photoreceptor-regulated transcriptional and protein-level80 regulation involving BASIC HELIX LOOP HELIX (BHLH) and HOMEODOMAIN-81 LEUCINE ZIPPER, (HD-ZIP) transcription factors and auxin, gibberellin and82 brassinosteroid hormone genes (Casal, 2012; 2013). Flooding often leads to partial83 or complete submergence of plants. Water severely restricts gas diffusion and the84 consequent limited exchange of O2 and CO2 restricts respiration and photosynthesis.85 Another consequence is the rapid accumulation of the volatile hormone ethylene.86 Ethylene is considered an important regulator of adaptive responses to flooding,87 including accelerated shoot elongation responses that bring leaf tips from the water88 layer into the air (Sasidharan and Voesenek, 2015; Voesenek and Bailey-Serres,89 2015). In deepwater rice, this flooding-induced elongation response involves90 ethylene-mediated induction of members of the group VII Ethylene Response91 Factors (ERF-VII) family, a decline in active abscisic acid (ABA) and consequent92 increase in gibberellic acid (GA) responsiveness and promotion of GA biosynthesis93 (Hattori et al., 2009). In submerged Rumex palustris petioles, ethylene also rapidly94 stimulates cell wall acidification and transcriptional induction of cell wall modification95 proteins to facilitate rapid elongation (Voesenek and Bailey-Serres, 2015). Shade96 cues are reported to enhance ethylene production resulting in shade avoidance97 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 4.
    4 phenotypes (Pierik etal., 2004). However, these responses are mediated by98 ethylene concentrations of a much lower magnitude than that occuring in flooded99 plant organs (1µl L-1 ) (Sasidharan and Voesenek, 2015).100 So far, it is largely unknown to what extent these growth responses to such highly101 diverse environmental stimuli, share physiological and molecular components102 through time. A preliminary study in R. palustris showed that GA is a common103 regulator of responses to both submergence and shade (Pierik et al. 2005). Although104 submergence is a compound stress, rapid ethylene accumulation is considered an105 early and reliable flooding signal triggering plant adaptive responses. High ethylene106 concentrations as occur within submerged plant organs, promote rapid shoot107 elongation (Voesenek and Bailey-Serres, 2015). This submergence response, which108 has been extensively characterised in rice and Rumex (Hattori et al. 2009; van Veen109 et al., 2013), can be almost completely mimicked by the application of saturating (1µl110 L-1 ) ethylene concentrations (Sasidharan and Voesenek, 2015). Saturating ethylene111 concentrations were therefore used here as a submergence mimic. Shade was given112 as true shade which combines the three known key signals that trigger elongation113 (red and blue light depletion with relative far-red enrichment).114 A hypocotyl elongation assay in Arabidopsis thaliana (Col-0) was used as a proxy for115 shoot elongation under ethylene and shade in order to study to what extent ethylene116 and shade responses share molecular signalling components. Although ethylene117 suppresses Arabidopsis hypocotyl elongation in dark, high ethylene concentrations118 in light (as occurs during submergence) stimulate hypocotyl elongation in119 Arabidopsis (Smalle et al., 1997; Zhong et al., 2012). Also upon simulated shade,120 Arabidopsis demonstrates pronounced hypocotyl elongation (Morelli and Ruberti,121 2000). To capture early physiological responses and gene expression changes in122 response to ethylene and shade, Arabidopsis seedling hypocotyl elongation and123 cotyledon expansion were examined over time. The two treatments elicited124 characteristic hypocotyl growth kinetics. To uncover the transcriptomic changes125 regulating the elongation response to these signals, an organ-specific genome-wide126 investigation was carried out on hypocotyls and cotyledons separately at three time-127 points corresponding to distinct hypocotyl elongation phases. Clustering analyses in128 combination with biological-enrichment tests allowed identification of gene clusters129 with expression patterns matching the hypocotyl growth trends across the three time-130 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 5.
    5 points in boththe treatments. Correlation of genome-wide hypocotyl and cotyledon-131 specific transcriptomic changes to publicly available microarray data on hormone132 treatments identified enriched hormonal signatures of auxin, brassinosteroid and133 gibberellin in hypocotyl tissues and several potential growth regulatory candidate134 genes. Using hormone mutants and chemical inhibitors, we confirmed the combined135 involvement of these hormones and candidate regulators in the hypocotyl elongation136 response to ethylene and shade. We suggest that growth responses to diverse137 environmental stimuli like ethylene and shade converge on a common regulatory138 module consisting of both positive and negative regulatory proteins that interact with139 a hormonal triad to achieve a controlled fine-tuned growth response.140 141 142 RESULTS143 Delineation of hypocotyl elongation kinetics under ethylene and shade in144 Arabidopsis seedlings145 Exogenous application of ethylene (1 µl L-1 ) in light-grown seedlings resulted in thick,146 yet elongated hypocotyls and smaller cotyledons as compared to untreated controls.147 Shade, achieved by the use of a green filter, stimulated strong hypocotyl elongation148 in seedlings but resulted in mildly smaller cotyledons compared to controls (Fig. 1A).149 Hypocotyl length increments in the two treatments relative to control were around 2-150 fold under ethylene and greater than 3-fold under shade (Figs. 1, A and B). For both151 treatments growth stimulation was strongest in the first two days of treatment (Fig.152 1C) and faded out in the subsequent days. When combined, shade and ethylene153 exposure resulted in hypocotyl lengths that were intermediate to the individual154 treatments (Supplemental Fig. S1).155 To get a more detailed time-line of the early elongation kinetics, we performed a156 follow-up experiment with 3 h measurement intervals for the first 33 h (Fig. 1D).157 Ethylene-mediated stimulation of hypocotyl elongation started only in the middle of158 the dark period after 15 h. However, under shade, longer hypocotyls were recorded159 already after 3 h and this rapid stimulation continued until the start of the dark period.160 Interestingly, accelerated elongation was again observed at around 24 h after the161 start of the treatments (when the lights were switched on). Based on this time-line,162 we determined epidermal cell lengths at time-points 0, 3, 7.5, 15 and 27 h (Gendreau163 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 6.
    6 et al., 1997;Fig. 1E), the latter four of which are either prior to start of accelerated164 growth or during it in response to ethylene and shade. The rapid stimulation of165 elongation under shade starts at the base of the hypocotyl (3 h) and then progresses166 all along the hypocotyl with maximum elongation occurring in the middle segment167 while under ethylene accelerated elongation is observed at the middle-bottom of168 hypocotyl (27 h).169 170 Organ-specific transcriptomics in hypocotyl and cotyledon under ethylene and171 shade172 The transcriptome response to ethylene and shade in hypocotyl and cotyledon173 tissues was characterised using Affymetrix Arabidopsis Gene 1.1 ST arrays at three174 time points of hypocotyl length kinetics (1.5 h, 13.5 h and 25.5 h) (Fig. 1D). Principal175 component analysis (PCA) (Abdi and Williams, 2010) of all replicate samples for176 hypocotyl and cotyledon exposed to control, ethylene or shade conditions showed177 that replicate samples generally clustered together (Fig. 2A). The first principal178 component (34.2%) separates tissue-specific samples, whereas the second principal179 component (13.0%) showed separate clustering of the 13.5h samples which falls180 during the dark period.181 Hierarchical clustering (HC) (Eisen et al., 1998) of mean absolute expression182 intensities for the different main samples (combination of 3 replicates) revealed183 similar trends (Fig. 2B). Fig. 2C shows the distribution of up- and down-regulated184 differentially expressed genes (DEGs) (genes with adjusted p-value ≤ 0.01) in185 hypocotyl and cotyledon for ethylene and shade at the three harvest time points 1.5186 h, 13.5 h, 25.5 h respectively. In both the conditions and tissues, the number of both187 up- and down-regulated DEGs increased with time. Ethylene regulated substantially188 more DEGs in the hypocotyl as compared to shade at all harvest time points (Fig.189 2C). Data analysis identified 6668 and 4741 genes (hereafter termed as “total190 DEGs”) that were differentially expressed in hypocotyl at one or more of the three191 tissue harvest time points by ethylene and shade respectively. Interestingly, in the192 cotyledon, at 1.5 h, the number of significant DEGs under ethylene was higher than193 under shade but at the subsequent two time points, shade regulated more genes. In194 the cotyledon, 1197 and 2173 DEGs were identified that were differentially195 expressed at one or more of the three tissue harvest time points by ethylene and196 shade respectively.197 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 7.
