The document discusses the optimization of TaqMan rare mutation digital PCR assays for the QuantStudio 3D system, focusing on the detection of mutations in the EGFR and KRAS genes. Multiplex assays were developed to enable simultaneous detection of several mutations, demonstrating successful results with high sensitivity. The study confirms the feasibility of multiplexing these assays, enhancing efficiency in clinical research involving limited sample material.

1. RESULTS
TaqMan Rare Mutation Digital PCR Assays are optimized
for use in the QuantStudio 3D Digital PCR System.
Figure 5. The QuantStudio 3D Digital PCR Platform
ABSTRACT
Detection of rare mutations in tumor tissue and
cell free DNA (cfDNA) allows for monitoring of
tumor progression and regression for research
purposes. cfDNA isolated from plasma combined
with a sensitive detection method like digital PCR
is non- invasive and enables earlier detection
compared to conventional imaging techniques.
Building on the TaqMan based Rare Mutation
assay set for detection of rare mutations using
digital PCR on the QuantStudio 3D Digital PCR
System, we are now developing multiplex assays
for simultaneous detection of several mutations.
We selected relevant mutations in the EGFR and
KRAS genes for our initial multiplex application:
EGFR G719, EGFR exon 19 deletions, and
KRAS G12/G13. These mutations may have
implications for potential future targeted therapy.
Primers and probes of singleplex Rare Mutation
Assays were reformulated to generate multiplex
assays detecting the EGFR and KRAS
mutations. All multiplex assays were tested on
template composed of wild-type genomic DNA
background mixed with mutant plasmid reflecting
each of the mutations detected by the multiplex
assays.
Initial experimental results were successful and
showed excellent signal intensity and clear
cluster separation when analyzed with the
QuantStudio 3D AnalysisSuiteTM Cloud
Software. The EGFR G719 mutations
(COSM6239, COSM6253, COSM6252) were
detected using a 3plex assay, EGFR exon 19
deletions (COSM12383, COSM12422,
COSM12678, COSM6223, COSM6254,
COSM6255) were detected using a 6plex assay,
and KRAS G12/G13 mutations (COSM516,
COSM517, COSM518, COSM520, COSM521,
COSM522, COSM527, COSM532) were
detected using an 8plex.
Multiplexing assays for three relevant mutation
loci proved feasible and presents an efficient way
to assess the presence and the percentage of
mutations at these loci.
INTRODUCTION
We undertook a feasibility study multiplexing
TaqMan Rare Mutation Assays covering three
important mutational loci to accommodate limited
amounts of sample frequently encountered in
research involving cfDNA or biopsy material. We
selected mutations in the EGFR and KRAS
genes for our initial multiplex application: EGFR
G719, EGFR exon 19 deletions, and KRAS G12/
G13. These mutations may have implications for
potential future targeted therapy.
MATERIALS AND METHODS
Primers and probes of singleplex Rare
Mutation Assays were reformulated and
pooled to generate multiplex assays which
give positive signal in the presence of any of
the targeted EGFR or KRAS mutations. All
multiplex assays were wet-lab tested on wild-
type genomic DNA (Coriell Institute) mixed with
mutant plasmid (Thermo Fisher Scientific)
reflecting each of the mutations detected by the
multiplex assays. Amounts of plasmids added
reflected mutation rates of 10%, 1% and 0.1%.
Thermal cycling on the ProFlex™ PCR System
was performed according to the Quick Reference
Protocol for Rare Mutation Analysis (publication
# CO29568 1114, Thermo Fisher Scientific).
Results were analyzed in QuantStudio 3D
AnalysisSuite Cloud Software.
CONCLUSIONS
In clinical research, mutations affecting the same
codon or the same exon usually present with the
same disease phenotype. Researchers therefore
like to detect these targets with one assay to save
on sample material and cost. In this study, we
proved the feasibility of multiplexing TaqMan Rare
Mutation Assays for three relevant mutation loci. All
assays detected the respective mutations at
sensitivity levels as low as 0.1%.
REFERENCES
• The Hallmarks of Cancer. Hanahan D and
Weinberg RA, 2000, Cell, Vol 100:57-70.
