SNP genotyping using Affymetrix' Axiom Genotyping Solution
•Download as PPTX, PDF•
1 like•705 views
Michael Shapero, Product Development, Affymetrix.Outline of the development and performance of the new Axiom® 384 high-throughput format for low-cost genotyping of up to 50,000 SNPs.
Report
Share
Report
Share
![CNNNNNNNN-Hapten2-5
~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAA [A/G]
3 5
~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAAA TT
~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAAT AT
Average HapMap ≥99.5%
Concordance
Average Reproducibility
SNP genotyping using Affymetrix’ Axiom®
Genotyping Solution
M. Shapero, M. Purdy, R. Kurapati, J. Law, H. Lee, H. Loi, D. Nguyen,
P. H. Wang, A. Yan, C. S. Yu, M. Shirazi, L. Bellon
Affymetrix, Inc. Santa Clara, CA 95051 USA
ABSTRACT #7310
The use of DNA microarrays for easy, cost-effective genotyping of single
nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms (indels)
Probe design for interrogation of SNPs and indels
ACATTAAAAGCTATCATTTAAATTTGGTTGAGACA[C/T]AATATGCTGTTGCACTTTCTATAAAGCATCTGCCA
TGTAATTTTCGATAGTAAATTTAAACCAACTCTGT[G/A]TTATACGACAACGTGAAAGATATTTCGTAGACGGT
3 5
Non C/G & Non A/T SNPs:
1 probe, 2 colors
continues to play an important role in genotype-trait association studies and
marker-assisted selection in both plant and animal breeding programs.
Axiom® Genotyping Solution enables complete automation of DNA target
preparation, DNA amplification, and enzymatic fragmentation of post-amplification
products on the Biomek® FXP Target Prep Express platform. Following target
preparation, arrays are processed using GeneTitan® Multi-Channel (MC)
Instrument. Here we describe a new Axiom® product in which 384 individual
arrays, contained in the footprint of a standard microtiter plate, offer the
capability to genotype approximately 50,000 variants in combination with a
processing throughput of greater than 3,000 samples per week. The 384-array
layout is ideal for high-throughput screening in molecular breeding or marker-
assisted selection programs where ease of use, accuracy, and turnaround time are
all essential. The Axiom 384-array layout retains full compatibility with the
currently existing Axiom instrumentation platform and downstream data analysis
stream. Genotyping performance metrics obtained with Axiom 384-array layout
-p
5
ANNNNNNNN-Hapten1-5
-p
5
3 5ANNNNNNNN-Hapten1-5
TNNNNNNNN-Hapten1-5
•Mis-match occurs on 3’ side of ligation junction
3 5
-p
5
5 ACATTAAAAGCTATCATTTAAATTTGGTTGAGACA[A/T]AATATGCTGTTGCACTTTCTATAAAGCATCTGCCA 3
3 TGTAATTTTCGATAGTAAATTTAAACCAACTCTGT[T/A]TTATACGACAACGTGAAAGATATTTCGTAGACGGT 5
•Mis-match occurs on 5’ side of ligation junction
C/G & A/T SNPs:
2 probes, 1 color
Insertion/deletions:
1 probe, 2 colors
will be presented.
I In summary, new Axiom® advances to DNA sample type compatibility, high-
throughput sample processing enabled with laboratory automation, and the 384-
array layout further extend the platform’s capabilities to genotype thousands of
samples per week with minimal manual intervention that is consistent with the
needs of both animal and plant agrigenomics solutions.
Axiom biochemistry and workflow overview
Total genomic DNA (100 ng) is amplified and randomly fragmented into 25 to
125 base pair (bp) fragments
Axiom probes are typically 30 mers that contain a 5’-phosphate group
Fragmented whole-genome amplified genomic DNA hybridizes to the array-
bound probes
The polymorphic nucleotides are detected using two differentially labeled sets
of ligation probes
Axiom 384 layout automated target prep (ATP) tested on
standard Axiom® Genome-Wide CEU 1 Array Plate
Experiment designed to uncouple Axiom 384 layout ATP from Axiom 384 array
layout in order to independently assess Axiom 384 layout ATP and compare the
performance with specifications established for the Axiom 96 layout ATP
DNA samples prepared using Axiom 384 layout ATP executed on three different
Biomek instruments and a subset of samples were tested on standard 96-array
Axiom® GW CEU 1 Array Plate (genome-wide array that includes validated
markers from human populations with northern and western European ancestry)
All genotyping performance specifications pass acceptance criteria
These fragments are purified, re-suspended, and hybridized to customized
Axiom® myDesign™ Arrays Plates
Following hybridization, the bound target is washed under stringent conditions
to remove non-specific background caused by random ligation events. Each
polymorphic nucleotide is queried via a multi-color ligation event carried out
on the array surface
After ligation, the arrays are stained and imaged on GeneTitan MC Instrument
384
ATP#1
100%
0.985
99.7%
99.7%
384
ATP#3
100%
0.988
99.8%
99.7%
Metrics
Overall Sample Pass
Rate
DQC Median
Average Call Rate
Average HapMap
Concordance
Average
Reproducibility
Acceptance
criteria
≥97%
≥99.0%
≥99.5%
≥99.8%
384
ATP#2
100%
0.984
99.7%
99.7%
99.9%
Biomek FXP Target Prep
Express System
Axiom 384 array layout performance
Axiom 384 layout
Metrics
Number of Input Samples
Overall Sample Pass Rate
384 sample
acceptance criteria
≥97%
384
ATP_I
380
100%
DQC Median
Average Call Rate ≥99.0%
0.984
99.7%
GeneTitan®
Multi-Channel Instrument
Axiom 384 array layout can be processed on an existing in-market GTMC with
only a software upgrade
Axiom 384 array layout is capable of genotyping 100–45,000 SNPs from
diploid species or up to 32,000 SNPs from polyploid species
8-plate workflow in 5 days offers a throughput in excess of 3,000 samples
per week
The SNP content on the Axiom 384 array layout can be selected from in-
market agrigenomic arrays for plants and animals or from SNPs that have
been discovered through next generation-sequencing
99.8%
≥99.8% 99.9%
(100 sets)
Axiom 384 layout ATP used with HapMap270 DNA samples (4 blank wells
excluded from analysis; T03 YRI samples in duplicate)
Axiom 384 Test Array_1 used to assess genotyping performance
SNP content is from Axiom validated database and represents ~14K SNPs
known to have MAF >5% in YRI samples
All genotyping performance specifications pass acceptance criteria](https://image.slidesharecdn.com/affymetrix-axiom-384-format-shapero-2013-150713181819-lva1-app6891/85/SNP-genotyping-using-Affymetrix-Axiom-Genotyping-Solution-1-320.jpg)
Recommended
Improvement of TMB Measurement by removal of Deaminated Bases in FFPE DNA
Tumor mutational burden (TMB) is a positive predictive factor for response to immune-checkpoint inhibitors in certain types of cancer. The Oncomine™ Tumor Mutation Load Assay, a targeted next generation sequencing (NGS) assay, measures TMB (from 1.2Mb of coding region) and detects mutations in 409 cancer genes. The TMB values obtained using targeted sequencing are highly correlated with TMB measured by whole exome sequencing. FFPE preservation methods can lead to significant cytosine deamination of the isolated DNA, resulting in decreased sequencing quality. In these samples, uracils are propagated as thymines and result in false C>T substitutions. Analysis of the Oncomine™ TML Assay using Torrent Suite and Ion Reporter ™ software uniquely estimates the degree of deamination in fixed tissues by measuring C:G>T:A variants. This deamination score is used to assess quality of DNA extracted from FFPE tumor tissue. To minimize the influence
that excess deamination has on TMB results, we have incorporated a repair treatment to eliminate damaged targets and improve usable TMB values of DNA from damaged FFPE tumor tissue using Uracil-DNA glycosylase (UDG). The
Oncomine™ TML Assay for TMB on the Ion Gene Studio™ S5 systems in conjunction with a deamination score is informative and potentially predictive for the use of checkpoint inhibitors in multiple cancer types.
