This talk outlines the general steps for project management in rapid development (design to data in two weeks) of a novel digital PCR assay to validate and quantify low frequency variants discovered by sequencing (NGS) of a targeted comprehensive cancer gene panel by the Ion Torrent PGM on PDX models of metastatic colon cancer and spheroid (3-D) cell cultures.
Goal: If the potential driver mutation is validated, treat both (PDX model & cell culture) with small molecule drugs, investigate coincident response.
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...Kate Barlow
The Treatment Resistance Team at the Institute of Cancer Research has been using plasma to interrogate resistance in castration-resistant prostate cancer (CRPC) and develop biomarkers for selecting treatment. Using targeted next-generation sequencing and droplet digital PCR on cfDNA from sequential plasma samples AR mutations was found to emerge with resistance to abiraterone and enzalutamide. A strong association between plasma AR aberrations in the form of AR gain and mutations and resistance to abiraterone or enzalutamide in CRPC patients was also seen, supporting the clinical utility of cfDNA studies in metastatic prostate cancer.
Daniel Wetterskog, Senior Scientist, Institute of Cancer Research, UK
In this ppt, the various types of PCR such as real time PCR, Reverse transcription PCR, multiplex PCR, ligation chain PCR, nested PCR which is applied in diagnosis of diseases, identification of genetic disorders, determination of polymorphism and also in DNA fingerprinting analysis are described.
It is a molecular biological technique.we can monitor the amplification of DNA or RNA sequence. we can aklso test Corona like disease trough this machine.
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...Kate Barlow
The Treatment Resistance Team at the Institute of Cancer Research has been using plasma to interrogate resistance in castration-resistant prostate cancer (CRPC) and develop biomarkers for selecting treatment. Using targeted next-generation sequencing and droplet digital PCR on cfDNA from sequential plasma samples AR mutations was found to emerge with resistance to abiraterone and enzalutamide. A strong association between plasma AR aberrations in the form of AR gain and mutations and resistance to abiraterone or enzalutamide in CRPC patients was also seen, supporting the clinical utility of cfDNA studies in metastatic prostate cancer.
Daniel Wetterskog, Senior Scientist, Institute of Cancer Research, UK
In this ppt, the various types of PCR such as real time PCR, Reverse transcription PCR, multiplex PCR, ligation chain PCR, nested PCR which is applied in diagnosis of diseases, identification of genetic disorders, determination of polymorphism and also in DNA fingerprinting analysis are described.
It is a molecular biological technique.we can monitor the amplification of DNA or RNA sequence. we can aklso test Corona like disease trough this machine.
Precision medicine for oncology requires accurate and sensitive molecular characterization. However, sample degradation, polymerase errors, and sequencing errors reduce accuracy for sequencing genetic variants. By incorporating molecular tagged adapters in target enrichment, and using DNA probes that deliver extremely even and deep coverage, we are able to demonstrate a 300-fold reduction in false positives at or above 0.25% variant frequency. In this presentation, Dr Mirna Jarosz discusses these methods and how they can significantly reduce error rates in your sequencing data.
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesQIAGEN
This slidedeck introduces the concepts of real-time PCR and how to conduct a real-time PCR assay. The topics that are covered include an overview of real-time PCR chemistries, protocols, quantification methods, real-time PCR applications and factors for success.
A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Le...Agriculture Journal IJOEAR
Abstract—ACLSV is one of the major fruit viruses and can cause severe diseases in species of family Rosaceae. Previous RT-PCR methods are available to detect ACLSV in hawthorn samples, but not to evaluate the infected level of ACLSV. In this study, a TaqMan-based quantitative RT-PCR detection method targeting CP gene of ACLSV was first established and the sensitivity and reproducibility were investigated. The results indicated that this standard curve between log of plasmid DNA concentration versus the cycle threshold (Ct) value generated a linear fit with a linear correlation (R2) of 0.99 and the PCR efficiency was more than 90%. The quantitative RT-PCR method was high sensitive and able to detect 6.9 × 102 copies•μL-1 of ACLSV RNA. Compared with the conventional RT-PCR method, it was 100-fold sensitive in detection of ACLSV. In addition, different organs of hawthorn samples were examined using the quantitative RT-PCR repeatedly and the result revealed that the quantitative RT-PCR is not only an effective detection method, and can obtain an absolute quantitation for ACLSV.
What is PCR ? What is Real Time PCR ? Polymerase Chain Reaction ? What is Reverse Transcriptase Enzyme ?