    7 Interestingly, at 1.5h, there was more transcriptional regulation in ethylene- than198 shade-exposed hypocotyls even though subsequent hypocotyl elongation was much199 more rapid in shade (Figs. 2C and 1D). For ethylene-specific downregulated DEGs200 at 1.5 h, the topmost enriched GO term was cell wall organization (containing 30201 genes), which suggested a repression of growth-promoting genes and possible lack202 of ethylene-mediated elongation at 1.5 h (Supplemental Fig. S2). We also found 6203 genes (AT1G65310, XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE204 17 (XTH17); AT5G23870, pectin acetyl esterase; AT3G06770, glycoside hydrolase;205 AT5G46240, POTASSIUM CHANNEL IN ARABIDOPSIS THALIANA 1 (KAT1);206 AT1G29460, SMALL AUXIN UPREGULATED RNA 65 (SAUR65) and AT3G02170,207 LONGIFOLIA 2 (LNG2)) in the shade-specific upregulated 32 genes at 1.5 h, with208 implied cell expansion roles and could possibly be associated with the rapid209 elongation response (Sasidharan et al., 2010; Philippar et al., 2004; Nozue et al.,210 2015; Chae et al., 2012; Lee et al., 2006).211 212 Different gene expression clusters contributing to hypocotyl growth in213 ethylene and shade214 In order to find specific genes regulating the elongation phenotype under both215 treatments, we used temporal clustering of DEGs based on expression values. Due216 to distinct hypocotyl length kinetics in response to ethylene and shade (Fig. 1D), we217 searched for a set of temporally co-expressed genes that could potentially contribute218 to this treatment-specific kinetics. Time-point based clustering was performed for the219 6668 ethylene and 4741 shade total DEGs based on the positive or negative220 magnitude of log2FC for DEGs at the three time points (Fig. 3, A and D). The gene221 expression patterns in clusters-1 and 5 across the three time points matched the222 ethylene hypocotyl growth kinetics closely (Fig. 3, B and C). Similarly, gene223 expression kinetics in clusters-1 and 3 matched the hypocotyl length kinetics in224 shade (Fig. 3, E and F). These growth pattern matching clusters were termed225 “positive”. All the clusters with mirror image of gene expression profiles to that of the226 positive clusters (clusters-8 and 4 in ethylene and clusters-8 and 6 in shade) were227 termed as “negative” clusters.228 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 8.
    8 Next, a hypergeometricover-representation test for selected MapMan bins (“stress”,229 “hormone”, “signalling”, “RNA.Regulation of transcription” and “cell wall”) was carried230 out for the temporal gene clusters (Fig. 3G). Interestingly, “cell wall”, “hormone” and231 “signalling” were highly co-enriched in positive clusters (cluster-1 and 5 for ethylene232 and cluster-1 for shade) which hints at co-regulation of genes mapped to these terms233 during transcriptomic response to ethylene and shade in the hypocotyl.234 To identify growth promotion related DEGs, we identified DEGs common to both the235 treatments in the clusters previously designated as ‘positive’ and ‘negative’ clusters236 (Fig. 3, H and I). 997 DEGs were obtained from a venn diagram between the237 treatment-specific positive clusters, upregulated at atleast two time-points, and238 hereafter called “Common Up”. Similarly, 824 DEGs were shared between ethylene239 and shade negative clusters, were downregulated at atleast two time points and240 hereafter called “Common Down”.241 Enriched functional categories in the different gene sets from Venn diagrams of242 positive and negative clusters, were identified using the GeneCodis tool (Tabas-243 Madrid et al., 2012) (Fig. 4). In the Common Up set, we found a variety of growth244 associated GO categories including cell wall modification, hormone (auxin and245 brassinosteroid) signaling and metabolism, transport processes, tropisms, response246 to abiotic stimuli and signal transduction. The ethylene-specific set for positive247 clusters was enriched for ethylene-associated terms as expected, but also for248 various sugar metabolic, endoplasmic reticulum (ER)-related and protein post-249 translational modification-related processes. Some of the enriched GO terms in the250 ethylene-specific set for positive clusters were also found in the Common Up set, but251 caused by different genes in the same GO category, including those associated with252 growth, hormones and transport processes. The shade-specific set for positive253 clusters showed only few clear GO enrichments such as trehalose metabolism,254 secondary cell wall biogenesis and amino acid metabolism, but also shared some255 with the Common Up set like shade avoidance and protein phosphorylation and with256 both Common Up and ethylene-specific set for positive clusters, such as response to257 auxin and unidimensional growth.258 In the Common Down set, GO terms associated with photosynthesis, primary and259 secondary metabolism, response to biotic and abiotic stress, as well as260 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 9.
    9 photomorphogenesis were enriched.The latter is striking given that ethylene does261 not alter the light environment. The ethylene-specific set for negative clusters262 included strong enrichment of circadian rhythm and a variety of photosynthesis-and263 chloroplast-associated GO terms, partially shared with the Common Down set. In the264 shade-specific set for negative clusters, flavonoid/anthocyanin biosynthesis and265 response to UV-B and heat were enriched. The shade-specific set for negative266 clusters shared terms from defence-associated GO categories and cadmium, karrikin267 response with Common Down set. Terms common to all three sets of negative268 clusters were related to photomorphogenesis and metabolic process.269 270 Functional characterization: shared components in ethylene -and shade-271 mediated regulation of hypocotyl length272 We classified Common Up and Down set genes into transcriptional regulators,273 hormone metabolism genes, signalling genes and cell wall genes and also applied a274 logFC filter (see “Materials and Methods” sub-section “LogFC Filter and Gene275 Classification”) to obtain a final list of 53 and 8 genes in the two sets respectively276 (Fig. 5, A and B). We selected a subset of candidate regulators for functional testing277 and made sure to include two transcription factors since these may be relatively278 upstream in the convergence of signaling pathways. Obvious targets for these279 regulators would be different plant hormones, and before zooming in on these, we280 ran a hormonometer analysis with our transcriptome data to further subset our281 candidate regulators.282 283 Transcription factor candidates:284 ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 28 (ATHB28) is a zinc-finger285 homeodomain (ZF-HD) transcription factor that showed upto 2-fold induction in the286 hypocotyls in ethylene and shade respectively. A homozygous null mutant287 (Supplemental Fig. S3, A-D), “athb28”, showed a significant reduction in hypocotyl288 lengths under both ethylene and shade (Fig. 6A), consistent with its induction upon289 both the treatments.290 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 10.
    10 Both shade andethylene also significantly induced transcript levels of the bHLH291 transcription factor INCREASED LEAF INCLINATION1 BINDING bHLH1 like-1292 (IBL1) Arabidopsis hypocotyls. However, the ibl1 (SALK T-DNA insertion line)293 showed wild-type responses to the treatments (Fig. 6B). The bHLH transcription294 factors IBL1 and its homolog IBH1 have been implicated in repressing BR-mediated295 cellular elongation. In an ibl1 mutant, IBH1 is still present and may negatively296 regulate cell elongation independently of IBL1. The 35S overexpression line, IBL1OE297 (Zhiponova et al., 2014), had shorter hypocotyls than the wild-type under control298 conditions. IBL1OE also lacked ethylene and shade-induced hypocotyl elongation299 implying an inhibitory role for IBL1 (Fig. 6C).300 301 Hormone candidates: auxin, brassinosteroid and gibberellin302 To further investigate the significant hormone related changes amongst the growth303 related DEGs we analysed our data using Hormonometer (Volodarsky et al., 2009).304 For both treatments, the hormonal signatures across the three time-points for BR305 and GA most closely matched the hypocotyl elongation kinetics (Figs. 1D and 7A).306 The analysis also showed significant correlations with auxin responses for all data307 sets.308 In the Common Up set 49 genes were present that were all also auxin-regulated,309 whereas there were 14 that were also BR-regulated. In the Common Down set 16310 genes were present that can be regulated by auxin, 16 that can also be ABA-311 regulated and 13 genes that are also JA-regulated. Interestingly, there were no312 genes for BR in the Common Down set. In addition, genes involved in auxin-313 conjugation genes (GRETCHEN HAGEN 3 FAMILY PROTEIN 3.17 (GH3.17) and314 AT5G13370), GA catabolising genes (GIBBERELLIN 2 OXIDASE (GA2OX) 2,315 GA2OX4 and GA2OX7) and JA augmenting genes (LIPOXYGENASE (LOX) 1,316 LOX2 and LOX3) were down-regulated.317 In order to test the possible role of auxin, GA and BR, in mediating shade and318 ethylene-induced hypocotyl elongation, we first tested the effects of pharmacological319 inhibitors of these hormones on shade and ethylene-induced hypocotyl elongation.320 To visualize the auxin effect we treated the pIAA19:GUS auxin response marker line321 with the auxin transport inhibitor, 1-N-Naphthylphthalamic acid (NPA). As shown in322 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 11.
    11 Fig. 7B, applicationof NPA (25 µM) inhibited hypocotyl elongation and also strongly323 reduced staining in the hypocotyl region. This inhibition was rescued by IAA (10 µM).324 The auxin perception inhibitor, α-(phenylethyl-2-one)-indole-3-acetic acid, PEO-IAA325 (100 µM), strongly reduced staining in the whole pIAA19:GUS seedling and inhibited326 elongation in response to both treatments. The significant inhibition of ethylene and327 shade-induced hypocotyl elongation by the different auxin inhibitors is quantitated in328 Fig. 7,C-E. The addition of NPA, yucasin (auxin biosynthesis inhibitor) and α-329 (phenylethyl-2-one)-indole-3-acetic acid (PEO-IAA; auxin antagonist) inhibited330 hypocotyl elongation under both the treatments confirming that all three aspects of331 auxin are required for ethylene- and shade-induced hypocotyl elongation. BR332 biosynthesis inhibitor brassinazole (BRZ) and GA biosynthesis inhibitor paclobutrazol333 (PBZ) fully inhibited these elongation responses as well (Fig. 7, F and G).334 To further validate the involvement of auxin, BR and GA in ethylene and shade-335 induced hypocotyl elongation we tested hypocotyl elongation responses in a variety336 of hormone mutants, including mutants for candidate genes from Figure 5.337 Both the auxin receptor (tir1-1) and biosynthesis (wei8-1) mutants showed338 significantly impaired hypocotyl elongation responses compared to the wild type339 ethylene and shade response (Fig. 8, A and B). A similar effect was seen in the340 auxin transport mutant pin3pin4pin7 which had severely reduced hypocotyl341 elongation in both treatments (Fig. 8C).342 The GA biosynthesis (ga1-3) and insensitive (gai) mutant both showed a complete343 lack of hypocotyl elongation in both treatments (Fig. 8, D and E). We also tested the344 GA biosynthesis mutant ga20ox1-3, since it was identified as a ‘common Up’ gene,345 induced in response to both treatments (Fig. 5A). The ga20ox1-3 mutant showed a346 significantly reduced elongation phenotype in both treatments compared to the wild347 type response (Fig. 8F).348 The BR receptor (bri1-116) and biosynthesis (dwf4-1) mutants both showed severe349 hypocotyl elongation phenotypes, and did not respond to either treatment (Fig. 8, G350 and I). In another biosynthesis mutant, rot3-1, while the ethylene elongation351 response was absent there was a severely reduced shade response (Fig. 8H). Two352 BR-metabolism related genes were identified in the common Up set (Fig. 5A):353 BR6OX1 and BAS1. The bas1-2 mutant showed constitutive elongation in all354 treatments ((Fig. 8J) confirming a negative role of BR catabolism through BAS1 in355 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 12.