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Thermo Fisher Scientific
The use of cell-free circulating tumor DNA (ctDNA) for non-invasive cancer testing has the potential to revolutionize the field. However, emergence of an increasing number of extraction methods and detection assays is rendering laboratory workflow development much more complex and cumbersome. The use of standardized, well characterized ctDNA control materials in human plasma could facilitate the evaluation of extraction efficiency and assay performance across platforms. In this study, we use a full process ctDNA quality control material in true human plasma to demonstrate the variability of extraction yield between different ctDNA extraction kits. We also examine the correlation between the amplifiable
copy number and DNA concentration post-extraction.Analytical Validation of the Oncomine™ Comprehensive Assay v3 with FFPE and C...
Analytical Validation of the Oncomine™ Comprehensive Assay v3 with FFPE and C...Thermo Fisher Scientific
The document summarizes an analytical validation of the Oncomine Comprehensive Assay v3 (OCAv3) targeted next-generation sequencing panel performed in a CLIA-certified laboratory. The validation assessed analytical sensitivity, specificity, accuracy, and precision using formalin-fixed paraffin-embedded tumor samples and cell lines. Results showed the assay met performance thresholds of 90% or higher for detecting single nucleotide variants, insertions/deletions, copy number variants, and gene fusions across a wide range of variants. Over 2,500 clinical samples were subsequently sequenced with the assay maintaining a 95% success rate and average turnaround time of 10 days.target identefication
The document discusses transient receptor potential (TRP) channels as therapeutic drug targets. It begins by explaining that TRP channels are appealing drug targets because they do not share homology with voltage-gated sodium and calcium channels, allowing for subtype-selective compounds. It also notes that TRP channels integrate several signaling systems and mutations can cause human diseases. The document then focuses on TRP channels in pain pathways, respiratory systems, and other pathophysiological processes. It highlights clinical trials of TRPV1 and TRPV3 antagonists for pain and discusses how TRPV1 antagonists affect heat perception in humans.
Aacr poster2007
This document summarizes a study that used pathway-focused real-time PCR arrays to study extracellular matrix proteins and cell adhesion molecules in breast tumor development. Two PCR arrays were used - a Cancer PathwayFinder array and an Extracellular Matrix and Adhesion Molecules array. RNA from a breast tumor and normal breast tissue were analyzed on the Cancer PathwayFinder array, identifying 33 genes with at least a 3-fold expression change between tumor and normal tissue, including 7 cell adhesion molecules. Further analysis of a second tumor on the Extracellular Matrix array identified 38 cell adhesion genes with at least a 3-fold change, implicating these pathways in breast tumor formation.
Wp adna epi_tectmethyl2
The EpiTect Methyl II PCR Array System provides a simple and reliable method to screen DNA methylation levels of multiple genes simultaneously without bisulfite conversion. It uses selective digestion of genomic DNA with methylation-sensitive and methylation-dependent restriction enzymes, followed by quantitative PCR to determine the relative amounts of methylated and unmethylated DNA for each targeted region. As little as 1 microgram of DNA can profile methylation status of up to 94 genes. The system yields comparable data to bisulfite sequencing and beadchip assays but does not require bisulfite conversion. It is a useful tool for high-throughput screening of DNA methylation biomarkers.
Qpcrpcr array poster
The document describes using RT2Profiler PCR arrays to identify tumor-specific genes by comparing gene expression profiles between tumor and normal tissue samples. Key points:
1) 33 genes were found to have at least a 3-fold difference in expression between a breast tumor sample and normal breast tissue using the Cancer PathwayFinder array.
2) Seven of these genes code for cellular adhesion molecules. Further analysis with an extracellular matrix array identified 38 adhesion-related genes with differential expression.
3) The PCR arrays allow easy, reproducible, and sensitive identification of differentially expressed genes between tumor types or conditions through real-time PCR analysis of focused gene sets.
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Cytochrome P450 enzymes metabolize about 75% of drugs, including oncology drugs, with UGT enzymes metabolizing about another 15%. Variations in gene sequence or in copy number may result in an inactive, defective, unstable, mis-spliced, low expressed, or absent enzyme, an increase in enzyme activity, or an altered affinity for substrates. Pharmacogenomics genes can predict whether an individual is a poor or rapid metabolizer, facilitating dose optimization. Failure to adjust dosage of drugs metabolized by the relevant enzyme can lead to adverse drug reaction, or conversely to too rapid drug metabolism and no drug response. Here, we present a pharmacogenomics (PGx) Research panel to detect 139 SNV/Indel targets in 42 genes (Figure 1) and CYP2D6 copy number variation (CNV, Figure 2). This panel covers the commonly known targets in genes encoding drug metabolism enzymes and associated transport proteins. The panel design is particularly challenging due to high levels of sequence homology between the cytochrome P450 genes. This assay uses Ion AmpliSeq™ technology and contains 146 amplicons in an ultrahigh multiplex PCR in a single pool, followed by Ion Torrent™ semiconductor sequencing. The assay requires as little as 10 ng of input DNA. This customizable panel allows target addition or removal, and will be the first NGS PGx Research panel on the market.
Recommended
Improvement of TMB Measurement by removal of Deaminated Bases in FFPE DNA
Tumor mutational burden (TMB) is a positive predictive factor for response to immune-checkpoint inhibitors in certain types of cancer. The Oncomine™ Tumor Mutation Load Assay, a targeted next generation sequencing (NGS) assay, measures TMB (from 1.2Mb of coding region) and detects mutations in 409 cancer genes. The TMB values obtained using targeted sequencing are highly correlated with TMB measured by whole exome sequencing. FFPE preservation methods can lead to significant cytosine deamination of the isolated DNA, resulting in decreased sequencing quality. In these samples, uracils are propagated as thymines and result in false C>T substitutions. Analysis of the Oncomine™ TML Assay using Torrent Suite and Ion Reporter ™ software uniquely estimates the degree of deamination in fixed tissues by measuring C:G>T:A variants. This deamination score is used to assess quality of DNA extracted from FFPE tumor tissue. To minimize the influence
that excess deamination has on TMB results, we have incorporated a repair treatment to eliminate damaged targets and improve usable TMB values of DNA from damaged FFPE tumor tissue using Uracil-DNA glycosylase (UDG). The
Oncomine™ TML Assay for TMB on the Ion Gene Studio™ S5 systems in conjunction with a deamination score is informative and potentially predictive for the use of checkpoint inhibitors in multiple cancer types.
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Thermo Fisher Scientific
The use of cell-free circulating tumor DNA (ctDNA) for non-invasive cancer testing has the potential to revolutionize the field. However, emergence of an increasing number of extraction methods and detection assays is rendering laboratory workflow development much more complex and cumbersome. The use of standardized, well characterized ctDNA control materials in human plasma could facilitate the evaluation of extraction efficiency and assay performance across platforms. In this study, we use a full process ctDNA quality control material in true human plasma to demonstrate the variability of extraction yield between different ctDNA extraction kits. We also examine the correlation between the amplifiable
copy number and DNA concentration post-extraction.Analytical Validation of the Oncomine™ Comprehensive Assay v3 with FFPE and C...
Analytical Validation of the Oncomine™ Comprehensive Assay v3 with FFPE and C...Thermo Fisher Scientific
The document summarizes an analytical validation of the Oncomine Comprehensive Assay v3 (OCAv3) targeted next-generation sequencing panel performed in a CLIA-certified laboratory. The validation assessed analytical sensitivity, specificity, accuracy, and precision using formalin-fixed paraffin-embedded tumor samples and cell lines. Results showed the assay met performance thresholds of 90% or higher for detecting single nucleotide variants, insertions/deletions, copy number variants, and gene fusions across a wide range of variants. Over 2,500 clinical samples were subsequently sequenced with the assay maintaining a 95% success rate and average turnaround time of 10 days.target identefication
The document discusses transient receptor potential (TRP) channels as therapeutic drug targets. It begins by explaining that TRP channels are appealing drug targets because they do not share homology with voltage-gated sodium and calcium channels, allowing for subtype-selective compounds. It also notes that TRP channels integrate several signaling systems and mutations can cause human diseases. The document then focuses on TRP channels in pain pathways, respiratory systems, and other pathophysiological processes. It highlights clinical trials of TRPV1 and TRPV3 antagonists for pain and discusses how TRPV1 antagonists affect heat perception in humans.
Aacr poster2007
This document summarizes a study that used pathway-focused real-time PCR arrays to study extracellular matrix proteins and cell adhesion molecules in breast tumor development. Two PCR arrays were used - a Cancer PathwayFinder array and an Extracellular Matrix and Adhesion Molecules array. RNA from a breast tumor and normal breast tissue were analyzed on the Cancer PathwayFinder array, identifying 33 genes with at least a 3-fold expression change between tumor and normal tissue, including 7 cell adhesion molecules. Further analysis of a second tumor on the Extracellular Matrix array identified 38 cell adhesion genes with at least a 3-fold change, implicating these pathways in breast tumor formation.