Presented By:
Bharat Bhushan Negi
M.Tech. Biotechnology
IIT Guwahati
Real-Time PCR
The Polymerase Chain Reaction (PCR) is a process for the
amplification of specific fragments of DNA.
Real-Time PCR a specialized technique that allows a PCR reaction
to be visualized “in real time” as the reaction progresses.
Real-Time PCR allows us to measure minute amounts of DNA
sequences in a sample.
Uses of Real-Time PCR
Real-Time PCR has become a cornerstone of molecular biology:
Gene expression analysis
Cancer research
Drug research
Disease diagnosis and management
Viral quantification
Food testing
Testing of GMO food
Animal and plant breeding
Gene copy number
Real Time Polymerase Chain Reaction
Basics of Real Time PCR
Definition
Advantages
Principles
Instruments (Thermal Cyclers)
Useful terms
Real Time PCR Chemistry
Fluorescence Dyes
SYBR Green
EvaGreen
Melt Doctor
Fluorescence Probes
TaqMan Probe
Molecular Beacons
Scorpion Primers
SYBR Green In details
qPCR Set-Up
Assay Design
Data Analysis
Troubleshooting
This presentations will help you to understand a modification of PCR i.e. Real Time PCR. What are the components of a real time pcr and its methodology and its applications.
INTRODUCTION TO REAL TIME PCR IS GIVEN, basic principle of realtime pcr, along with the process of operating this, diagrammatic representation of the process, advantages and disadvantages o f reatimem pcr, applications of the same is also there
Detection of rare mutations in tumor tissue and cell free DNA (cfDNA) allows for monitoring of tumor progression and regression for research purposes. cfDNA isolated from plasma combined with a sensitive detection method like digital PCR is non- invasive and enables earlier detection compared to conventional imaging techniques. Building on the TaqMan based Rare Mutation assay set for detection of rare mutations using digital PCR on the QuantStudio 3D Digital PCR System, we are now developing multiplex assays for simultaneous detection of several mutations. We selected relevant mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and
KRAS G12/G13. These mutations may have implications for potential future targeted therapy. Primers and probes of singleplex Rare Mutation Assays were reformulated to generate multiplex assays detecting the EGFR and KRAS mutations. All multiplex assays were tested on template composed of wild-type genomic DNA background mixed with mutant plasmid reflecting each of the mutations detected by the multiplex
assays. Initial experimental results were successful and showed excellent signal intensity and clear cluster separation when analyzed with the QuantStudio 3D AnalysisSuiteTM Cloud Software. The EGFR G719 mutations (COSM6239, COSM6253, COSM6252) were detected using a 3plex assay, EGFR exon 19 deletions (COSM12383, COSM12422, COSM12678, COSM6223, COSM6254, COSM6255) were detected using a 6plex assay, and KRAS G12/G13 mutations (COSM516,
COSM517, COSM518, COSM520, COSM521, COSM522, COSM527, COSM532) were detected using an 8plex. Multiplexing assays for three relevant mutation loci proved feasible and presents an efficient way to assess the presence and the percentage of mutations at these loci.
Characterization of Novel ctDNA Reference Materials Developed using the Genom...Thermo Fisher Scientific
Liquid biopsy diagnostic technologies have revolutionized cancer testing and therapeutic monitoring. Non-invasive sample collection removes the need for invasive and dangerous biopsies to diagnose cancer and monitor therapeutic efficacy. As liquid biopsy technologies become more sensitive, screening for early detection of cancer DNA using a blood test could become routine clinical practice. However, such technologies cannot be developed without high quality reference materials. In this study, ctDNA reference materials using the NIST Genome in a Bottle GM24385 cell line DNA were developed in a human plasma-EDTA matrix. The allelic frequency (AF), size and stability of the materials were analyzed.
Precision medicine for oncology requires accurate and sensitive molecular characterization. However, sample degradation, polymerase errors, and sequencing errors reduce accuracy for sequencing genetic variants. By incorporating molecular tagged adapters in target enrichment, and using DNA probes that deliver extremely even and deep coverage, we are able to demonstrate a 300-fold reduction in false positives at or above 0.25% variant frequency. In this presentation, Dr Mirna Jarosz discusses these methods and how they can significantly reduce error rates in your sequencing data.
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesQIAGEN
This slidedeck introduces the concepts of real-time PCR and how to conduct a real-time PCR assay. The topics that are covered include an overview of real-time PCR chemistries, protocols, quantification methods, real-time PCR applications and factors for success.