    12 hypocotyl elongation control.Although the BR biosynthetic mutant br6ox1 (cyp85a1-356 2) mutant did not show any phenotypic alteration (Fig. 8K), a double mutant of357 BR6OX1 and BR6OX2 (cyp85a1cyp85a2) showed a complete lack of elongation in358 response to both ethylene and shade (Fig. 8L).359 360 361 Discussion362 Accelerated shoot elongation is a common mode of stress escape that allows plants363 to grow away from stressful conditions (Pierik and Testerink, 2014). Stress escape364 does, however, come at an energetic cost and is only beneficial if improved365 conditions are achieved. Here our goal was to establish to what extent shade and366 ethylene elicit similar responses through shared or distinct molecular pathways. In367 our study we found distinct elongation kinetics in ethylene and shade for Arabidopsis368 hypocotyls, differing in both temporal regulation and the degree of response. Shade369 treatment evoked a rapid, strong and persisting hypocotyl elongation, whereas370 ethylene initially inhibited elongation and only in the first night period started to371 promote hypocotyl length (Fig. 1). In both treatments, hypocotyl growth involved372 enhanced epidermal cell elongation. Previous studies have shown that low R:FR373 induces ethylene biosynthesis in Arabidopsis (Pierik et al., 2009) and it could be374 argued that the shade response might act through ethylene. However, ethylene375 marker genes were not induced in shade, and the ethylene-insensitive ein3eil1376 mutant retained a full response to shade (Supplemental Fig. S4), ruling out a role for377 ethylene in the shade response. Interestingly, combining shade and ethylene378 treatments did not lead to an additive response and instead dampened shade-379 induced hypocotyl elongation (Supplemental Fig. S1). The growth inhibitory effect of380 ethylene under shaded conditions could function similar to its effects in limiting381 hypocotyl elongation in the dark i.e. via induction of negative growth regulators such382 as ERF1 (Zhong et al., 2012). Transcriptome characterisation of the elongating383 hypocotyl upon exposure to single shade and ethylene stresses indicated384 considerable overlap between the two treatments. Thus, a large portion of DEGs385 under both treatments may contribute to similar processes implying that they target386 shared genetic components but have treatment-specific upstream regulatory factors.387 388 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 13.
    13 Hypocotyl growth promotionand photosynthesis repression occur389 concurrently under ethylene and shade390 By identifying gene clusters with expression patterns closely matching the distinct391 ethylene and shade growth kinetics, we identified positive and negative clusters for392 the respective treatments. These clusters were also among the bigger clusters that393 contributed to most of the transcriptomic changes, suggesting that a large part of394 transcriptomic response are associated with the hypocotyl growth and concurrent395 biological processes. Functional enrichment analysis for the Common Up set (shared396 between positive clusters of ethylene and shade) (Fig. 4), suggested an involvement397 of growth promoting genes. Cell wall genes are all involved in mediating cellular398 expansion in growing hypocotyls. However, they need to be controlled by either the399 environmental signal directly or by upstream factors in the signal transduction400 pathway. The Common Down set (shared between negative clusters of ethylene and401 shade) (Fig. 4), was highly enriched in photosynthesis-related terms and proteins.402 The effects of ethylene on photosynthesis can be positive or negative depending on403 the context (Iqbal et al., 2012; Tholen et al., 2007). Low R:FR treated stems of404 tomato showed reduced expression of photosynthetic genes (Cagnola et al., 2012).405 This reduction was mainly due to a decrease in expression of Calvin cycle genes,406 which we also observed for our Common Down set (Supplemental Table S1). In407 addition, under ethylene specifically, Photosystem II and I genes were mostly408 repressed. Thus acceleration of hypocotyl elongation is accompanied by repression409 of genes associated with non-elongation processes like metabolism and410 photosynthesis. This was also shown to be true for low R:FR treated elongating411 stems of tomato (Cagnola et al., 2012). Light capture and carbon fixation are412 minimized and energy is apparently invested in stimulating growth (Sulpice et al.,413 2014; Henriques et al., 2014; Lilley et al., 2012). It would be interesting to investigate414 how photomorphogenic responses are associated with and influence photosynthesis415 and growth promotion.416 417 Convergence of signaling pathways in response to ethylene and shade in418 control of hypocotyl elongation419 In shade avoidance responses, photoreceptors like phyB and cry1/2 would regulate420 the elongation phenotype via control of Phytochrome Interacting Factor (PIF) levels.421 However, since these are photoreceptors, it seems unlikely that these proteins422 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 14.
    14 themselves would integrateinformation from the ethylene pathway as well (Park et423 al., 2012; Li et al., 2012). It was shown by van Veen et al. (2013), that in the424 submerged petioles of R. palustris (which displays petiole elongation under complete425 submergence), early molecular components of light signalling (KIDARI, COP1, PIFs,426 HD-ZIP IIs) are induced by ethylene independently of any change in light quality.427 Over expression of PIF5 on the other hand leads to increased ethylene production in428 etiolated Arabidopsis seedlings, causing inhibition of hypocotyl length (Khanna et al.,429 2007). Interestingly, the downstream ethylene signal transduction protein EIN3 was430 shown to physically interact with PIF3 (Zhong et al., 2012). We, therefore, suggest431 that ethylene and shade might both induce this shared gene pool by, for example,432 targeting (different) members of the PIF family of transcription factors. Since different433 PIFs likely regulate the expression of at least partly shared target genes (Leivar and434 Monte, 2014), this would explain our observed partial overlap in the transcriptional435 response to shade and ethylene. PIFs are also known to directly bind and regulate436 expression of other transcription factors like homeodomain (HD) TFs (Capella et al.,437 2015; Kunihiro et al. 2011) in the control of shade avoidance responses. Indeed, our438 TAIR motif analysis hinted towards the presence of significantly enriched binding439 signatures of PIF/MYC proteins (CACATG) as well as HD proteins (TAATTA) in the440 upstream promoter sequences of the Common Up set genes (Pfeiffer et al., 2014;441 Kazan and Manners, 2013; Supplemental Fig. S5).442 Several potential transcriptional regulators were identified in the narrowed down443 Common Up gene set. A growth-promoting role of KIDARI in regulating elongation in444 response to shade and ethylene was suggested previously (Hyun and Lee 2006; van445 Veen et al., 2013). Upregulation of another bHLH encoding gene and a negative446 regulator of elongation, IBL1 was observed for both treatments (Fig. 6C)). While447 PIF4 induces IBH1 and IBL1, IBH1 represses PIF4 targets (Zhiponova et al., 2014).448 IBH1 and its homolog IBL1 collectively regulate expression of a large number of BR-,449 GA- and PIF4-regulated genes and this might their mode of action in shade- and450 ethylene-induced hypocotyl elongation. In addition to these bHLH proteins, we show451 that the ZF-HD transcription factor ATHB28 is also involved in regulating hypocotyl452 elongation under ethylene and shade (Fig. 6A). Hong et al. (2011) showed that453 another ZF-HD protein, MIF1 interacts strongly with four other ZF-HD proteins454 including ATHB33 and ATHB28. This leads to non-functional MIF1-ATHB455 heterodimers and inhibition of e.g. ATHB33-regulated expression and growth456 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 15.