Wp adna epi_tectmethyl2
The EpiTect Methyl II PCR Array System provides a simple and reliable method to screen DNA methylation levels of multiple genes simultaneously without bisulfite conversion. It uses selective digestion of genomic DNA with methylation-sensitive and methylation-dependent restriction enzymes, followed by quantitative PCR to determine the relative amounts of methylated and unmethylated DNA for each targeted region. As little as 1 microgram of DNA can profile methylation status of up to 94 genes. The system yields comparable data to bisulfite sequencing and beadchip assays but does not require bisulfite conversion. It is a useful tool for high-throughput screening of DNA methylation biomarkers.
Qpcrpcr array poster
The document describes using RT2Profiler PCR arrays to identify tumor-specific genes by comparing gene expression profiles between tumor and normal tissue samples. Key points:
1) 33 genes were found to have at least a 3-fold difference in expression between a breast tumor sample and normal breast tissue using the Cancer PathwayFinder array.
2) Seven of these genes code for cellular adhesion molecules. Further analysis with an extracellular matrix array identified 38 adhesion-related genes with differential expression.
3) The PCR arrays allow easy, reproducible, and sensitive identification of differentially expressed genes between tumor types or conditions through real-time PCR analysis of focused gene sets.
Pharmacogenomics Research Ion AmpliSeq Assay | ESHG 2015 Poster PM15.10
Cytochrome P450 enzymes metabolize about 75% of drugs, including oncology drugs, with UGT enzymes metabolizing about another 15%. Variations in gene sequence or in copy number may result in an inactive, defective, unstable, mis-spliced, low expressed, or absent enzyme, an increase in enzyme activity, or an altered affinity for substrates. Pharmacogenomics genes can predict whether an individual is a poor or rapid metabolizer, facilitating dose optimization. Failure to adjust dosage of drugs metabolized by the relevant enzyme can lead to adverse drug reaction, or conversely to too rapid drug metabolism and no drug response. Here, we present a pharmacogenomics (PGx) Research panel to detect 139 SNV/Indel targets in 42 genes (Figure 1) and CYP2D6 copy number variation (CNV, Figure 2). This panel covers the commonly known targets in genes encoding drug metabolism enzymes and associated transport proteins. The panel design is particularly challenging due to high levels of sequence homology between the cytochrome P450 genes. This assay uses Ion AmpliSeq™ technology and contains 146 amplicons in an ultrahigh multiplex PCR in a single pool, followed by Ion Torrent™ semiconductor sequencing. The assay requires as little as 10 ng of input DNA. This customizable panel allows target addition or removal, and will be the first NGS PGx Research panel on the market.
Q biomarkersomaticmutation
The document summarizes qBiomarker Somatic Mutation PCR Arrays, which are PCR-based assays that can rapidly and accurately detect somatic mutations in cancer samples. The arrays can detect mutations present at as little as 0.01% of DNA in a sample. They have been validated to work reliably with different sample types, including archived samples. The arrays cover a wide range of clinically relevant cancer mutations and allow screening of many mutations simultaneously in a single PCR run. The assays and content were selected based on published data on mutation frequencies and functional significance. The arrays provide a simple method for sensitive somatic mutation profiling to aid cancer research.
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...ANALYTICAL AND QUANTITATIVE CYTOPATHOLOGY AND HISTOPATHOLOGY
This document describes a study that used droplet digital PCR (dd-PCR) to detect EGFR mutations in cervical cancer and lung cancer samples. The study found:
1) EGFR was highly expressed in tumor tissue samples from both cervical cancer and lung cancer patients.
2) dd-PCR detected no EGFR G719S or T790M mutations in cervical cancer samples but did detect the T790M mutation in some lung cancer samples.
3) dd-PCR is a sensitive method for detecting mutations in formalin-fixed paraffin-embedded (FFPE) samples with low DNA input. The results provide information on EGFR mutation status that could help guide EGFR-targeted therapy decisions.High Sensitivity Detection of Tumor Gene Mutations-v3
This document summarizes a new method called QClamp PCR that can highly sensitively detect tumor gene mutations. QClamp uses synthetic XNA probes to selectively block amplification of wild-type DNA sequences, improving the sensitivity of PCR to detect mutations present in less than 0.1% of samples. This level of sensitivity allows detection of mutations from biopsy, tissue, or blood samples. The document discusses applications of QClamp PCR for detection of EGFR mutations in lung cancer patients and enriching samples for DNA sequencing. QClamp represents an improvement over other methods by reducing the excess of wild-type DNA that creates high background signals.
Tri-Con_2015
1) The document describes QClamp XNA-PCR, a technology from DiaCarta that uses molecular "clamps" to highly sensitively detect low frequency and cell-free circulating mutant DNA.
2) It needs assays that can detect biomarkers present at low frequency in samples containing a high amount of normal DNA. Existing technologies are inadequate for this need.
3) QClamp assays can reliably detect all possible mutations in a gene region using a single reaction. They can achieve ultra-high sensitivity down to 0.01% from minimal sample input.
C0261218
This document summarizes a study on the preparation of F(ab')2 trastuzumab fragment for use in synthesizing a 177Lu radioimmunoconjugate. Key points:
1. Trastuzumab was purified from preservatives by dialysis.
2. Pepsin digestion at a ratio of 1:4 (enzyme:antibody) for 18 hours at 37°C was found to completely digest trastuzumab into F(ab')2 fragments.
3. F(ab')2 fragments were purified from other fragments using a Sephadex G-25 column and characterized using SEC-HPLC and SDS-PAGE, showing 98% purity and a molecular weight of
Novel amphiphilic nanoparticles for controlled and sustained release
Preparation of amphiphilic nanoparticles based on chitosan and polylactic acid for controlled delivery of anticancer drugs
Ascbrn ai poster
1) The document presents a statistical error model for analyzing sources of variance in real-time PCR based RNAi validation. It finds that greater than 80% transfection efficiency is needed for reliable results.
2) The model shows that both biological and technical replicates are essential to account for variance from transfection and PCR. It recommends a minimum of three replicates for each RNAi experiment.
3) Applying the model to a case study of 119 shRNA sequences targeting 32 genes, the measured knockdowns matched well with the theoretical variance estimates, validating the error model.
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...Thermo Fisher Scientific
TaqMan genotyping assays are widely used to genotype CYP2D6, which encodes a major drug metabolizing enzyme.Development of a high throughput workflow for genotyping CFTR mutations
The document describes the development of over 200 TaqMan assays to detect mutations in the CFTR gene that cause cystic fibrosis. Key mutations were selected from databases and assays were designed to target single nucleotide variants, insertions/deletions, and large deletions. Assays were tested on various sample types and plate formats, with some assays requiring redesign to robustly detect mutations. The developed assays and analysis workflow provide a high-throughput method for CFTR mutation detection to help research efforts.
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencingAxiom™ Genome-Wide CEU 1 Array Plate
The first array to maximize power for European populations with high whole-genome coverage of common and rare variants
New Strategy to detect SNPs
This document describes a new strategy for detecting single nucleotide polymorphisms (SNPs) in HIV genetic sequences. The strategy involves trimming low quality bases, correcting base calls using area ratio or average height ratio algorithms, filtering adjacent SNPs, and generating a consensus sequence from multiple alignments. The strategy was tested on 35 batches of HIV sequences and achieved true positive rates of 75.4% using area ratio and 52.6% using average height ratio, outperforming two external SNP detection tools, Polybayes and Polyphred. Future work will involve testing with larger datasets with higher coverage and sequences from more conserved organisms.
Som aacr2011poster
1) qBiomarker Somatic Mutation PCR Arrays have been developed as a pathway-focused cancer mutation profiling tool using real-time PCR. Each array detects the most frequent mutations in genes within a specific pathway implicated in cancer.
2) The arrays can detect as little as 1% somatic mutation in a background of wild type DNA. They have been tested on a variety of sample types and quality conditions.
3) Initial results show the arrays can reliably detect known mutations in cancer cell lines and tissue samples. Mutations detected by the arrays have been confirmed by alternative methods such as pyrosequencing.