A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Le...Agriculture Journal IJOEAR
Abstract—ACLSV is one of the major fruit viruses and can cause severe diseases in species of family Rosaceae. Previous RT-PCR methods are available to detect ACLSV in hawthorn samples, but not to evaluate the infected level of ACLSV. In this study, a TaqMan-based quantitative RT-PCR detection method targeting CP gene of ACLSV was first established and the sensitivity and reproducibility were investigated. The results indicated that this standard curve between log of plasmid DNA concentration versus the cycle threshold (Ct) value generated a linear fit with a linear correlation (R2) of 0.99 and the PCR efficiency was more than 90%. The quantitative RT-PCR method was high sensitive and able to detect 6.9 × 102 copies•μL-1 of ACLSV RNA. Compared with the conventional RT-PCR method, it was 100-fold sensitive in detection of ACLSV. In addition, different organs of hawthorn samples were examined using the quantitative RT-PCR repeatedly and the result revealed that the quantitative RT-PCR is not only an effective detection method, and can obtain an absolute quantitation for ACLSV.
What is PCR ? What is Real Time PCR ? Polymerase Chain Reaction ? What is Reverse Transcriptase Enzyme ?
Presented By:
Bharat Bhushan Negi
M.Tech. Biotechnology
IIT Guwahati
Real-Time PCR
The Polymerase Chain Reaction (PCR) is a process for the
amplification of specific fragments of DNA.
Real-Time PCR a specialized technique that allows a PCR reaction
to be visualized “in real time” as the reaction progresses.
Real-Time PCR allows us to measure minute amounts of DNA
sequences in a sample.
Uses of Real-Time PCR
Real-Time PCR has become a cornerstone of molecular biology:
Gene expression analysis
Cancer research
Drug research
Disease diagnosis and management
Viral quantification
Food testing
Testing of GMO food
Animal and plant breeding
Gene copy number
Real Time Polymerase Chain Reaction
Basics of Real Time PCR
Definition
Advantages
Principles
Instruments (Thermal Cyclers)
Useful terms
Real Time PCR Chemistry
Fluorescence Dyes
SYBR Green
EvaGreen
Melt Doctor
Fluorescence Probes
TaqMan Probe
Molecular Beacons
Scorpion Primers
SYBR Green In details
qPCR Set-Up
Assay Design
Data Analysis
Troubleshooting
This presentations will help you to understand a modification of PCR i.e. Real Time PCR. What are the components of a real time pcr and its methodology and its applications.
INTRODUCTION TO REAL TIME PCR IS GIVEN, basic principle of realtime pcr, along with the process of operating this, diagrammatic representation of the process, advantages and disadvantages o f reatimem pcr, applications of the same is also there
Detection of rare mutations in tumor tissue and cell free DNA (cfDNA) allows for monitoring of tumor progression and regression for research purposes. cfDNA isolated from plasma combined with a sensitive detection method like digital PCR is non- invasive and enables earlier detection compared to conventional imaging techniques. Building on the TaqMan based Rare Mutation assay set for detection of rare mutations using digital PCR on the QuantStudio 3D Digital PCR System, we are now developing multiplex assays for simultaneous detection of several mutations. We selected relevant mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and
KRAS G12/G13. These mutations may have implications for potential future targeted therapy. Primers and probes of singleplex Rare Mutation Assays were reformulated to generate multiplex assays detecting the EGFR and KRAS mutations. All multiplex assays were tested on template composed of wild-type genomic DNA background mixed with mutant plasmid reflecting each of the mutations detected by the multiplex
assays. Initial experimental results were successful and showed excellent signal intensity and clear cluster separation when analyzed with the QuantStudio 3D AnalysisSuiteTM Cloud Software. The EGFR G719 mutations (COSM6239, COSM6253, COSM6252) were detected using a 3plex assay, EGFR exon 19 deletions (COSM12383, COSM12422, COSM12678, COSM6223, COSM6254, COSM6255) were detected using a 6plex assay, and KRAS G12/G13 mutations (COSM516,
COSM517, COSM518, COSM520, COSM521, COSM522, COSM527, COSM532) were detected using an 8plex. Multiplexing assays for three relevant mutation loci proved feasible and presents an efficient way to assess the presence and the percentage of mutations at these loci.