    15 promotion. Transcriptomics datafor 35S:MIF1 (displaying short hypocotyl457 phenotype), shows downregulation of auxin, BR and GA responsive genes and458 upregulation of ABA genes (Hu and Ma, 2006). We can speculate that MIF1 on one459 hand and ATHB33 and ATHB28 on the other hand, might target the same set of460 hormone genes, but in an opposite manner, to control growth. What remains to be461 studied is how ethylene and shade regulate ZF-HD transcription factors and this will462 be an important topic for future studies.463 Well-established targets for above-mentioned PIFs and HD TFs are various aspects464 of auxin signalling and homeostasis, such as YUCCA biosynthetic enzymes and465 AUX/IAA proteins for signalling (Kunihiro et al. 2011; Li et al., 2012; Sun et al., 2012;466 De Smet et al., 2013). Our list of candidate genes (Fig. 5) contained auxin-467 responsive transcriptional regulator IAA3 and many of the auxin-responsive SAUR468 genes which have been shown to positively modulate hypocotyl elongation (Kim et469 al., 1998; Sun et al., 2012; Chae et al., 2012; Spartz et al., 2012) and may act470 individually or in concert to regulate the phenotype. With reference to elongation471 responses under shade in Arabidopsis seedlings, auxin seems to play a major role.472 An increase in free auxin levels and its transport towards epidermal cells in hypocotyl473 is necessary for low R:FR-mediated hypocotyl elongation (Tao et al., 2008;474 Keuskamp et al., 2010; Zheng et al., 2016). The importance of YUCCAs and TAA1 in475 low R:FR responses has been previously demonstrated (Li et al., 2012). It is476 generally assumed that auxin synthesized in the cotyledons is required to regulate477 hypocotyl elongation in response to e.g. low R:FR light conditions (Procko et al.478 2014). Indeed, cotyledons are key regulators of hypocotyl elongation in a479 phytochrome-dependent way (Endo et al., 2005; Warnasooriya and Montgomery,480 2009; Estelle, 1998; Tanaka et al., 2002). In our data, hormonometer analysis481 identified strong induction of auxin-associated genes in the cotyledons in both482 treatments (Fig. 7). We speculate that the physiological regulation of hypocotyl483 elongation in our study depends on cotyledons via auxin dynamics. However, we484 also show that auxin is certainly not the only shared physiological regulator between485 the ethylene and shade response.486 GA20OX1 and BR6OX1 expression were up-regulated in patterns that closely487 matched the hypocotyl elongation profiles (Fig. 5A), and hormonometer analysis also488 revealed enrichment of GA and BR hormonal signatures in ethylene and shade489 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 16.
    16 exposed hypocotyls. (Fig.7). The positive role of GA in flooding-associated shoot490 elongation (Voesenek and Bailey-Serres, 2015) and shade avoidance (Djakovic-491 Petrovic et al., 2007) is well established. It is well known that GA20OX1 specifically492 affects plant height without having any other major phenotypic effects (Barboza et493 al., 2013; Rieu et al., 2008), and it has been shown to be involved in shade494 avoidance (Nozue et al. 2015; Hisamatsu et al. 2005). In our data, ga20ox1 knockout495 showed reduced elongation to shade as well as ethylene, extending its function from496 controlling shade avoidance to ethylene mediated elongation responses (Fig. 8F).497 GA biosynthesis via GA20OX1 can be induced by brassinosteroids, suggesting a498 possible cross-talk between the two growth-promoting hormones (Unterholzner et499 al., 2015). Although future studies are needed to establish if this crosstalk occurs500 under the conditions tested here, we do confirm that BR is an important hormone501 involved in both the responses since several BR mutants showed disturbed502 elongation responses to ethylene and shade (Fig. 8G-8L). Interestingly, also auxin503 and brassinosteroids have partially overlapping roles in hypocotyl elongation control504 (Chapman et al., 2012; Nemhauser et al., 2004), further extending the crosstalk505 towards a tripartite network. Among the BR mutants tested is the cyp85a1cyp85a2506 mutant, encoding a double mutant for BR6OX2 and BR6OX1 which showed a507 complete lack of elongation to both treatments (Fig. 8L) similar to a BRZ treatment508 (Figs. 7F). BR6OX1 was one of the direct candidate genes identified from the509 transcriptomics analysis (Figure 5A). A tripartite bHLH transcription factor module510 consisting of IBH1, PRE and HBI1, has been previously implicated in regulating cell511 elongation in response to hormonal and environmental signals (Bai et al., 2012).512 Several BR biosynthesis and signaling genes are direct targets of HBI1, including513 BR6OX1 (Fan et al. 2014), indicating the possible involvement of this bHLH514 regulatory module in promoting BR responses during shade and ethylene exposure.515 Why is there be such an elaborate network of regulators and even hormones516 involved in controlling unidrectional cell expansion in hypocotyl growth responses?517 To achieve a controlled growth, feedback loops are likely required, and crosstalk518 between different routes are probably a necessity to deal with multiple environmental519 inputs simultaneously. We found BAS1 transcriptional upregulation in hypocotyls in520 response to ethylene and shade. BAS1 may act to balance the hypocotyl growth521 promotion mediated by brassinosteroids (castasterone (CS) and brassinolide (BL))522 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 17.
    17 as it inactivatesboth CS and BL (Neff et al., 1999; Turk et al., 2005). In shade523 avoidance research, likewise, HFR1 is induced by PIFs to suppress the growth524 promotion induced the same PIF proteins, and putative control of DELLAs would525 modulate GA responses.526 Conclusion527 Hypocotyl elongation in response to ethylene and shade treatments is likely528 regulated at the upstream level by (a) a bHLH module consisting of positive growth529 regulators, PIFs (PIF3 in ethylene and PIF4 and PIF5 in shade) and inhibitory factors530 like IBL1 and (b) a homeodomain module, where ZF-HD TFs like ATHB28 may531 either act in parallel to the bHLH TFs or are regulated by PIFs (similar to induction of532 HD-ZIP TFs) to transcriptionally target genes related to the growth promoting533 hormone module (auxin, BR and GA), as hinted by promoter motif analysis. We534 hypothesize that in Arabidopsis seedlings, shade and ethylene stimulate auxin535 synthesis in the cotyledons, which is then transported to the hypocotyl to epidermal536 cell layers where it interacts with both GA and BR to co-ordinately induce hypocotyl537 elongation. This increased auxin response, indicated by elevated SAUR levels, and538 likely increased levels of GA and BR as indicated by increased GA20OX1 and539 BR6OX expression in the hypocotyl, likely act to induce unidirectional epidermal cell540 wall elongation via upregulation of genes encoding cell-wall modifying proteins,541 which promote cellular expansion leading to hypocotyl elongation.542 543 MATERIALS AND METHODS544 Plant Material and Growth Conditions545 Around 30 Arabidopsis thaliana (Col-0) and mutant seeds were sown per agar plate546 containing 1.1 g L-1 Murashige-Skoog (1/4 MS) and 8 g L-1 Plant-agar (0.8%w/v)547 (both Duchefa Biochemie, The Netherlands). Mutants or overexpression lines used548 in this work were: pin3pin4pin7 (Blilou et al., 2005); wei8-1 (Stepanova et al., 2008),549 tir1-1 (Ruegger et al., 1998), dwf4-1 (Azpiroz et al., 1998), rot3-1 (Kim et al., 1998),550 ga1-3 (Wilson et al., 1992), gai (Talon et al., 1990), ein3eil1 (Binder et al., 2004);551 bri1-116 (van Esse et al., 2012); ibl1 and IBL1OE (Zhiponova et al., 2014);552 cyp85a1/cyp85a2 and cyp85a1-2 (Nomura et al., 2005); bas1-2 (Turk et al., 2005);553 ga20ox1-3 (Hisamatsu et al., 2005).554 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 18.
    18 ibl1 (N657437), cyp85a1(N681535), wei8-1 (N16407) and ga20ox1-3 (N669422)555 were obtained from NASC seed-stock centre; bri1-116 was kindly provided by Sacco556 de Vries Lab, Wageningen University while cyp85a1/cyp85a2 and dwf4-1 were557 kindly provided by Sunghwa Choe Lab, Seoul National University. IBL1OE558 overexpression lines were kindly provided by the Jenny Russinova lab (VIB Ghent,559 Belgium). bas1-2 mutant was kindly provided by Michael Neff lab (Washington State560 University, USA). Some GA mutants used were in the Ler background. All other561 mutants were in the Col-0 background. After stratification at 4°C for 3 d in the dark,562 seeds were transferred for 2 h to control light conditions (see below) and then kept in563 dark (at 20°C) again for another 15 h. Subsequently seedlings were allowed a period564 of 24 h growth under control light conditions in Short-Day photoperiod conditions (15565 h dark/9h light) before being transferred to 22.4 L glass desiccators with air-tight lids566 for specific treatments. Col-0 genotypes were grown at 21 ± 1 °C. Ler genotypes567 were grown at 19 ± 1 °C (Supplemental Figure S6).568 For athb28 (GK-326G12), lines were obtained from NASC (UK). Genotyping was569 performed using the following primers: for athb28, athb28_fwd570 (CTAAGTACCGGGAATGTCAGAAG); athb28_rev (TAACCAACTGAGCTATTCC571 AGCTA) and LB primer o8474: (ATAATAACGCTG CGGA CATCTACATTTT). For572 verifying transcript levels, ATHB28_fwd (GGAGAAGATGAAGGAATTTGCA) and573 ATHB28_rev (TGTTTCTCTTCA TTGCTTGCT) were used.574 575 Treatments576 Control and ethylene desiccators were kept in control light conditions577 (Photosynthetically Active Radiation, PAR = 140 μmol m-2 s-1 , blue light (400 nm-500578 nm) = 29 μmol m-2 s-1 and R:FR = 2.1). Ethylene treatments were started by injecting579 ethylene into the desiccators (with 1 µl L-1 final concentration in the dessicator) and580 levels were verified with a Gas Chromatograph (GC955; Synspec, The Netherlands).581 Shade treatment was started by putting desiccators under a single layer of Lee Fern582 Green Filter (Lee Hampshire, UK) (PAR = 40 μmol m-2 s-1 , blue light (400 nm-500583 nm) = 3 μmol m-2 s-1 and R:FR = 0.45). For growth curve experiments, two plates584 with 15 seedlings per treatment per genotype distributed over two desiccators were585 used. For mutant analyses, one plate with 15 seedlings per treatment per genotype586 was used.587 588 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 19.