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Thermo Fisher Scientific
Circulating cell free DNA is a potential tumor marker in a non-invasive blood test for the treatment and evaluation of cancer and recurrence monitoring. As circulating tumor DNA is often present at low frequencies within circulating cell free DNA, targeted sequencing on the Ion Torrent™ platform is an optimal tool or mutation detection with very little sample input required. Here, we demonstrate a complete workflow from isolation through molecular characterization of circulating tumor DNA. We have optimized a protocol using magnetic beads to isolate circulating cell free DNA. This protocol is easily automated to process up to 192 samples a day. It is also easily scalable for any input volume and can elute in volumes down to 15 μL resulting in no loss of low frequency alleles. We demonstrate comparable performance between this bead based isolation and column based isolation. We have completed molecular characterization of circulating cell free DNA using the multiplexing capabilities of AmpliSeq™ and the Ion PGM™. With the Ion AmpliSeq™ Cancer Hotspot Panel v2, we performed targeted sequencing of 50 genes of interest, covering 2800 COSMIC mutations. We demonstrate good reproducibility of amplicon representation as well as allelic frequencies. Through saturation studies and subsampling, we have determined the limit of detection of hotspots circulating cell free DNA on the Ion PGM™ to be below 1%. We further demonstrate proof of principle of this workflow on circulating cell free DNA and matched FFPE samples. Our results verify the accuracy and ease of our workflow. This protocol, from isolation through targeted sequencing, will not only result in a simple sample preparation for circulating cell free DNA but also facilitate rapid mutation detection to advance cancer research.Bioinformatics t9-t10-biocheminformatics v2014
This document discusses various topics related to drug discovery through bioinformatics. It begins by describing how genome-wide RNAi screening in the nematode C. elegans can be used to identify genes involved in biological pathways related to diseases like type-2 diabetes. It then discusses topics like structural genomics, target identification and validation, high-throughput screening approaches and facilities, sources for screening libraries, criteria for hit and lead compounds, and computational methods used in hit identification and optimization like pharmacophore modeling and evaluating compounds against the "rule of five". Descriptors that can be used for characterizing compounds are also listed.
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
This slidedeck focuses on the design of a large cohort study for assessing breast cancer risk and how an innovative digital sequencing approach is able to solve the previously unmet challenges of this type of NGS study design. Our speaker, Dr. Fergus J. Couch of the Mayo Clinic, presents on the design of this NCI-funded project, which comprises the sequencing of 60,000 samples to assess the risk of breast cancer through association with targeted genes. The design and size of the study requires an accurate, robust and high-throughput sequencing method. The investigators are using a digital DNA sequencing approach from QIAGEN that incorporates molecular barcodes to tag and remove PCR duplicates and increase NGS assay sensitivity. The approach also uses proprietary chemistry that enables uniform sequencing to efficiently utilize sequencing power and deliver optimized results.
1073957 wp rt2_profilerapp_1012
The document summarizes three studies using RT2 Profiler PCR Arrays to examine gene expression changes in toxicology, oncology, and immunology research. In toxicology, the arrays identified distinct gene expression profiles for three drugs (troglitazone, pioglitazone, rosiglitazone) in liver cells, suggesting different mechanisms for their liver toxicity effects. In oncology, arrays revealed gene expression differences between breast tumor and normal tissue. In immunology, array results correlated well with measured cytokine protein levels between stimulated and unstimulated immune cells.
CTC Detection and Molecular Characterization – Challenges and Solutions
Circulating Tumor Cells (CTCs) have been extensively explored as circulating biomarkers in various cancers. Due to their rarity, heterogeneity and stem cell-like properties, detecting and profiling CTCs from blood samples is very challenging. In this webinar, Dr. Siegfried Hauch will introduce the well-known AdnaTests, which uses the Combination of Combinations Principle (COCP) to enable enriching and detecting CTCs in whole blood with high specificity and sensitivity, and how to overcome challenges in CTC enrichment and detection. The AdnaTests combine an immunomagnetic capturing method that increases purity, and is followed by molecular profiling of the captured CTCs. In addition, leukocyte contamination is another issue in CTCs detection and may lead to false positive results due to illegitimate expression of target genes or false interpretation. The AdnaWash is developed to reduce leukocyte contamination to such a level that whole gene panels can be analyzed while maintaining the required specificity and sensitivity.
Axiom® Genome-Wide AFR 1 Array World Array 3
The document describes the Axiom Genome-Wide AFR 1 Array, which provides high coverage of genetic variants associated with disease in African and African American populations. It was designed to maximize coverage of common and rare variants down to a minor allele frequency of 1% in specific gene regions and disease-associated areas. The array contains over 893,000 SNPs selected from genome-wide association studies and databases of disease-associated variants. It enables genome-wide association studies, replication, and fine mapping with one experiment.
Chigot poster2007
The ArrayGradeTM FFPE RNA isolation kit provides a more effective method for isolating RNA from formalin-fixed paraffin-embedded (FFPE) tissue samples. It yields RNA of higher quantity and quality compared to other commercial kits. The RNA isolated has greater compatibility with microarray and real-time PCR applications, providing more positive results and sensitivity. This allows researchers to reliably perform gene expression profiling on archived FFPE samples to gain insights into cancer progression and other disease studies.
Q pcr symposium2007-pcrarray
This document compares different methods for calculating amplification efficiencies in real-time PCR. It finds that the Real-Time PCR Miner method provides the most precise efficiency estimates across three real-time PCR instruments by applying whole kinetic curve fitting and iterative nonlinear regression. In contrast, standard curve methods and other amplification plot methods produce instrument-dependent efficiency values. The Real-Time PCR Miner also has the smallest variability between replicate reactions, making it the best tool for accurate efficiency estimation.
More Related Content
What's hot
Q biomarkersomaticmutation
The document summarizes qBiomarker Somatic Mutation PCR Arrays, which are PCR-based assays that can rapidly and accurately detect somatic mutations in cancer samples. The arrays can detect mutations present at as little as 0.01% of DNA in a sample. They have been validated to work reliably with different sample types, including archived samples. The arrays cover a wide range of clinically relevant cancer mutations and allow screening of many mutations simultaneously in a single PCR run. The assays and content were selected based on published data on mutation frequencies and functional significance. The arrays provide a simple method for sensitive somatic mutation profiling to aid cancer research.
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...ANALYTICAL AND QUANTITATIVE CYTOPATHOLOGY AND HISTOPATHOLOGY
This document describes a study that used droplet digital PCR (dd-PCR) to detect EGFR mutations in cervical cancer and lung cancer samples. The study found:
1) EGFR was highly expressed in tumor tissue samples from both cervical cancer and lung cancer patients.
2) dd-PCR detected no EGFR G719S or T790M mutations in cervical cancer samples but did detect the T790M mutation in some lung cancer samples.
3) dd-PCR is a sensitive method for detecting mutations in formalin-fixed paraffin-embedded (FFPE) samples with low DNA input. The results provide information on EGFR mutation status that could help guide EGFR-targeted therapy decisions.High Sensitivity Detection of Tumor Gene Mutations-v3
This document summarizes a new method called QClamp PCR that can highly sensitively detect tumor gene mutations. QClamp uses synthetic XNA probes to selectively block amplification of wild-type DNA sequences, improving the sensitivity of PCR to detect mutations present in less than 0.1% of samples. This level of sensitivity allows detection of mutations from biopsy, tissue, or blood samples. The document discusses applications of QClamp PCR for detection of EGFR mutations in lung cancer patients and enriching samples for DNA sequencing. QClamp represents an improvement over other methods by reducing the excess of wild-type DNA that creates high background signals.
Tri-Con_2015
1) The document describes QClamp XNA-PCR, a technology from DiaCarta that uses molecular "clamps" to highly sensitively detect low frequency and cell-free circulating mutant DNA.
2) It needs assays that can detect biomarkers present at low frequency in samples containing a high amount of normal DNA. Existing technologies are inadequate for this need.
3) QClamp assays can reliably detect all possible mutations in a gene region using a single reaction. They can achieve ultra-high sensitivity down to 0.01% from minimal sample input.
C0261218
This document summarizes a study on the preparation of F(ab')2 trastuzumab fragment for use in synthesizing a 177Lu radioimmunoconjugate. Key points:
1. Trastuzumab was purified from preservatives by dialysis.
2. Pepsin digestion at a ratio of 1:4 (enzyme:antibody) for 18 hours at 37°C was found to completely digest trastuzumab into F(ab')2 fragments.