Characterization of Novel ctDNA Reference Materials Developed using the Genom...Thermo Fisher Scientific
Liquid biopsy diagnostic technologies have revolutionized cancer testing and therapeutic monitoring. Non-invasive sample collection removes the need for invasive and dangerous biopsies to diagnose cancer and monitor therapeutic efficacy. As liquid biopsy technologies become more sensitive, screening for early detection of cancer DNA using a blood test could become routine clinical practice. However, such technologies cannot be developed without high quality reference materials. In this study, ctDNA reference materials using the NIST Genome in a Bottle GM24385 cell line DNA were developed in a human plasma-EDTA matrix. The allelic frequency (AF), size and stability of the materials were analyzed.
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Thermo Fisher Scientific
The use of cell-free circulating tumor DNA (ctDNA) for non-invasive cancer testing has the potential to revolutionize the field. However, emergence of an increasing number of extraction methods and detection assays is rendering laboratory workflow development much more complex and cumbersome. The use of standardized, well characterized ctDNA control materials in human plasma could facilitate the evaluation of extraction efficiency and assay performance across platforms. In this study, we use a full process ctDNA quality control material in true human plasma to demonstrate the variability of extraction yield between different ctDNA extraction kits. We also examine the correlation between the amplifiable
copy number and DNA concentration post-extraction.
Streamlined next generation sequencing assay development using a highly multi...Thermo Fisher Scientific
Next generation sequencing (NGS) assay development for solid tumor sequencing requires characterization of variant calling directly from formalin-fixed paraffin embedded (FFPE) tissue samples. However, cell line based FFPE and human FFPE samples only contain 2 to 20 variants, which require laboratories to invest significant resources in sample sourcing and preparation when developing assays to detect 100+ variants
Cystic Fibrosis is an autosomal recessive genetic disease that is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which has important roles in ion exchange.
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...Lawrence Greenfield
The OncoScan microarray offers high-quality copy number, genotype, and somatic mutation data with whole-genome coverage and high resolution in cancer genes for use with challenging FFPE samples.
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
Rapid and accurate Cancer somatic mutation profiling with the qBiomarker Soma...QIAGEN
QIAGEN has developed real-time PCR-based qBiomarker Somatic Mutation PCR Arrays for pathway- and disease-focused mutation profiling. By combining allele-specific amplification and 5' hydrolysis probe detection, the PCR assays on these arrays detect as little as 0.01% somatic mutation in a background of wild-type genomic DNA. These assays have consistent and reliable mutation detection performance in different sample types (including fresh, frozen, or formalin-fixed samples), and with varying sample quality. In application examples, the PCR-based mutation detection results are consistent with Pyrosequencing results for the same samples. The qBiomarker Somatic Mutation PCR Arrays, combining laboratory-verified assays, comprehensive content, and integrated data analysis software, are highly suited for identifying somatic mutations in the context of biological pathways and diseases.
Principle, Procedure and applications of Digital PCR.pptxVikramadityaupmanyu
Digital PCR (dPCR) is the new generation PCR that enables absolute quantification of target gene by separating reac¬tion mixture in several compartments. In this system, copies of target nucleic acid are distributed randomly from 0, 1 or many in the several small volume compartments. Amplification is occurred in the compartment and resulting absorbance is measured. Integrated fluidic circuits, chip based microchambers, and water in oil droplets are the methods are used for separation of reaction mixture in to several compartments. BioMark HD system (Fluidigm, USA) and QuantStudio3D system (Thermofisher Scientific, USA) uses integrated fluidic circuits harbor¬ing 10000 to 40000 microchambers and integrated chip containing 20000 microchambers, respectively. In droplet digital PCR System (Biorad, USA), reaction mixture is separated into 20,000 water in droplets. After cycles of reaction using any of the above technologies, fluorescence is detected with an imaging sys¬tem in the each compartment and copy numbers of the target is calculated with imaging software.
In droplets digital PCR, after amplification, droplets containing target gene are detected by fluorescence and scored as positive, and droplets without fluorescence are scored as negative. Poisson statistical analysis of the numbers of positive and negative droplets yields absolute quantitation of the target sequence. Digital PCR is the preferred technique for absolute quantification of target gene without need of standard curve and higher sensitivity and produces highly reproducible results, and also less susceptible to inhibitors than conventional RT-qPCR
Quantification of Donor/Recipient Chimerism in Leukemia Samples by Digital PCRThermo Fisher Scientific
During leukemia treatment mixed chimerism occurs in which both recipient and donor cells are present in the bone marrow or peripheral blood after transplantation.