    19 Imaging and HypocotylLength Measurements589 For hypocotyl elongation assays, experiments were replicated twice. Seedling plates590 were collected from the dessicators. Seedlings were flattened on the agar plates to591 reveal the full extent of their hypocotyl, and images of the seedlings were obtained592 by scanning the plates using EPSON Perfection v370 Photo scanner (Epson Europe593 BV, The Netherlands). Hypocotyl lengths were measured from these images using594 ImageJ (http://rsbweb.nih.gov/ij/) and values (per data point) were obtained for n ≥595 30-60 seedlings. Final values for the data was obtained by taking mean ± S.E. for596 values from the two independent experiments.597 598 Epidermal Cell Length Measurements599 Seedlings were mounted on microscopic slides and covered with a cover slip.600 Hypocotyl epidermal cells were imaged using Olympus AX70 (20x objective, Nikon601 DXM1200 camera), after which cell lengths were measured using ImageJ software602 tool (http://rsbweb.nih.gov/ij/).603 604 Microarray Tissue Harvest, RNA Isolation and Array Hybridization605 Seedlings were dissected using BD PrecisionGlide Hypodermic 27 Gauge 1 1/4"606 Grey Needle with outer diameter = 0.41 mm (Becton Dickinson B.V., The607 Netherlands) to separately harvest the hypocotyl and cotyledon + shoot apical608 meristem (hereafter termed “cotyledon”). The roots were discarded. Samples were609 harvested at 1.5 h, 13.5 h and 25.5 h after the start of the treatments. For 13.5 h time610 point, which occurs during the dark period, dissection was carried out under low611 intensity green safelight (≈ 5 μmol m-2 s-1 ). For minimizing the effects of green light612 on gene expression, seedlings were kept in the dark until dissected and dissection613 was carried out in several rounds with each round involving maximum 2-3 seedlings.614 In total, 3 replicate experiments were carried out. In each replicate experiment,615 tissues were harvested from two independent technical replicates (each with 25616 seedlings from the two technical replicate plates as mentioned in “Treatments”617 section above). Harvested material was immediately frozen in liquid nitrogen and618 stored at -80°C until further use.619 Frozen tissue was ground using tissue lyser and total RNA was isolated using620 RNeasy Mini Kit (QIAGEN, Germany). QIAGEN RNase-Free DNase set was used to621 eliminate Genomic DNA contamination by performing on-column DNase digestion.622 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 20.
    20 Extracted RNA wasverified (for quality check) and quantified using NanoDropTM ND-623 1000 Spectrophotometer (Isogen Life Science, De Meern, The Netherlands).624 RNA samples were sent to AROS (AROS Applied Biotechnology A/S, Aarhus,625 Denmark). RNA was repurified on low-elution QIAGEN RNeasy columns, re-626 quantified with NanoDropTM 8000 UV-Vis Spectrophotometer and checked for quality627 with Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA samples628 with RNA Integrity Number (RIN) value of > 7.5 were considered for further use. 50629 ng RNA from each of the two independent technical replicates was mixed in the ratio630 1:1 and the pooled sample was considered as one biological replicate for631 hybridization experiments. Thus, 3 biological replicates were obtained for the 3632 replicate experiments. 100 ng of RNA sample was processed for cDNA synthesis,633 fragmentation and labelling was carried out for the RNA samples. The samples were634 hybridized to the Affymetrix Gene 1.1 ST Arabidopsis Array Plate and washed on an635 Affymetrix GeneAtlas system followed by scanning of arrays at AROS Applied636 Biotechnology (http://arosab.com/services/microarrays/gene-expression/).637 638 Microarray Data Analysis639 Scanned arrays in the form of .cel files (provided by AROS) were checked for quality640 control using Affymetrix Expression Console Software and an in-house script in R641 and Bioconductor (http://www.r-project.org./; http://www.bioconductor.org/)642 (Bioconductor “oligo” and “pd.aragene.1.1.st” ). Bioconductor was used for Robust643 Multi-array Average (RMA) normalization of raw data at Gene level to obtain644 summarized signal intensity values for all genes present on the array (log2 format).645 Principal component analysis was carried out using Affymetrix Expression Console646 Software (http://www.affymetrix.com/) and dendrogram of all microarray samples647 according to the mean signal intensity values was generated using R (“plot”648 package). Bioconductor (“Limma” package) was used for carrying out differential649 expression analysis.650 651 Temporal Clustering And Bioinformatics Analysis652 We clustered the list of total DEGs (defined as number of DEGs that were regulated653 at atleast one of the three time points) under ethylene and shade based on positive654 or negative regulation at each of the three time-points. With three time-points and655 two directions of expression (positive or negative), 23 = 8 possible trends can occur656 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 21.
    21 and accordingly asmany clusters were obtained. DEGs were clustered temporally657 based on log2FC.658 659 MapMan bin overrepresentation using hypergeometric test was done using R (“stats”660 package) and adjusted p-values for the statistical significance of enrichment were661 converted into negative logarithm score and plotted as a heatmap. A score above662 1.3 for this score was considered significant.663 GeneCodis (http://genecodis.cnb.csic.es/compareanalysis) webtool was used for GO664 analysis of different sets obtained from venn of Positive clusters and of Negative665 Clusters. A score above 1.3 for negative log of adjusted p-values was considered666 significant.667 668 LogFC Filter and Gene Classification669 In order to narrow down the genes for functional characterization (from the list of670 classified genes), we utilised a logFC filter. To narrow down the Common Up set, a671 filter of log2FC < 0.5 at 1.5 h and log2FC ≥ 0.5 at both 13.5 h and 25.5 h for ethylene672 and log2FC ≥ 0.5 at both 1.5 h and 25.5 h for shade was applied. To narrow down673 the Common Down set, we applied a filter of log2FC > - 0.5 at 1.5 h and log2FC ≤ -674 0.5 at both 13.5 h and 25.5 h under ethylene and of log2FC ≤ - 0.5 at both 1.5 h and675 25.5 h under shade. These resulting group of genes were then classified based on676 MapMan based classification for the terms: “RNA.regulation of transcription”, “Cell677 wall”, “Signalling” and “Hormone metabolism”. Genes from Plant TFDB678 (http://planttfdb.cbi.pku.edu.cn/index.php?sp=Ath) and Potsdam TFDB679 (http://plntfdb.bio.uni-potsdam.de/v3.0/index.php?sp_id=ATH) were also included as680 a source for gene-classification to select for additional transcriptional regulators.681 682 Hormone Correlational Analysis683 Hormonometer software (http://genome.weizmann.ac.il/hormonometer/) was used to684 evaluate transcriptional similarities between the transcriptome data obtained here685 and the published, indexed list of those elicited by exogenous application of plant686 hormones. Arabidopsis gene locus IDs were converted to Affymetrix GeneChip687 identifiers using the “at to AGI converter” tool (The Bio-Analytic Resource for Plant688 Biology, http://bar.utoronto.ca/). We used the new Affymetrix aragen1.1st arrays (28k689 genes) for transcriptomics but the hormonometer data is based on 3’ ATH1 arrays690 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 22.
    22 (22k genes). Accordingly,many locus IDs could not be included (those which were691 newly incorporated in the aragene1.1st arrays) in this analysis. In few other cases692 where multiple ATH1 GeneChip IDs for one locus ID was obtained, all IDs were693 retained.694 695 Pharmacological Treatments696 Auxin transport was inhibited by use of 25 µM NPA (Duchefa Biochemie, The697 Netherlands) (Petrásek et al., 2003). Auxin perception was blocked by use of 100 µM698 PEO-IAA (Hayashi et al., 2008). Auxin biosynthesis was blocked by use of 50 µM699 yucasin (Nishimura et al., 2014). 2 µM brassinazole (TCI Europe, Japan) was used700 to inhibit BR biosynthesis (Asami et al., 2000). 2 µM paclobutrazol (Duchefa701 Biochemie, The Netherlands) was used to inhibit GA biosynthesis (Rademacher,702 2000). All chemicals were dissolved in respective solvents (DMSO or ETOH) with703 final solvent concentration in media < 0.1% to prevent toxicity due to solvents. All704 chemicals were applied by pipetting 150 µl of chemical solutions or mock solvents as705 a thin film over the MS-agar media in the petri plates and then allowing the solution706 to diffuse through the medium before starting the treatments.707 708 GUS Staining and Imaging709 For GUS assays, seedlings were transferred immediately from treatments to a GUS710 staining solution (1 mM X-Gluc (5-bromo-4-chloro-3-indolyl-D-glucoronide) (Duchefa711 Biochem, The Netherlands) in 100 mM Sodium phosphate buffer (pH=7.0) along with712 0.1 % Triton X-100, 0.5 mM each of Potassium ferrocyanide (K4Fe(CN)6 and713 Potassium ferricyanide (K3Fe(CN)6 and 10 mM of EDTA (Merck Darmstadt,714 Germany)) and kept at 37°C overnight. Seedlings were bleached in 70% ethanol for715 1 day before capturing images.716 717 Statistical Analysis and Graphing718 1-way ANOVAs followed by Tukey's HSD Post-Hoc tests were performed on the719 measurements obtained in hypocotyl length/cotyledon area kinetics to assess720 statistically significant differences between mean hypocotyl length/cotyledon area721 under ethylene or shade relative to control at the same time point.722 A two-way ANOVA followed by a Tukey's HSD Post-Hoc test was used for pairwise723 multiple comparison. For hypocotyl elongation assays, statistical significance was724 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 23.