3. F(ab')2 fragments were purified from other fragments using a Sephadex G-25 column and characterized using SEC-HPLC and SDS-PAGE, showing 98% purity and a molecular weight of
Novel amphiphilic nanoparticles for controlled and sustained release
Preparation of amphiphilic nanoparticles based on chitosan and polylactic acid for controlled delivery of anticancer drugs
Ascbrn ai poster
1) The document presents a statistical error model for analyzing sources of variance in real-time PCR based RNAi validation. It finds that greater than 80% transfection efficiency is needed for reliable results.
2) The model shows that both biological and technical replicates are essential to account for variance from transfection and PCR. It recommends a minimum of three replicates for each RNAi experiment.
3) Applying the model to a case study of 119 shRNA sequences targeting 32 genes, the measured knockdowns matched well with the theoretical variance estimates, validating the error model.
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...Thermo Fisher Scientific
TaqMan genotyping assays are widely used to genotype CYP2D6, which encodes a major drug metabolizing enzyme.Development of a high throughput workflow for genotyping CFTR mutations
The document describes the development of over 200 TaqMan assays to detect mutations in the CFTR gene that cause cystic fibrosis. Key mutations were selected from databases and assays were designed to target single nucleotide variants, insertions/deletions, and large deletions. Assays were tested on various sample types and plate formats, with some assays requiring redesign to robustly detect mutations. The developed assays and analysis workflow provide a high-throughput method for CFTR mutation detection to help research efforts.
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencingAxiom™ Genome-Wide CEU 1 Array Plate
The first array to maximize power for European populations with high whole-genome coverage of common and rare variants
New Strategy to detect SNPs
This document describes a new strategy for detecting single nucleotide polymorphisms (SNPs) in HIV genetic sequences. The strategy involves trimming low quality bases, correcting base calls using area ratio or average height ratio algorithms, filtering adjacent SNPs, and generating a consensus sequence from multiple alignments. The strategy was tested on 35 batches of HIV sequences and achieved true positive rates of 75.4% using area ratio and 52.6% using average height ratio, outperforming two external SNP detection tools, Polybayes and Polyphred. Future work will involve testing with larger datasets with higher coverage and sequences from more conserved organisms.
Som aacr2011poster
1) qBiomarker Somatic Mutation PCR Arrays have been developed as a pathway-focused cancer mutation profiling tool using real-time PCR. Each array detects the most frequent mutations in genes within a specific pathway implicated in cancer.
2) The arrays can detect as little as 1% somatic mutation in a background of wild type DNA. They have been tested on a variety of sample types and quality conditions.
3) Initial results show the arrays can reliably detect known mutations in cancer cell lines and tissue samples. Mutations detected by the arrays have been confirmed by alternative methods such as pyrosequencing.
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Thermo Fisher Scientific
Circulating cell free DNA is a potential tumor marker in a non-invasive blood test for the treatment and evaluation of cancer and recurrence monitoring. As circulating tumor DNA is often present at low frequencies within circulating cell free DNA, targeted sequencing on the Ion Torrent™ platform is an optimal tool or mutation detection with very little sample input required. Here, we demonstrate a complete workflow from isolation through molecular characterization of circulating tumor DNA. We have optimized a protocol using magnetic beads to isolate circulating cell free DNA. This protocol is easily automated to process up to 192 samples a day. It is also easily scalable for any input volume and can elute in volumes down to 15 μL resulting in no loss of low frequency alleles. We demonstrate comparable performance between this bead based isolation and column based isolation. We have completed molecular characterization of circulating cell free DNA using the multiplexing capabilities of AmpliSeq™ and the Ion PGM™. With the Ion AmpliSeq™ Cancer Hotspot Panel v2, we performed targeted sequencing of 50 genes of interest, covering 2800 COSMIC mutations. We demonstrate good reproducibility of amplicon representation as well as allelic frequencies. Through saturation studies and subsampling, we have determined the limit of detection of hotspots circulating cell free DNA on the Ion PGM™ to be below 1%. We further demonstrate proof of principle of this workflow on circulating cell free DNA and matched FFPE samples. Our results verify the accuracy and ease of our workflow. This protocol, from isolation through targeted sequencing, will not only result in a simple sample preparation for circulating cell free DNA but also facilitate rapid mutation detection to advance cancer research.Bioinformatics t9-t10-biocheminformatics v2014
This document discusses various topics related to drug discovery through bioinformatics. It begins by describing how genome-wide RNAi screening in the nematode C. elegans can be used to identify genes involved in biological pathways related to diseases like type-2 diabetes. It then discusses topics like structural genomics, target identification and validation, high-throughput screening approaches and facilities, sources for screening libraries, criteria for hit and lead compounds, and computational methods used in hit identification and optimization like pharmacophore modeling and evaluating compounds against the "rule of five". Descriptors that can be used for characterizing compounds are also listed.
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
This slidedeck focuses on the design of a large cohort study for assessing breast cancer risk and how an innovative digital sequencing approach is able to solve the previously unmet challenges of this type of NGS study design. Our speaker, Dr. Fergus J. Couch of the Mayo Clinic, presents on the design of this NCI-funded project, which comprises the sequencing of 60,000 samples to assess the risk of breast cancer through association with targeted genes. The design and size of the study requires an accurate, robust and high-throughput sequencing method. The investigators are using a digital DNA sequencing approach from QIAGEN that incorporates molecular barcodes to tag and remove PCR duplicates and increase NGS assay sensitivity. The approach also uses proprietary chemistry that enables uniform sequencing to efficiently utilize sequencing power and deliver optimized results.
1073957 wp rt2_profilerapp_1012
The document summarizes three studies using RT2 Profiler PCR Arrays to examine gene expression changes in toxicology, oncology, and immunology research. In toxicology, the arrays identified distinct gene expression profiles for three drugs (troglitazone, pioglitazone, rosiglitazone) in liver cells, suggesting different mechanisms for their liver toxicity effects. In oncology, arrays revealed gene expression differences between breast tumor and normal tissue. In immunology, array results correlated well with measured cytokine protein levels between stimulated and unstimulated immune cells.
CTC Detection and Molecular Characterization – Challenges and Solutions
Circulating Tumor Cells (CTCs) have been extensively explored as circulating biomarkers in various cancers. Due to their rarity, heterogeneity and stem cell-like properties, detecting and profiling CTCs from blood samples is very challenging. In this webinar, Dr. Siegfried Hauch will introduce the well-known AdnaTests, which uses the Combination of Combinations Principle (COCP) to enable enriching and detecting CTCs in whole blood with high specificity and sensitivity, and how to overcome challenges in CTC enrichment and detection. The AdnaTests combine an immunomagnetic capturing method that increases purity, and is followed by molecular profiling of the captured CTCs. In addition, leukocyte contamination is another issue in CTCs detection and may lead to false positive results due to illegitimate expression of target genes or false interpretation. The AdnaWash is developed to reduce leukocyte contamination to such a level that whole gene panels can be analyzed while maintaining the required specificity and sensitivity.
Axiom® Genome-Wide AFR 1 Array World Array 3
The document describes the Axiom Genome-Wide AFR 1 Array, which provides high coverage of genetic variants associated with disease in African and African American populations. It was designed to maximize coverage of common and rare variants down to a minor allele frequency of 1% in specific gene regions and disease-associated areas. The array contains over 893,000 SNPs selected from genome-wide association studies and databases of disease-associated variants. It enables genome-wide association studies, replication, and fine mapping with one experiment.
What's hot (20)
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...
Highly Sensitive Droplet Digital PCR for the Detection of EGFR G719S and T790...
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
Novel amphiphilic nanoparticles for controlled and sustained release
Novel amphiphilic nanoparticles for controlled and sustained release
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...
Resolving false positive CYP2D6 genotype results: CYP2D7 variation is the cul...
Development of a high throughput workflow for genotyping CFTR mutations
Development of a high throughput workflow for genotyping CFTR mutations
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
CTC Detection and Molecular Characterization – Challenges and Solutions
CTC Detection and Molecular Characterization – Challenges and Solutions
Similar to SNP genotyping using Affymetrix' Axiom Genotyping Solution
Chigot poster2007
The ArrayGradeTM FFPE RNA isolation kit provides a more effective method for isolating RNA from formalin-fixed paraffin-embedded (FFPE) tissue samples. It yields RNA of higher quantity and quality compared to other commercial kits. The RNA isolated has greater compatibility with microarray and real-time PCR applications, providing more positive results and sensitivity. This allows researchers to reliably perform gene expression profiling on archived FFPE samples to gain insights into cancer progression and other disease studies.