Chimerism analysis is performed to monitor peripheral blood or bone marrow in the recipient after allogenic stem cell transplantation to monitor for leukemic relapse. Observation of increasing mixed chimerism after transplantation is associated with a higher risk of relapse in acute leukemia. Previously, a quantitative PCR (qPCR) technique, using INDEL polymorphisms, was found to predict relapse in 88.2% vs. 44.4% of individuals analyzed by VNTR markers with a median anticipation period of 58 days and a sensitivity of 0.01% vs. 3%. Here we present results from research experiments performed to determine if a digital PCR (dPCR) method is able to predict relapse earlier and with greater accuracy than the qPCR method using retrospective leukemia samples. Research results showed that dPCR using data generated by the QuantStudio™ 3D Digital PCR System and the qPCR method yielded similar percent recipient chimerism values when recipient DNA was present above the 1% level. Furthermore, dPCR using the system was found to be more sensitive than the qPCR method based on the ability to detect the recipient DNA in a relapsed individual about 2 months earlier where the percent recipient chimerism was 0.2% or less. The false positive rate was close to the complete chimerism value of 0.01% for peripheral blood samples.
Introduction:
RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) is an important biological process for modulating eukaryotic gene expression.
It is highly conserved process of posttranscriptional gene silencing by which double stranded RNA (dsRNA) causes sequence-specific degradation of mRNA sequences.
dsRNA-induced gene silencing (RNAi) is reported in a wide range of eukaryotes ranging from worms, insects, mammals and plants.
This process mediates resistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and regulates the expression of protein-coding genes.
What are small ncRNAs?
micro RNA (miRNA)
short interfering RNA (siRNA)
Properties of small non-coding RNA:
Involved in silencing mRNA transcripts.
Called “small” because they are usually only about 21-24 nucleotides long.
Synthesized by first cutting up longer precursor sequences (like the 61nt one that Lee discovered).
Silence an mRNA by base pairing with some sequence on the mRNA.
Discovery of siRNA?
The first small RNA:
In 1993 Rosalind Lee (Victor Ambros lab) was studying a non- coding gene in C. elegans, lin-4, that was involved in silencing of another gene, lin-14, at the appropriate time in the
development of the worm C. elegans.
Two small transcripts of lin-4 (22nt and 61nt) were found to be complementary to a sequence in the 3' UTR of lin-14.
Because lin-4 encoded no protein, she deduced that it must be these transcripts that are causing the silencing by RNA-RNA interactions.
Types of RNAi ( non coding RNA)
MiRNA
Length (23-25 nt)
Trans acting
Binds with target MRNA in mismatch
Translation inhibition
Si RNA
Length 21 nt.
Cis acting
Bind with target Mrna in perfect complementary sequence
Piwi-RNA
Length ; 25 to 36 nt.
Expressed in Germ Cells
Regulates trnasposomes activity
MECHANISM OF RNAI:
First the double-stranded RNA teams up with a protein complex named Dicer, which cuts the long RNA into short pieces.
Then another protein complex called RISC (RNA-induced silencing complex) discards one of the two RNA strands.
The RISC-docked, single-stranded RNA then pairs with the homologous mRNA and destroys it.
THE RISC COMPLEX:
RISC is large(>500kD) RNA multi- protein Binding complex which triggers MRNA degradation in response to MRNA
Unwinding of double stranded Si RNA by ATP independent Helicase
Active component of RISC is Ago proteins( ENDONUCLEASE) which cleave target MRNA.
DICER: endonuclease (RNase Family III)
Argonaute: Central Component of the RNA-Induced Silencing Complex (RISC)
One strand of the dsRNA produced by Dicer is retained in the RISC complex in association with Argonaute
ARGONAUTE PROTEIN :
1.PAZ(PIWI/Argonaute/ Zwille)- Recognition of target MRNA
2.PIWI (p-element induced wimpy Testis)- breaks Phosphodiester bond of mRNA.)RNAse H activity.
MiRNA:
The Double-stranded RNAs are naturally produced in eukaryotic cells during development, and they have a key role in regulating gene expression .
Seminar of U.V. Spectroscopy by SAMIR PANDASAMIR PANDA
Spectroscopy is a branch of science dealing the study of interaction of electromagnetic radiation with matter.
Ultraviolet-visible spectroscopy refers to absorption spectroscopy or reflect spectroscopy in the UV-VIS spectral region.
Ultraviolet-visible spectroscopy is an analytical method that can measure the amount of light received by the analyte.