• Mutations in the p53 Tumor Suppressor Gene:
Important Milestones at the Various Steps of
Tumorigenesis. Rivlin N et al., Genes &
Cancer / vol 2 no 4 (2011), pp.466-474
• Clinical pharmacogenomic testing of KRAS,
BRAF and EGFR mutations by high resolution
melting analysis and ultra-deep
pyrosequencing. Borras E et al., BMC Cancer
2011, 11:406
• Novel mutant-enriched Sequencing Identified
High Frequency of PIK3CA Mutations in
Pharyngeal Cancer. Qiu W et al., Int J Cancer.
2008 March 1; 122(5): 1189–1194.
• PIK3CA Mutations Frequently Coexist with RAS
and BRAF Mutations in Patients with Advanced
Cancers. Janku F et al., PLoS ONE Volume 6
(7): 1-8
• Detection of Circulating Tumor DNA in Early-
and Late-Stage Human Malignancies.
Bettegowda C et al., Sci Transl Med. 2014
February 19; 6(224)
ACKNOWLEDGEMENTS
We thank Amy Cuneo and Rachel Formosa of
Thermo Fisher Scientific for reviewing the
document.
For Research Use OnIy. Not for use in diagnostic procedures.
© 2016 Thermo Fisher Scientific Inc. All rights reserved
All trademarks are the property of Thermo Fisher
Scientific and its subsidiaries unless otherwise specified.
TaqMan is a registered trademark of Roche Molecular
Systems, Inc., used under permission and license.
Thermo Fisher Scientific • 5791 Van Allen Way • Carlsbad, CA 92008 • www.lifetechnologies.com
Marion Laig, Bonnie Moy, Frances Chan, Le Lac, Ted Straub, Kamini Varma, David Keys
Thermo Fisher Scientific, 180 Oyster Point Blvd., South San Francisco, CA
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
Table 1. Overview of Multiplex Assays
TaqMan Rare Mutation Assays were multiplexed for the EGFR and KRAS genes comprising between 3 and 7
individual assays. All Assays were wet-lab tested using wild-type genomic DNA with mutant plasmid spiked in,
reflecting mutation rates of 10%, 1% and 0.1% and negative wild-type only control at 0%. Data were analyzed
using QuantStudio® 3D AnalysisSuite™ Cloud Software. All multiplex assays successfully detected each of
their individual target (Figure 1 – Figure 4).
Assay Performance of the EGFR exon 19 deletion assay tested against its 6 individual targets. Details
of individual targets are depicted in Figure 2.
Figure 3. EGFR exon 19 deletions assay detects 6 individual mutations
Assay Performance of the KRAS G12/G13 assay tested against its 7 individual targets
p.G12C, p.G12S, p.G12R, p.G12V, p.G12D, p.G12A and p.G13C.
Figure 4. KRAS G12/G13 assay detects 7 individual mutations
EGFR wild-type AATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAAT
EGFR-12383 AATTCCCGTCGCTATCAAGGAAC------------CATCTCCGAAAGCCAACAAGGAAAT
EGFR-6254 AATTCCCGTCGCTATCAAGGA---------------ATCTCCGAAAGCCAACAAGGAAAT
EGFR-12678 AATTCCCGTCGCTATCAAGGC---------------ATCTCCGAAAGCCAACAAGGAAAT
EGFR-6223 AATTCCCGTCGCTATCAAAAC---------------ATCTCCGAAAGCCAACAAGGAAAT
EGFR-6255 AATTCCCGTCGCTATCAAGGAA------------------CCGAAAGCCAACAAGGAAAT
EGFR-12422 AATTCCCGTCGCTATCAAGGAGC---------CAACATCTCCGAAAGCCAACAAGGAAAT
******************.. ********************
Assay Performance of the EGFR G719X
assay tested against its three targets
p.G719A, p.G719C and p.G719S
Figure 1. EGFR G719X assay
EGFR exon 19 carries several micro-deletions. Shown is the
sequence alignment of deletions covered by the EGFR exon 19
deletions assay (see Figure 3).
Figure 2. EGFR Exon 19 Deletions Sequence Alignment