Q pcr symposium2007-pcrarray
This document compares different methods for calculating amplification efficiencies in real-time PCR. It finds that the Real-Time PCR Miner method provides the most precise efficiency estimates across three real-time PCR instruments by applying whole kinetic curve fitting and iterative nonlinear regression. In contrast, standard curve methods and other amplification plot methods produce instrument-dependent efficiency values. The Real-Time PCR Miner also has the smallest variability between replicate reactions, making it the best tool for accurate efficiency estimation.
Ascb 2007-pcr array-poster
This document describes a real-time PCR array for simultaneously evaluating the expression of multiple cytokine mRNAs. The RT2Profiler PCR Array allows detection of 84 cytokine-related genes with high reproducibility, specificity, efficiency and sensitivity. The array was used to identify cytokines upregulated or downregulated in peripheral blood mononuclear cells stimulated with PMA and ionomycin compared to unstimulated cells. Twenty-nine genes showed at least a 5-fold change in expression, and protein level changes measured by ELISA were consistent with mRNA changes detected by the array. The PCR array provides a reliable tool for profiling cytokine gene expression.
Aai 2007-pcr array-poster
This document describes a real-time PCR array for simultaneously evaluating the expression of multiple cytokine mRNAs. The RT2Profiler PCR Array demonstrated high reproducibility, specificity, efficiency, sensitivity, and linear dynamic range. Using this array, 29 genes were found to have at least a 5-fold change in expression between resting and stimulated peripheral blood mononuclear cells after 6 hours of stimulation. The array provides a reliable tool for profiling cytokine pathway gene expression.
Abrf poster2007
The RT2Profiler PCR Array allows for the simultaneous analysis of 84 genes related to specific pathways using real-time PCR. It provides consistent and reproducible results that correlate well with other gene expression platforms such as microarrays and TaqMan assays. The document demonstrates the array's wide dynamic range, high amplification efficiency, and ability to accurately identify differentially expressed genes between normal and tumor tissue samples.
Tfpcr array poster
The document describes a study that used RT2Profiler PCR Array, a low-density qPCR array, to validate differential gene expression between breast tumor and normal breast tissue samples. Thirty-three genes were found to have at least a 3-fold difference in expression. The array demonstrated high reproducibility of Ct values across replicate plates, instruments, and investigators. It provides a validated method for accelerating microarray validation through multi-gene qPCR analysis in a single experiment.
Assay Development in Digital PCR
This talk outlines the general steps for project management in rapid development (design to data in two weeks) of a novel digital PCR assay to validate and quantify low frequency variants discovered by sequencing (NGS) of a targeted comprehensive cancer gene panel by the Ion Torrent PGM on PDX models of metastatic colon cancer and spheroid (3-D) cell cultures.
Goal: If the potential driver mutation is validated, treat both (PDX model & cell culture) with small molecule drugs, investigate coincident response.
A High Throughput TaqMan CFTR Mutation Genotyping Workflow
Thermo Fisher Scientific developed 200 TaqMan assays to detect mutations in the CFTR gene. They tested the assays on DNA samples containing known CFTR mutations and achieved high call rates and accuracy. The assays can be used to study CFTR mutations according to population frequency and can detect a variety of mutation types including small and large deletions. Example data is shown for assays detecting homopolymer regions and large deletions.
Q pcr poster-20070314
This document summarizes a study comparing gene expression results from a SYBR Green-based real-time PCR array to other technologies using two reference RNA samples. The PCR array showed high reproducibility and accuracy when compared to quantitative PCR methods like TaqMan and microarray platforms. There was a high degree of overlap between differentially expressed gene lists from the PCR array and other technologies. The PCR array provides a convenient, cost-effective way to simultaneously analyze expression of multiple genes related to the same pathway using validated primers.
Genomica - Microarreglos de DNA
The document discusses various applications and techniques of DNA microarrays, including summarizing key points about Affymetrix GeneChips, spotted microarrays, experimental design, data analysis, and several case studies on various topics like ovarian cancer, Sjogren's syndrome, wine yeast genomics, and norovirus genotyping. Microarrays allow analysis of gene expression patterns and copy number variations across genomes through comparative hybridization experiments. The document provides an overview of microarray technology and applications in genomic and biomedical research.
cms_042247
The document summarizes research evaluating the performance of TaqMan Low Density Arrays for gene expression analysis. It finds that assays on arrays can discriminate 2-fold changes as well as plate assays, and assay results are highly reproducible both within and across arrays. The study also uses a TaqMan Low Density Human Endogenous Control Array to examine housekeeping gene expression across 32 tissues, identifying genes with consistent expression levels suitable for normalization.
Final project-kbakshy
The document describes a study that analyzed gene expression data from ovarian carcinoma cell lines treated with and without the chemotherapy drug cisplatin. The study aimed to explore the connection between cellular responses to cisplatin and epithelial-mesenchymal transition (EMT). Gene expression microarrays were used to analyze 171 samples and identify differentially expressed genes between epithelial-like and mesenchymal-like cell lines. Statistical tests identified over 6500 differentially expressed genes. Classification analysis correctly predicted the epithelial or mesenchymal status of 70 test samples based on their gene expression profiles. Top genes found to be upregulated or downregulated in epithelial versus mesenchymal cell lines are involved in processes like cell adhesion, migration and proliferation
final_presentation
The document provides details on analyzing genomic sequencing data from a breast cancer patient to identify somatic mutations. It describes extracting over 100 features from the normal and tumor sequencing data, selecting the most informative features, and using machine learning algorithms on principal components of the data to classify SNPs as somatic or germline. Several known breast cancer driver genes were found among the identified somatic mutations, including RAP1A, PARP1, and TACSTD2. Future work could involve analyzing more data from similar patients to increase training data and address sequencing errors.
Classes of-molecular-markers
The document describes several classes of molecular markers used in genetic analysis, including isozymes, RFLPs, RAPDs, AFLPs, microsatellites, and SNPs. Isozymes analyze differences in protein mobility on a gel, while RFLPs, RAPDs, AFLPs detect DNA fragment length polymorphisms. Microsatellites analyze differences in repeat number, and SNPs detect single nucleotide differences. Each method has advantages and disadvantages related to factors like technical requirements, costs, reproducibility, and amount of polymorphism detected. The choice of marker depends on the application and study objectives.
Classes of-molecular-markers
The document describes several classes of molecular markers used in genetic analysis, including isozymes, RFLPs, RAPDs, AFLPs, microsatellites, and SNPs. Isozymes analyze differences in protein mobility on a gel, while RFLPs, RAPDs, AFLPs detect DNA fragment length polymorphisms. Microsatellites analyze differences in repeat number, and SNPs detect single nucleotide differences. The techniques vary in their genetic nature, use of radioactivity, cost, reproducibility, and number of loci analyzed. Choosing a marker system depends on these factors and the research question.
Gene 151_119 (1994) [SDM of dsDNA]
This document describes a method for site-directed mutagenesis of double-stranded DNA using polymerase chain reaction (PCR). Key steps include:
1) Using a higher initial template concentration and fewer PCR cycles (5-10) to reduce unwanted secondary mutations while still producing sufficient mutated DNA.
2) Treating the PCR product with DpnI endonuclease, which digests the methylated parental DNA template, leaving the non-methylated mutated PCR products.
3) Using Pfu DNA polymerase to remove any extra bases added to the 3' ends of the PCR product by Taq DNA polymerase, thereby "polishing" the ends prior to ligation and transformation.
The method allows
Streamlined next generation sequencing assay development using a highly multi...
Streamlined next generation sequencing assay development using a highly multi...Thermo Fisher Scientific
Next generation sequencing (NGS) assay development for solid tumor sequencing requires characterization of variant calling directly from formalin-fixed paraffin embedded (FFPE) tissue samples. However, cell line based FFPE and human FFPE samples only contain 2 to 20 variants, which require laboratories to invest significant resources in sample sourcing and preparation when developing assays to detect 100+ variantsSAGE- Serial Analysis of Gene Expression
Serial Analysis of Gene Expression (SAGE) is a method to quantify gene expression in cells. It involves extracting short sequence tags from mRNA transcripts and concatenating them for efficient sequencing. This allows simultaneous analysis of thousands of transcripts. SAGE provides quantitative gene expression data without prior knowledge of genes and can identify differentially expressed genes between cell types or conditions. While powerful, it requires substantial sequencing and computational analysis of large datasets.