    23 indicated by theuse of different letters. All statistical analyses were done in the R725 software environment. Graphs were plotted using Prism 6 software (GraphPad726 Software, USA).727 728 Accession numbers729 .CEL files utilised in the organ-specific transcriptomics for hypocotyl and cotyledon730 tissues are posted with the GEO accession series GSE83212.731 732 Supplemental data733 The following materials are available in the online version of this article.734 Supplemental Figure S1. Hypocotyl elongation response in wild-type Col-0 under735 control, ethylene, shade and combination (ethylene + shade) treatments.736 Supplemental Figure S2. Venn diagram of gene intersection between up- and737 down- regulated DEGs of ethylene and shade separately at 1.5 h.738 Supplemental Figure S3. Genotyping and transcript level verification for (A)-(D)739 athb28.740 Supplemental Figure S4. Hypocotyl elongation response in ethylene signalling741 mutant, ein3eil1 under ethylene and shade.742 Supplemental Figure S5. TAIR motif analysis for Common Up and Down genesets.743 Supplemental Figure S6. Hypocotyl length of Ler under control and ethylene744 conditions when grown at 220 C day / 200 C night and 200 C day / 180 C night745 temperature regime.746 Supplemental Table S1. Photosynthesis gene proportion in genesets from Venn of747 negative clusters.748 ACKNOWLEDGMENTS749 We would like to thank all the group members of Plant Ecophysiology, Utrecht750 University, The Netherlands for their help in the harvest for the transcriptomics751 experiment.752 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 24.
    24 753 FIGURE LEGENDS754 Figure 1.Physiological responses, hypocotyl length and epidermal cell length755 kinetics under ethylene and shade in Arabidopsis (Col-0) seedlings. 1-day old756 seedlings were exposed to control conditions (PAR = 140 μmol m-2 s-1 , blue light =757 29 μmol m-2 s-1 and R:FR = 2.1), elevated ethylene (1 µl L-1 , PAR = 140 μmol m-2 s-1 ,758 blue light = 29 μmol m-2 s-1 and R:FR = 2.1) or shade (PAR = 40 μmol m-2 s-1 , blue759 light = 3 μmol m-2 s-1 and R:FR = 0.45). A, Figure shows representative seedlings760 displaying typical phenotypes after 96 h of exposure to control, ethylene or shade761 conditions. B, Mean hypocotyl lengths at 0 h, 24 h, 48 h, 72 h and 96 h under control762 (open circle), ethylene (closed circle) and shade (open triangle) are shown. C, Rate763 of increase in hypocotyl length. Differences between mean hypocotyl lengths of764 subsequent time points averaged over 1 d time interval for control, ethylene and765 shade are shown. D, Detailed hypocotyl length kinetics. 1-day old seedlings were766 exposed to control (open circle), ethylene (closed circle) and shade (open triangle)767 and measured at 3 h time intervals (s, e: first time point at which shade (s) or768 ethylene (e) treatment lead to significantly longer hypocotyls). Data are mean ± S.E.769 (n=60) for (A)-(D). Shaded area denotes the 15 h dark period in the 15 h dark/9 h770 light photoperiodic growth condition. e and s denote the first point of statistically771 significant differences in hypocotyl length or cotyledon area relative to control for772 ethylene and shade respectively. E, Epidermal cell length kinetics. 1-day old773 seedlings were exposed to control, ethylene or shade. Mean cell length ± S.E. (n ≥774 10) for epidermal cells of the Arabidopsis hypocotyl at 0 h control (black line) and at775 3 h, 7.5 h, 15 h and 27 h control (orange line), ethylene (blue line) and shade (green776 line) is shown. Apex denotes the hypocotyl-cotyledon junction and base denotes the777 hypocotyl-root junction.778 Figure 2. Overall description of microarray data. A, Principal component analysis779 (PCA) and hierarchical clustering (HC) was used to describe the structure in the780 microarray data. Expression intensities for all genes on the array for all 54 hypocotyl781 and cotyledon samples (3 time points, 3 treatments and 3 replicates) were projected782 onto the first three principal components. B, Hierarchical clustering was used to783 group 18 main samples (according to mean expression intensity of 3 replicates for784 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 25.
    25 each main sample)into a dendrogram. C, Distribution of differentially expressed785 genes (DEGs) in hypocotyl and cotyledon samples at three time-points in response786 to ethylene and shade. DEGs obtained for each time-point were plotted separately787 as up-regulated, down-regulated (adjusted p-value ≤ 0.01 and log2FC > or < 0) or788 non-significant (adjusted p-value > 0.01). Bar length denotes total DEGs obtained789 after combining DEGs from all 3 time points.790 Figure 3. Temporal gene expression clusters for ethylene (A) and shade (D);791 hypocotyl growth curve for ethylene (B) and shade (E); clusters with gene expression792 matching hypocotyl growth kinetics in ethylene (C) and shade (F). Heatmap for793 temporal clusters (A, D) based on the log2FC at the three microarray time points794 (grey box represents dark; arrows indicate heatmap time-points and treatments795 include control (open circle), ethylene (closed circle), shade (open triangle)). Yellow796 denotes up-regulation and blue denotes down-regulation. Two gene expression797 clusters (C, F) with mean log2FC temporal pattern resembling the hypocotyl length798 kinetics (B, E) were named positive clusters. G, Heatmap for hypergeometric799 enrichment of selected MapMan bins for temporal clusters under ethylene and800 shade. Horizontal-axis denotes the cluster number. More intense colours indicate801 higher statistical significance. Grey color indicates non-significant score or absence802 of genes in the bin. H, Venn intersection for positive clusters (clusters with gene803 expression pattern matching the hypocotyl length kinetics) from ethylene and shade804 to obtain “Common Up” genes. I, Venn intersection for negative clusters (mirror805 image to Positive clusters) from ethylene and shade to obtain “Common Down”806 genes.807 Figure 4. Gene Ontology (GO) enrichment analysis using GeneCodis for positive808 and negative clusters. Adjusted p-values for statistical significance of GO enrichment809 were converted into negative logarithm score (base10) (> 1.3 are considered810 significant). Heatmap colours denote this score and more intense colours indicate811 higher statistical significance. White color indicates non-significant score or absence812 of genes in the GO terms.813 814 Figure 5. Heatmap of (A) Common Up and (B) Common Down set of genes815 classified into the categories: transcriptional regulator, hormone metabolism,816 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 26.
    26 signalling and cellwall genes after application of a log2fold-change (log2FC) filter.817 Log2FC at the three time-points 1.5 h, 13.5 h, 25.5 h for ethylene and shade818 microarray dataset identified in the color scheme of the heatmap. Genes were819 categorized according to Mapman bin gene classification (shown on left side).820 821 Figure 6. Hypocotyl length measurements for (A) athb28 (B) ibl1 (C) IBL1-OE822 following 96 h of control, ethylene and shade treatments. Data represents mean ±823 S.E. (n=30 seedlings). Different letters above the bars indicate significant differences824 (2-way ANOVA followed by Tukey’s HSD Post-Hoc pairwise comparison).825 826 Figure 7. A, Identification of enriched hormonal signatures in the ethylene- and827 shade-induced Arabidopsis transcriptome. Ethylene and shade-induced hypocotyl828 and cotyledon transcriptomes were analyzed for hormonal signatures using the tool829 Hormonometer (Valdorsky et al., 2009) to establish correlations with expression data830 in an established hormonal transcriptome database. Positive correlations were831 colored yellow and negative correlations blue. Significant correlations were identified832 with absolute correlation values of 0.3 and higher. Numbers in the cells represent the833 exact correlation values. Rows denote hormone treatments that are indicated by the834 name of the hormone and the duration of hormone treatment. Columns denote835 ethylene and shade transcriptome in the hypocotyl and cotyledon at the three time-836 points of tissue harvest. The magnitude of correlation in gene expression is indicated837 by the color scale at top right side. B, Effect of auxin transport inhibitor NPA (25 µM),838 IAA (10 µM), NPA (25 µM) + IAA (10 µM) and auxin perception inhibitor PEO-IAA839 (100 µM) on GUS staining of the pIAA19:GUS lines. For NPA and PEO-IAA effect in840 GUS assay, seedlings were exposed to 2 days of treatment conditions. Arabidopsis841 (Col-0) seedlings were treated with chemical inhibitors for (C) auxin transport (NPA),842 (D) auxin biosynthesis (Yucasin), (E) auxin perception (PEO-IAA), (F)843 brassinosteroid biosynthesis (BRZ) and (G) gibberellin biosynthesis (PBZ) at the844 indicated concentrations in the legend and length was measured following 96h of845 ethylene and shade. Hypocotyl length was measured following 96 h of ethylene and846 shade. Mean ± S.E. was calculated for 30 seedlings. Different letters above the bars847 indicate significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-848 Hoc pairwise comparison. Abbreviations: PEO-IAA is α-(phenylethyl-2-one)-indole-3-849 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 27.