Richard's entangled aventures in wonderlandRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
The increased availability of biomedical data, particularly in the public domain, offers the opportunity to better understand human health and to develop effective therapeutics for a wide range of unmet medical needs. However, data scientists remain stymied by the fact that data remain hard to find and to productively reuse because data and their metadata i) are wholly inaccessible, ii) are in non-standard or incompatible representations, iii) do not conform to community standards, and iv) have unclear or highly restricted terms and conditions that preclude legitimate reuse. These limitations require a rethink on data can be made machine and AI-ready - the key motivation behind the FAIR Guiding Principles. Concurrently, while recent efforts have explored the use of deep learning to fuse disparate data into predictive models for a wide range of biomedical applications, these models often fail even when the correct answer is already known, and fail to explain individual predictions in terms that data scientists can appreciate. These limitations suggest that new methods to produce practical artificial intelligence are still needed.
In this talk, I will discuss our work in (1) building an integrative knowledge infrastructure to prepare FAIR and "AI-ready" data and services along with (2) neurosymbolic AI methods to improve the quality of predictions and to generate plausible explanations. Attention is given to standards, platforms, and methods to wrangle knowledge into simple, but effective semantic and latent representations, and to make these available into standards-compliant and discoverable interfaces that can be used in model building, validation, and explanation. Our work, and those of others in the field, creates a baseline for building trustworthy and easy to deploy AI models in biomedicine.
Bio
Dr. Michel Dumontier is the Distinguished Professor of Data Science at Maastricht University, founder and executive director of the Institute of Data Science, and co-founder of the FAIR (Findable, Accessible, Interoperable and Reusable) data principles. His research explores socio-technological approaches for responsible discovery science, which includes collaborative multi-modal knowledge graphs, privacy-preserving distributed data mining, and AI methods for drug discovery and personalized medicine. His work is supported through the Dutch National Research Agenda, the Netherlands Organisation for Scientific Research, Horizon Europe, the European Open Science Cloud, the US National Institutes of Health, and a Marie-Curie Innovative Training Network. He is the editor-in-chief for the journal Data Science and is internationally recognized for his contributions in bioinformatics, biomedical informatics, and semantic technologies including ontologies and linked data.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
1. Assay Development in Digital PCR
Orthogonal validation of low-frequency variants
discovered by NGS.
4/4/2017
Kirsten Copren, Ph.D.
Genome Analysis Core
2. Introduction
Feasibility/Protocol Review
Type of Assay
Type & Quality of Sample
Level of Detection/Sensitivity
Precision/Accuracy
Replication/Technical Variation/Reproducibility
Timeline
Staffing
Cost
Project Management Workflow
4/4/20172 Assay Development in dPCR
3. Type of Sample
PDX Models of metastatic colon cancer and spheroid (3-D) cell cultures
Goal: treat both with small molecule drugs, investigate coincident response.
Dr. Robert Warren brought us a potential gene target to validate.
4/4/2017Assay Development in dPCR3
4. Project:
NGS Results. Comprehensive Cancer Panel. Ion Torrent PGM. Data from
SANOFI. Identified two variants in 23 tumor samples <10%, false positives or
real mutations?
4/4/2017Assay Development in dPCR4
5. Gene TSC1, Tuberous sclerosis 1 (TSC1), tumor growth
suppressor. Not previously found in colon cancer.
If validated, single assay could screen thousands of samples.
Gene
Chromosome
Location
Base Change
(Forward Strand)
Codon Change
(Reverse Strand)
Amino Acid
Change
TSC1 g.chr9:135772640 A>T c.(2905-2907)TTG>TAG p.L969*
TSC1 g.chr9:135781427 G>A c.(1537-1539)CCA>CTA p.P513L
4/4/2017Assay Development in dPCR5
Sample ID Sample Type Mutation
Sequencing Mutation
Rate
40006 FFPE Tissue L969* 7.2%
727 Frozen Tissue P513L 9.7%
6. Level of Detection/Sensitivity
NGS and Cancer
• Ion Torrent PGM first sequencer that
clinically validated a Comprehensive
Cancer Panel (400 genes)
‒ Validated a variant in a tumor as 10%
of sample in a tumor/normal
comparison. Clinical approval
accepted.
‒ Oncologists want to detect down to
the first occurrence of a mutation
(0.1%).
‒ NGS is sensitive, but also has a high
error rate. Accuracy below 10%
begins to interact with false positives.
Research (Rx) accepts higher variation than Diagnostics (Dx)
4/4/20176 Assay Development in dPCR
7. Digital PCR
4/4/2017Assay Development in dPCR7
• dPCR counts individual DNA molecules to
allow absolute quantitation without the need
for a standard curve.