Microarray
DNA microarrays, also known as DNA chips, allow simultaneous measurement of gene expression levels for every gene in a genome. They detect mRNA levels by hybridizing cDNA to arrays of gene probes spotted on glass slides or other surfaces. Differences in gene expression between cell types or conditions can be measured and analyzed to answer biological questions.
Microsatellites Markers
Microsatellite are powerful DNA markers for quantifying genetic variations within & between populations of a species, also called as STR, SSR, VNTR. Tandemly repeated DNA sequences with the repeat/size of 1 – 6 bases repeated several times
Similar to SNP genotyping using Affymetrix' Axiom Genotyping Solution (20)
A High Throughput TaqMan CFTR Mutation Genotyping Workflow
A High Throughput TaqMan CFTR Mutation Genotyping Workflow
Streamlined next generation sequencing assay development using a highly multi...
Streamlined next generation sequencing assay development using a highly multi...
More from Affymetrix
Axiom® Genome-Wide CHB 1 & CHB 2 Array Plate Set
High coverage of common and rare variants to detect disease associations in Han Chinese populations
Axiom™ Genome-Wide ASI 1 Array Plate
The Axiom Genome-Wide ASI 1 Array provides high genomic coverage of common and rare alleles in East Asian populations. It contains over 600,000 SNPs, including variants from important biological categories. Validation testing showed the array achieves over 99.5% concordance with HapMap samples and over 99.7% repeatability. The array offers greater coverage of rare Asian variants compared to competing products.
Axiom® Biobank Genotyping Arrays
A choice of population-optimized GWAS imputation grids, combined with exome, loss-of-function, ADME, and eQTL markers in one high-coverage, high-value, customizable design.
SNP genotyping using the Affymetrix® Axiom® Genome-Wide Pan-African (PanAFR) ...
The document describes the Axiom Genome-Wide PanAFR Array Set, which was designed to maximize coverage of common and rare genetic variants in populations of Yoruba ancestry. The array contains over 2.2 million markers selected from several genome projects to provide high coverage of the genome as well as specific regions and gene categories. Testing showed the array performs well with an average call rate over 99% and high concordance and reproducibility of calls.
A SNP array for human population genetics studies
Yontao Lu, Teri Genschoreck, Swapan Mallick, Amy Ollmann, Nick Patterson, Yiping Zhan, Teresa Webster, David Reich Overview of the Human Origins Array, the first array developed with leading geneticists to enable rigorous population genetics studies.
Axiom® Genome-Wide LAT 1 Array World Array 4
Coverage-Optimized World Arrays: next-generation designs combining GWAS, replication, and fine-mapping into one array. Dense marker coverage of disease-associated SNPs, genes, and regions, plus whole-genome coverage of common and rare variants. Optimized for diverse ancestries including European, African and Native American.
FFPE Applications Solutions brochure
A Platform of comprehensive genomics solutions for analyzing FFPE archival tissues from whole-genome to single molecules
Solutions for Personalized Medicine brochure
The document discusses personalized medicine and describes some of the tools and technologies used for biomarker discovery and validation to enable personalized medicine. Specifically, it discusses:
1) Affymetrix provides a portfolio of tools to detect and validate DNA and RNA biomarkers for diseases like cancer through microarrays, services, and assays that can interrogate genomes, transcriptomes, genes, pathways, and individual molecules.
2) RNA and DNA biomarkers like gene expressions levels, mutations, and other genomic alterations can serve as indicators of disease processes and therapeutic responses. Affymetrix tools allow analysis of whole genomes, transcriptomes, alternative splicing, and single-cell analysis.
3) These tools are used to discover and validate biomarkers which
Download our publication archive list
Includes over 250 transcriptomics and genomics papers published from 2009 to 2011 in plants, animals, and other non-human species; sorted by species.
Integrating arrays and RNA-Seq
This document discusses how microarrays and RNA sequencing (RNA-Seq) are complementary approaches for genomics research. It notes that while RNA-Seq is useful for discovering unknown transcripts, microarrays allow researchers to quickly and cost-effectively profile known pathways and genes. The document also highlights how microarrays can generate data from limited or degraded RNA samples not amenable to RNA-Seq, and can validate potential RNA-Seq hits simultaneously. It concludes by emphasizing the robust, cost-effective, and proven nature of microarray technology as a complement to emerging NGS approaches.
Designing GWAS arrays for efficient imputation-based coverage
Yiping Zhan, Bioinformatics, Affymetrix (presented at ASHG 2012).
Our proprietary, imputation-based SNP selection method creates population-optimized GWAS array designs that use fewer markers to deliver better 1000 Genomes coverage than pairwise tagSNP arrays.
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Giovanni Martinelli, PhD
Associate Professor of Haematology, Institute of Haematology and Medical Oncology, University of Bologna, Italy
From trials evaluating drugs to trials evaluating treatment algorithms – Focu...
Christophe Le Tourneau, MD, PhD
Medical Oncologist, Head of the Phase I Program, Institut Curie, France
Affymetrix OncoScan®* data analysis with Nexus Copy Number™
This document discusses the analysis of Affymetrix OncoScan data using Nexus Copy Number software. It outlines researchers' needs such as visualizing data, identifying common aberrations, comparing sample populations, and predictive analysis. It then describes the data processing in Nexus, including algorithms for identifying significant aberrations and dealing with heterogeneity. Finally, it shows examples of data visualization, analysis features for survival, enrichment, and comparing groups that Nexus provides to help researchers analyze and understand OncoScan data.
Phenotypic identification of subclones in multiple myeloma with different gen...
Bruno Paiva, PhD
Scientific Co-Director of CIMA LAB Diagnostics and Director of the Unit of Cytometry, University of Navarra, Spain
Mitigating genotyping application note
Mitigating sequencing errors, monomorphs, and poor performing markers during de novo SNP selection for genotyping applications
Statistical methods for off-target variant genotyping on Affymetrix' Axiom Ar...
Teresa Webster, Bioinformatics, Affymetrix.Automated clustering and calling of ""Off-Target Variants,"" atypical cluster patterns caused by secondary variants in the probe hybridization region.
Allopolyploid Genotyping Algorithm on Affymetrix' Axiom Arrays
Hong Gao, Bioinformatics, Affymetrix.An automated algorithm that reduces genotype analysis to ~1 hour is described and applied to hexaploid wheat data.
SNP genotyping of markers with nearby secondary polymorphisms using Affymetri...
Laurent Bellon, Product Development, Affymetrix.Axiom® Genotyping Solution is uniquely suited to genotyping of highly polymorphic genomes as it is permissive to secondary variants as close as 10 bp from the target variant.
Development of a high-throughput high-density SNP genotyping array for bovine
This document summarizes the development of a high-density SNP genotyping array for cattle. Key points:
1) Researchers from Affymetrix and academic institutions combined efforts to sequence the genomes of 15 bovine breeds and identify over 3 million SNPs.
2) A set of 648,000 SNPs was selected from the 3 million to be included on the new AxiomTM Genome-Wide BOS 1 Array based on their ability to genetically represent linkage disequilibrium blocks across multiple breeds.
3) Testing of the new array showed over 99% call rate and genetic coverage of over 90% for many beef and dairy cattle breeds, demonstrating its effectiveness for applications like marker-assisted breeding.
More from Affymetrix (20)
SNP genotyping using the Affymetrix® Axiom® Genome-Wide Pan-African (PanAFR) ...
SNP genotyping using the Affymetrix® Axiom® Genome-Wide Pan-African (PanAFR) ...
Designing GWAS arrays for efficient imputation-based coverage
Designing GWAS arrays for efficient imputation-based coverage
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
From trials evaluating drugs to trials evaluating treatment algorithms – Focu...
From trials evaluating drugs to trials evaluating treatment algorithms – Focu...
Affymetrix OncoScan®* data analysis with Nexus Copy Number™
Affymetrix OncoScan®* data analysis with Nexus Copy Number™
Phenotypic identification of subclones in multiple myeloma with different gen...
Phenotypic identification of subclones in multiple myeloma with different gen...