    27 acetic acid; NPAis 1-N-Naphthylphthalamic acid; BRZ is Brassinazole; PBZ is850 Paclobutrazol.851 852 Figure 8. Hypocotyl elongation response in response to ethylene and shade in (B)–853 (D) auxin, (E)–(G) gibberellin (GA) and (H)–(J) brassinosteroid (BR) mutants. Mean854 ± S.E. was calculated for 30 seedlings. Different letters above the bars indicate855 significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-Hoc856 pairwise comparison.857 858 LITERATURE CITED859 860 Abdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley861 Interdisciplinary Reviews: Computational Statistics, 2(4), 433-459.862 Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T.,863 Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant864 Responses to Environmentally Activated Phytohormonal Signals. Science 311:865 91–94.866 Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S.,867 Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of868 brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant869 Physiol. 123: 93–100.870 Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis871 brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell872 10: 219–230.873 Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic874 helix-loop-helix cascade controls cell elongation downstream of multiple875 hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:876 4917-4929877 Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and878 Koornneef, M. (2013). Arabidopsis semidwarfs evolved from independent879 mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and880 barley. Proc. Natl. Acad. Sci. U. S. A. 110: 15818–15823.881 Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B.882 (2004). Short-Term Growth Responses to Ethylene in Arabidopsis. Plant883 Physiol. 136: 2921–2927.884 Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R.,885 Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator886 network controls growth and patterning in Arabidopsis roots. Nature, 433(7021),887 39-44.888 Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J.889 J. (2012). Stem transcriptome reveals mechanisms to reduce the energetic cost890 of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.891 Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis892 thaliana HomeoBox 1 (AtHB1), a Homedomain‐Leucine Zipper I (HD‐Zip I)893 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 28.
    28 transcription factor, isregulated by PHYTOCHROME‐INTERACTING FACTOR894 1 to promote hypocotyl elongation. New Phytologist, 207, 669-682.895 Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade.896 Annu. Rev. Plant Biol. 64: 403–27.897 Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157.898 Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P.,899 and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes900 hypocotyl and stamen filament elongation. Plant J. 71: 684–697.901 Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and902 Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-903 promoting genes through GA-dependent and -independent pathways. PLoS904 One 7: e36210.905 De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers,906 D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS by HD-907 ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009–3019.908 Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007).909 DELLA protein function in growth responses to canopy signals. Plant J. 51: 117–910 126.911 Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster912 analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci.913 U. S. A. 95: 14863–14868.914 Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005).915 Phytochrome B in the Mesophyll Delays Flowering by Suppressing916 FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant917 Cell 17: 1941–1952.918 Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant919 Cell 10: 1775–1778.920 Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S.,921 Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor922 HBI1 mediates the trade-off between growth and pathogen-associated923 molecular pattern–triggered immunity in Arabidopsis. The Plant Cell Online,924 26(2), 828-841.925 Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu,926 P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011).927 Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high928 temperature. Proc. Natl. Acad. Sci. U. S. A. 108: 20231–5.929 Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930–944.930 Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H.931 (1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol.932 114: 295–305.933 Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu,934 J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H.,935 Ashikari, M. (2009). The ethylene response factors SNORKEL1 and936 SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030.937 Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki,938 H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate939 interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A.940 105: 5632–5637.941 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 29.
    29 Henriques, R., Bögre,L., Horváth, B., and Magyar, Z. (2014). Balancing act:942 Matching growth with environment by the TOR signalling pathway. J. Exp. Bot.943 65: 2691–2701.944 Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The945 involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole946 elongation of Arabidopsis. Plant Physiol. 138: 1106–1116.947 Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear948 import and DNA binding of the ZHD5 transcription factor is modulated by a949 competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659–1668.950 Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene951 MIF1: Involvement in multiple hormonal regulation of Arabidopsis development.952 Plant J. 45: 399–422.953 Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein,954 represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61:955 283–96.956 Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated957 photosynthesis results from increased nitrogen and sulfur assimilation in958 mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84–959 90.960 Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6:961 686–703.962 Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik,963 R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade964 avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107:965 22740–22744.966 Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J.,967 and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined968 auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208–217.969 Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E.,970 and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts971 on ethylene biosynthesis and phytochrome signaling by distinct mechanisms.972 Plant Cell. 19: 3915-3929.973 Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998).974 Photomorphogenic development of the Arabidopsis shy2-1D mutation and its975 interaction with phytochromes in darkness. Plant J. 15: 61–68.976 Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and977 Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4978 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in979 the coincidence mechanism underlying photoperiodic control of plant growth of980 Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315–1329.981 Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006).982 LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate983 longitudinal cell elongation in Arabidopsis. Development 133: 4305–4314.984 Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development.985 The Plant Cell 26: 56–78.986 Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture.987 Genes Dev. 26: 785–790.988 Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An989 Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and990 Hypocotyl Elongation. Plant Physiol. 160: 2261–2270.991 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 30.
    30 Mickelbart, M. V.,Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic992 mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat.993 Rev. Genet. 16: 237–251.994 Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000).995 Update on Light Signaling Shade Avoidance Responses. Driving Auxin along996 Lateral Routes. Plant Physiol. 122: 621–626.997 Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H.,998 Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999).999 BAS1: A gene regulating brassinosteroid levels and light responsiveness in1000 Arabidopsis. Proc. Natl. Acad. Sci. 96: 15316–15323.1001 Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of1002 brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2: E258.1003 Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y.,1004 Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba,1005 T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin1006 biosynthesis. Plant J. 77: 352–366.1007 Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi,1008 S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome1009 P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280:1010 17873–17879.1011 Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R.,1012 Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance1013 Components and Pathways in Adult Plants Revealed by Phenotypic Profiling.1014 PLOS Genet. 11: e1004953.1015 Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of1016 plants to water stress. Front. Plant Sci. 5(86): 10-3389.1017 Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012).1018 Phytochrome B inhibits binding of phytochrome-interacting factors to their target1019 promoters. Plant J. 72: 537–546.1020 Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and1021 Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux by impairing vesicle1022 traffic? Plant Physiol. 131: 254–263.1023 Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014).1024 Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in1025 Arabidopsis. Mol. Plant 7: 1598–1618.1026 Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and1027 Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes1028 expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815–827.1029 Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions1030 between ethylene and gibberellins in phytochrome-mediated shade avoidance1031 responses in tobacco. Plant Physiol. 136: 2928-2936.1032 Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek,1033 L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor1034 proximity signals independent of gibberellin and DELLA proteins in Arabidopsis.1035 Plant Physiol. 149: 1701–1712.1036 Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New1037 perspectives in flooding research: The use of shade avoidance and Arabidopsis1038 thaliana. Ann. Bot. 96: 533–540.1039 Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from1040 shade, salt and drought. Plant Physiol. 166: 5–22.1041 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 31.
    31 Pierik, R. andDe Wit, M. (2014). Shade avoidance: Phytochrome signalling and1042 other aboveground neighbour detection cues. J. Exp. Bot. 65: 2815–2824.1043 Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014).1044 Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in1045 Brassica rapa. Plant Physiol. 165: 1285–1301.1046 Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van1047 Zanten, M. (2016). Molecular and genetic control of plant1048 thermomorphogenesis. Nature Plants. 2: 15190.1049 Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin1050 Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant1051 Mol. Biol. 51: 501–531.1052 Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong,1053 F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L.,1054 and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and1055 AtGA20ox2 act, partially redundantly, to promote growth and development1056 throughout the Arabidopsis life cycle. Plant J. 53: 488–504.1057 Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M.1058 (1998). The TIR1 protein of Arabidopsis functions in auxin response and is1059 related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198–207.1060 Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R.,1061 Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-1062 mediated petiole elongation in Arabidopsis during shade avoidance involves cell1063 wall modification by xyloglucan endotransglucosylase/hydrolases. Plant Physiol.1064 154: 978–990.1065 Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to1066 flooding stress. Plant Physiol.: pp.00387.1067 Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997).1068 Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl.1069 Acad. Sci. U. S. A. 94: 2756–2761.1070 Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A.,1071 Murphy, A.S., Overvoorde, P.J., and Gray, W.M. (2012). The SAUR191072 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70:1073 978–990.1074 Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y.,1075 Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-1076 Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant1077 Development. Cell 133: 177–191.1078 Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil,1079 R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal1080 regulation of carbon allocation and growth across a wide range of Photoperiods.1081 Mol. Plant 7: 137–155.1082 Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of1083 YUCCA8 expression integrates temperature into the auxin pathway in regulating1084 Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594.1085 Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012).1086 GeneCodis 3: a non-redundant and modular enrichment analysis tool for1087 functional genomics. Nucleic Acids Res. 40: W478–W483.1088 Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-1089 gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis1090 thaliana (L.) Heynh. Planta 182: 501–505.1091 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 32.
    32 Tanaka, S., Nakamura,S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome1092 in cotyledons regulates the expression of genes in the hypocotyl through auxin-1093 dependent and -independent pathways. The Plant Cell Physiol. 43: 1171–1181.1094 Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno,1095 J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballaré, C.L.,1096 Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a1097 New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in1098 Plants. Cell 133: 164–176.1099 Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene1100 insensitivity results in down-regulation of rubisco expression and photosynthetic1101 capacity in tobacco. Plant Physiol. 144: 1305–1315.1102 Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis1103 photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant1104 J. 42: 23–34.1105 Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler,1106 K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015).1107 Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in1108 Arabidopsis. The Plant Cell 27: 2261–2272.1109 Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de1110 Vries, S.C. (2012). A Mathematical Model for BRASSINOSTEROID1111 INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation.1112 Plant Physiol. 160: 523–532.1113 Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der1114 Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8: 462–1115 468.1116 van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-1117 Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R.,1118 Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two1119 Rumex species from contrasting hydrological niches regulate flooding tolerance1120 through distinct mechanisms. The Plant Cell 25: 4691–707.1121 Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and1122 processes : an overview. New Phytol. 206: 57–73.1123 Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009).1124 HORMONOMETER: a tool for discerning transcript signatures of hormone1125 action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796–1805.1126 Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific1127 phytochrome responses using targeted expression of biliverdin reductase in1128 Arabidopsis. Plant Physiol. 149: 424–33.1129 Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required1130 for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100: 403–1131 408.1132 Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K.,1133 Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014).1134 Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell1135 elongation in Arabidopsis through an apparent incoherent feed-forward loop.1136 Proc. Natl. Acad. Sci. U. S. A. 111: 2824–9.1137 Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J.1138 (2016). Local auxin metabolism regulates environment-induced hypocotyl1139 elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.251140 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 33.