• Sensitive to 1-10% rare allele detection, can
be optimized down to detect rare mutants at
a prevalence of 0.1%.
• Taqman® chemistry with specific dye-labelled probes
(Vic or Fam) are used to detect sequence-specific
targets, e.g. WT or mutant.
• Following PCR each well is individually analyzed to
detect presence or absence of an end-point signal.
• The fraction of negative reactions is used to generate an
absolute count of the number of target molecules in the
sample.
8. Assay Design:
Gene
Chromosome
Location
Base Change
(Forward Strand)
Codon Change
(Reverse Strand)
Amino Acid
Change
TSC1 g.chr9:135772640 A>T c.(2905-2907)TTG>TAG p.L969*
TSC1 g.chr9:135781427 G>A c.(1537-1539)CCA>CTA p.P513L
4/4/2017Assay Development in dPCR8
Primer Design for P513L Mutation in TSC1 (Forward Strand)
Sequence Length
T
M
Forward GGCTGCCGAGTGGGTCTT 18 60
Reverse TGACTCTCCCTTTTACCGAGACA 23 59
Probe 1 CTGAGAACCTAGGAGA 16 65
Probe 2 CGCTGAGAACCTGGGA 16 66
Primer Design for L969* Mutation in TSC1 (Reverse Strand)
Sequence Length
T
M
Forward CCAGGTGTTTGAATTGGAGATCT 23 58
Reverse CCCAAGGTCATGAATCAGTTCTT 23 58
Probe 1 ATTTATATGGCAGGTAGG 18 65
Probe 2 TGGCAGGTTGGAGAA 15 67
1. Obtain 150 bp flanking sequence (300 bp)- genome.ucsc.edu
2. Mask repetitive elements: Repeatmasker.org
3. Mask SNPs: NCBI BLAST
4. Default QPCR parameters: Primer Express 3.0
5. Verify amplicon: In-Silico PCR- Genome Browser
9. Synthetic Oligos: Positive Controls
500bp gBlocks mimic the WT and Mut gene sequences
Feasibility testing
1. Specificity: QPCR using gBlocks
2. Specificity & Sensitivity: dPCR using gBlocks
3. Validation: Test samples.
4. Limits of detection & technical variation.
gBlocks® Gene Fragments are double-stranded, sequence-verified genomic blocks for affordable
and easy gene construction or modification. IDTDNA
4/4/2017Assay Development in dPCR9
10. Results: Specificity Using QPCR.
4/4/2017Assay Development in dPCR10
Wildtype Allele - T Mutant Allele - A
Sample Name Expected Observed Expected Observed
Wildtype
gBlock
+ + - -
Mutant
gBlock
- + + +
NTC - - - -
Wildtype Allele - T Mutant Allele - A
Sample Name Expected Observed Expected Observed
Wildtype
gBlock
+ + - -
Mutant
gBlock
- - + +
NTC - - - -
(a) L969*: Passes (b) PL513:Fails. Off target amplification
Scaling
considerations
11. Results: Specificity Using dPCR
copies/µL Precision Allele Frequency
Sample
Copy
Input
No. chips
for
analysis
Wildtype
T
Mutant
A
Wildtype
T
Mutant
A
Wildtype
T
Mutant
A
Wt gBlock 20000 1 1089.20 3.03 1.96% 33.10% 99.72% 0.28%
Mut bBlock 20000 2 8.54 954.42 12.82% 1.43% 0.89% 99.11%
50Wt/50Mu
t
20000 2 539.68 458.17 1.72% 1.83% 54.08% 45.92%
90Wt/10Mu
t
20000 1 946.13 95.25 1.99% 5.23% 90.85% 9.15%
NTC 0 1 3.45 2.08 30.90% 41.41% 62.37% 37.63%
(a) L969*: Passes
4/4/2017Assay Development in dPCR11
The precision indicates the probability of a false positive, and values <10% are desirable.
Background
10% Mutant
100% WT
12. Validation: Test Sample
copies/µL Precision Allele Frequency
Sample Copy Input
No. chips
for analysis
Wildtype T Mutant A Wildtype T Mutant A Wildtype T Mutant A
40006 20000 2 2225.90 3.61 1.28% 19.87% 99.84% 0.16%
(a) L969*: Mutation not detected
4/4/2017Assay Development in dPCR12
The precision indicates the probability of a false positive, and values <10% are desirable.