    33 Zhong, S., Shi,H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and1141 Guo, H. (2012). A molecular framework of light-controlled phytohormone action1142 in Arabidopsis. Curr. Biol. 22: 1530–1535.1143 1144 1145 1146 1147 1148 1149 www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 34.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 35.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 36.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 37.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 38.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 39.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 40.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 41.
    www.plantphysiol.orgon July 4,2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 42.
    Parsed Citations Abdi, H.,and Williams, L. J. (2010). Principal component analysis. WileyInterdisciplinaryReviews:Computational Statistics, 2(4), 433-459. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant Responses to EnvironmentallyActivated Phytohormonal Signals. Science 311:91-94. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123:93-100. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell 10:219-230. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) Atriple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstreamof multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24:4917-4929 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and Koornneef, M. (2013). Arabidopsis semidwarfs evolved fromindependent mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and barley. Proc. Natl. Acad. Sci. U. S. A. 110:15818-15823. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. (2004). Short-TermGrowth Responses to Ethylene in Arabidopsis. Plant Physiol. 136:2921-2927. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 39-44. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. J. (2012). Stemtranscriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated byPHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation. NewPhytologist, 207, 669-682. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. Annu. Rev. Plant Biol. 64:403-27. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10:e0157. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation. Plant J. 71:684-697. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 43.
    Chapman, E.J., Greenham,K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways. PLoS One 7:e36210. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS byHD-ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64:3009-3019. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). DELLAprotein function in growth responses to canopy signals. Plant J. 51:117-126. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis and displayof genome-wide expression patterns. Proc. Natl. Acad. Sci. U. S. A. 95:14863-14868. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). Phytochrome B in the Mesophyll Delays Flowering by Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant Cell 17:1941-1952. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Estelle, M. (1998). Polar Auxin Transport:NewSupport for an Old Model. The Plant Cell 10:1775-1778. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., KimS., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunityin Arabidopsis. The Plant Cell Online, 26(2), 828-841. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011). Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U. S. A. 108:20231-5. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Franklin, K. A. (2008). Shade avoidance. NewPhytol. 179:930-944. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H. (1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol. 114:295-305. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H., Ashikari, M. (2009). The ethylene response factors SNORKEL1 and SNORKEL2 allowrice to adapt to deep water. Nature 460:1026-1030. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 105:5632-5637. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act:Matching growth with environment bythe TOR signalling pathway. J. Exp. Bot. 65:2691-2701. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The involvement of Gibberellin 20-Oxidase genes in www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 44.
    phytochrome-regulated petiole elongationof Arabidopsis. Plant Physiol. 138:1106-1116. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear import and DNAbinding of the ZHD5 transcription factor is modulated bya competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286:1659-1668. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene MIF1:Involvement in multiple hormonal regulation of Arabidopsis development. Plant J. 45:399-422. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNABinding bHLH protein, represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61:283-96. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated photosynthesis results fromincreased nitrogen and sulfur assimilation in mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78:84-90. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kazan, K. and Manners, J.M. (2013). MYC2:The master in action. Mol. Plant 6:686-703. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107:22740-22744. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J., and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67:208-217. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E., and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling bydistinct mechanisms. Plant Cell. 19:3915- 3929. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998). Photomorphogenic development of the Arabidopsis shy2-1D mutation and its interaction with phytochromes in darkness. Plant J. 15:61-68. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanismunderlying photoperiodic control of plant growth of Arabidopsis thaliana. The Plant Cell Physiol. 52:1315-1329. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006). LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis. Development 133:4305-4314. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Leivar, P. and Monte, E. (2014). PIFs:systems integrators in plant development. The Plant Cell 26:56-78. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture. Genes Dev. 26:785-790. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 45.
    Lilley, J.L.S., Gee,C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An Endogenous Carbon-Sensing PathwayTriggers Increased Auxin Flux and Hypocotyl Elongation. Plant Physiol. 160:2261-2270. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. Rev. Genet. 16:237-251. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000). Update on Light Signaling Shade Avoidance Responses. Driving Auxin along Lateral Routes. Plant Physiol. 122:621-626. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H., Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999). BAS1:Agene regulating brassinosteroid levels and light responsiveness in Arabidopsis. Proc. Natl. Acad. Sci. 96:15316-15323. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependencyof brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2:E258. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y., Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba, T. (2014). Yucasin is a potent inhibitor of YUCCA, a keyenzyme in auxin biosynthesis. Plant J. 77:352-366. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi, S. (2005). The last reaction producing brassinolide is catalyzed bycytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280:17873-17879. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance Components and Pathways in Adult Plants Revealed byPhenotypic Profiling. PLOS Genet. 11:e1004953. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of plants to water stress. Front. Plant Sci. 5(86):10- 3389. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012). Phytochrome B inhibits binding of phytochrome- interacting factors to their target promoters. Plant J. 72:537-546. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux byimpairing vesicle traffic? Plant Physiol. 131:254-263. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014). Combinatorial Complexityin a TranscriptionallyCentered Signaling Hub in Arabidopsis. Mol. Plant 7:1598-1618. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes expressed in seedlings of Arabidopsis thaliana. Plant J. 37:815-827. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 46.
    Pierik, R., Cuppens,M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco. Plant Physiol. 136:2928-2936. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek, L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor proximitysignals independent of gibberellin and DELLAproteins in Arabidopsis. Plant Physiol. 149:1701- 1712. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). Newperspectives in flooding research:The use of shade avoidance and Arabidopsis thaliana. Ann. Bot. 96:533-540. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pierik, R. and Testerink, C. (2014). The art of being flexible:howto escape fromshade, salt and drought. Plant Physiol. 166:5-22. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pierik, R. and De Wit, M. (2014). Shade avoidance:Phytochrome signalling and other aboveground neighbour detection cues. J. Exp. Bot. 65:2815-2824. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014). Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa. Plant Physiol. 165:1285-1301. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van Zanten, M. (2016). Molecular and genetic control of plant thermomorphogenesis. Nature Plants. 2:15190. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Rademacher, W. (2000). GROWTH RETARDANTS:Effects on Gibberellin Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51:501-531. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong, F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L., and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant J. 53:488-504. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M. (1998). The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p. Genes Dev. 12:198-207. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R., Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification byxyloglucan endotransglucosylase/hydrolases. Plant Physiol. 154:978-990. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to flooding stress. Plant Physiol.:pp.00387. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V(1997). Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl. Acad. Sci. U. S. A. 94:2756-2761. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A., Murphy, A.S., Overvoorde, P.J., and Gray, W.M. www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 47.
    (2012). The SAUR19subfamilyof SMALL AUXIN UP RNAgenes promote cell expansion. Plant J. 70:978-990. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y., Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development. Cell 133:177-191. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil, R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods. Mol. Plant 7:137-155. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathwayin regulating Arabidopsis hypocotyl growth. PLoS Genet. 8:e1002594. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). GeneCodis 3:a non-redundant and modular enrichment analysis tool for functional genomics. Nucleic Acids Res. 40:W478-W483. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L.) Heynh. Planta 182:501-505. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome in cotyledons regulates the expression of genes in the hypocotyl through auxin-dependent and -independent pathways. The Plant Cell Physiol. 43:1171-1181. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno, J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballaré, C.L., Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a NewTryptophan-Dependent Pathway Is Required for Shade Avoidance in Plants. Cell 133:164-176. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene insensitivityresults in down-regulation of rubisco expression and photosynthetic capacityin tobacco. Plant Physiol. 144:1305-1315. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantlyto modulate Arabidopsis photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant J. 42:23-34. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler, K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015). Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis. The Plant Cell 27:2261-2272. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de Vries, S.C. (2012). AMathematical Model for BRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation. Plant Physiol. 160:523-532. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8:462-468. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R., Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two Rumex species fromcontrasting hydrological www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.
  • 48.
    niches regulate floodingtolerance through distinct mechanisms. The Plant Cell 25:4691-707. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Voesenek L.A.C.J.;and Bailey-serres, J. (2015). Flood adaptive traits and processes?:an overview. NewPhytol. 206:57-73. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009). HORMONOMETER:a tool for discerning transcript signatures of hormone action in the Arabidopsis transcriptome. Plant Physiol. 150:1796-1805. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific phytochrome responses using targeted expression of biliverdin reductase in Arabidopsis. Plant Physiol. 149:424-33. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100:403-408. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K., Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014). Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsis through an apparent incoherent feed-forward loop. Proc. Natl. Acad. Sci. U. S. A. 111:2824-9. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J. (2016). Local auxin metabolismregulates environment- induced hypocotyl elongation. Nat. Plants. 21:16025. doi:10.1038/nplants.2016.25 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and Guo, H. (2012). Amolecular framework of light- controlled phytohormone action in Arabidopsis. Curr. Biol. 22:1530-1535. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 4, 2016 - Published bywww.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.