Sample ID Sample Type Mutation
Sequencing Mutation
Rate
40006 FFPE Tissue L969* 7.2%
727 Frozen Tissue P513L 9.7%
13. Reproducibility
copies/µL Precision Allele Frequency
Mixture
Date
Diluted
Date Run
Copy
Input
No. chips
for
analysis
Wildtype
T
Mutant A
Wildtype
T
Mutant A
Wildtype
T
Mutant A
1 11/7/2014 11/7/2014 20000 1 946.13 95.25 1.99% 5.23% 90.85% 9.15%
2
11/10/2014 11/10/2014 20000 1 1291.50 94.72 1.84% 5.21% 93.17% 6.83%
11/10/2014 11/14/2014
20000 2 1331.90 93.36 1.30% 3.71% 93.45% 6.55%
11/10/2014 11/14/2014
10000 2 636.57 48.63 1.68% 5.41% 92.90% 7.10%
3
11/14/2014 11/14/2014
20000 2 1101.70 36.38 1.35% 5.93% 96.80% 3.20%
11/14/2014 11/14/2014
10000 2 584.77 33.38 1.65% 6.24% 94.60% 5.40%
(a) L969* - 90% wildtype and 10% mutant gBock mixture
4/4/2017Assay Development in dPCR13
The precision indicates the probability of a false positive, and values <10% are desirable.
14. Sensitivity
copies/µL Precision Allele Frequency
Dilutio
n
Date
Diluted
Date Run
Copy
Input
No.
chips for
analysis
Wildtype
T
Mutant
A
Wildtype
T
Mutant
A
Wildtype
T
Mutant A
1 11/14/2014 11/14/2014 20000 2 1102.30 33.82 1.38% 6.27% 97.02% 2.98%
L969*: 95% wildtype and 5% mutant gBock mixture
4/4/2017Assay Development in dPCR14
15. Conclusions
One assay failed: PL513
One assay confirmed mutation in NGS was false positive: L969*
Quick protocol. Quick pilot.
Can build cost model based on probability of potential failures.
Successful pilot. Low-cost ($200 for probes). Two week demo period. Vendor
collaboration.
High DNA input for lower sensitivity. Not appropriate for all sample types.
Lowest levels of sensitivity not reached. Require additional testing.
4/4/2017Assay Development in dPCR15
16. Re-visit
Feasibility/Protocol Review: Very good
Type of Assay: QPCR SNP
Type & Quality of Sample: FFPE & Fresh Frozen Tissue
Level of Detection/Sensitivity: 5-10%
Precision/Accuracy: Acceptable. Not all assays will pass.
Replication/Technical Variation: Requires additional testing.
Timeline: 2 weeks
Staffing: Highly skilled
Cost: $200 for probes. Successful vendor collaboration.
Project Management Workflow: Successful collaboration. Funded grant.
4/4/201716 Assay Development in dPCR
17. Genome Core:
Kathryn Thompson, B.A., Geneticist,
CareDx
Jennifer Dang, B.S., Geneticist,
CureSeq
Cassandra Adams, Ph.D., Staff
Scientist
Department of Surgery:
Robert Warren, M.D., Professor &
Chief of Surgical Oncology
David Donner, Ph.D., Professor
Mary Matli, M.S., Staff Research
Associate III
Team
4/4/2017Assay Development in dPCR17
Editor's Notes
Determine the scope of the project. Protocol review: contact points. Handling time. More interactions with protocol, more possibility of introducing variation.
Digital PCR combines Taqman® chemistry with digital PCR methodology using the QuantStudio® 3D Digital PCR System to enable the detection of rare mutant alleles.
dPCR counts individual DNA molecules to allow absolute quantitation without the need for a standard curve.
Sensitive to 1-10% rare allele detection, can be optimized down to detect rare mutants at a prevalence of 0.1%.
Commercially optimized assays available for common mutations e.g. Kras, Egfr, Braf etc.
DNA samples are partitioned into individual wells on a nanofluidic chip. Some wells contain multiple molecules and some are empty.
The use of a nanofluidic chip enables thousands of PCR reactions in individual wells to be run separately, yet in parallel.
During amplification Taqman® chemistry with specific dye-labelled probes (Vic or Fam) are used to detect sequence-specific targets, e.g. WT or mutant.
Following PCR each well is individually analyzed to detect presence or absence of an end-point signal.
The fraction of negative reactions is used to generate an absolute count of the number of target molecules in the sample