Statistical methods for off-target variant genotyping on Affymetrix' Axiom Ar...
Statistical methods for off-target variant genotyping on Affymetrix' Axiom Ar...
Allopolyploid Genotyping Algorithm on Affymetrix' Axiom Arrays
Allopolyploid Genotyping Algorithm on Affymetrix' Axiom Arrays
SNP genotyping of markers with nearby secondary polymorphisms using Affymetri...
SNP genotyping of markers with nearby secondary polymorphisms using Affymetri...
Development of a high-throughput high-density SNP genotyping array for bovine
Development of a high-throughput high-density SNP genotyping array for bovine
Recently uploaded
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...
Context. With a mass exceeding several 104 M⊙ and a rich and dense population of massive stars, supermassive young star clusters
represent the most massive star-forming environment that is dominated by the feedback from massive stars and gravitational interactions
among stars.
Aims. In this paper we present the Extended Westerlund 1 and 2 Open Clusters Survey (EWOCS) project, which aims to investigate
the influence of the starburst environment on the formation of stars and planets, and on the evolution of both low and high mass stars.
The primary targets of this project are Westerlund 1 and 2, the closest supermassive star clusters to the Sun.
Methods. The project is based primarily on recent observations conducted with the Chandra and JWST observatories. Specifically,
the Chandra survey of Westerlund 1 consists of 36 new ACIS-I observations, nearly co-pointed, for a total exposure time of 1 Msec.
Additionally, we included 8 archival Chandra/ACIS-S observations. This paper presents the resulting catalog of X-ray sources within
and around Westerlund 1. Sources were detected by combining various existing methods, and photon extraction and source validation
were carried out using the ACIS-Extract software.
Results. The EWOCS X-ray catalog comprises 5963 validated sources out of the 9420 initially provided to ACIS-Extract, reaching a
photon flux threshold of approximately 2 × 10−8 photons cm−2
s
−1
. The X-ray sources exhibit a highly concentrated spatial distribution,
with 1075 sources located within the central 1 arcmin. We have successfully detected X-ray emissions from 126 out of the 166 known
massive stars of the cluster, and we have collected over 71 000 photons from the magnetar CXO J164710.20-455217.
Cytokines and their role in immune regulation.pptx
This presentation covers the content and information on "Cytokines " and their role in immune regulation .
Micronuclei test.M.sc.zoology.fisheries.
Current Ms word generated power point presentation covers major details about the micronuclei test. It's significance and assays to conduct it. It is used to detect the micronuclei formation inside the cells of nearly every multicellular organism. It's formation takes place during chromosomal sepration at metaphase.
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...University of Maribor
Slides from talk:
Aleš Zamuda: Remote Sensing and Computational, Evolutionary, Supercomputing, and Intelligent Systems.
11th International Conference on Electrical, Electronics and Computer Engineering (IcETRAN), Niš, 3-6 June 2024
Inter-Society Networking Panel GRSS/MTT-S/CIS Panel Session: Promoting Connection and Cooperation
https://www.etran.rs/2024/en/home-english/Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Functional Magnetic Resonance Imaging (fMRI) provides means to characterize brain activations in response to behavior. However, cognitive neuroscience has been limited to group-level effects referring to the performance of specific tasks. To obtain the functional profile of elementary cognitive mechanisms, the combination of brain responses to many tasks is required. Yet, to date, both structural atlases and parcellation-based activations do not fully account for cognitive function and still present several limitations. Further, they do not adapt overall to individual characteristics. In this talk, I will give an account of deep-behavioral phenotyping strategies, namely data-driven methods in large task-fMRI datasets, to optimize functional brain-data collection and improve inference of effects-of-interest related to mental processes. Key to this approach is the employment of fast multi-functional paradigms rich on features that can be well parametrized and, consequently, facilitate the creation of psycho-physiological constructs to be modelled with imaging data. Particular emphasis will be given to music stimuli when studying high-order cognitive mechanisms, due to their ecological nature and quality to enable complex behavior compounded by discrete entities. I will also discuss how deep-behavioral phenotyping and individualized models applied to neuroimaging data can better account for the subject-specific organization of domain-general cognitive systems in the human brain. Finally, the accumulation of functional brain signatures brings the possibility to clarify relationships among tasks and create a univocal link between brain systems and mental functions through: (1) the development of ontologies proposing an organization of cognitive processes; and (2) brain-network taxonomies describing functional specialization. To this end, tools to improve commensurability in cognitive science are necessary, such as public repositories, ontology-based platforms and automated meta-analysis tools. I will thus discuss some brain-atlasing resources currently under development, and their applicability in cognitive as well as clinical neuroscience.
Equivariant neural networks and representation theory
Or: Beyond linear.
Abstract: Equivariant neural networks are neural networks that incorporate symmetries. The nonlinear activation functions in these networks result in interesting nonlinear equivariant maps between simple representations, and motivate the key player of this talk: piecewise linear representation theory.
Disclaimer: No one is perfect, so please mind that there might be mistakes and typos.
dtubbenhauer@gmail.com
Corrected slides: dtubbenhauer.com/talks.html
Bob Reedy - Nitrate in Texas Groundwater.pdf
Presented at June 6-7 Texas Alliance of Groundwater Districts Business Meeting
bordetella pertussis.................................ppt
Bordettela is a gram negative cocobacilli spread by air born drop let
Shallowest Oil Discovery of Turkiye.pptx
The Petroleum System of the Çukurova Field - the Shallowest Oil Discovery of Türkiye, Adana
ANAMOLOUS SECONDARY GROWTH IN DICOT ROOTS.pptx
Abnormal or anomalous secondary growth in plants. It defines secondary growth as an increase in plant girth due to vascular cambium or cork cambium. Anomalous secondary growth does not follow the normal pattern of a single vascular cambium producing xylem internally and phloem externally.
20240520 Planning a Circuit Simulator in JavaScript.pptx
Evaporation step counter work. I have done a physical experiment.
(Work in progress.)
Sharlene Leurig - Enabling Onsite Water Use with Net Zero Water
Sharlene Leurig - Enabling Onsite Water Use with Net Zero WaterTexas Alliance of Groundwater Districts
Presented at June 6-7 Texas Alliance of Groundwater Districts Business Meeting8.Isolation of pure cultures and preservation of cultures.pdf
Isolation of pure culture, its various method.
Deep Software Variability and Frictionless Reproducibility
Deep Software Variability and Frictionless ReproducibilityUniversity of Rennes, INSA Rennes, Inria/IRISA, CNRS
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
3D Hybrid PIC simulation of the plasma expansion (ISSS-14)
3D Particle-In-Cell (PIC) algorithm,
Plasma expansion in the dipole magnetic field.
Nucleic Acid-its structural and functional complexity.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
原版制作(carleton毕业证书)卡尔顿大学毕业证硕士文凭原版一模一样
原版纸张【微信：741003700 】【(carleton毕业证书)卡尔顿大学毕业证】【微信：741003700 】学位证，留信认证（真实可查，永久存档）offer、雅思、外壳等材料/诚信可靠,可直接看成品样本，帮您解决无法毕业带来的各种难题！外壳，原版制作，诚信可靠，可直接看成品样本。行业标杆！精益求精，诚心合作，真诚制作！多年品质 ,按需精细制作，24小时接单,全套进口原装设备。十五年致力于帮助留学生解决难题，包您满意。
本公司拥有海外各大学样板无数，能完美还原海外各大学 Bachelor Diploma degree, Master Degree Diploma
1:1完美还原海外各大学毕业材料上的工艺：水印，阴影底纹，钢印LOGO烫金烫银，LOGO烫金烫银复合重叠。文字图案浮雕、激光镭射、紫外荧光、温感、复印防伪等防伪工艺。材料咨询办理、认证咨询办理请加学历顾问Q/微741003700
留信网认证的作用:
1:该专业认证可证明留学生真实身份
2:同时对留学生所学专业登记给予评定
3:国家专业人才认证中心颁发入库证书
4:这个认证书并且可以归档倒地方
5:凡事获得留信网入网的信息将会逐步更新到个人身份内，将在公安局网内查询个人身份证信息后，同步读取人才网入库信息
6:个人职称评审加20分
7:个人信誉贷款加10分
8:在国家人才网主办的国家网络招聘大会中纳入资料，供国家高端企业选择人才
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...
The pygmy halfbeak Dermogenys colletei, is known for its viviparous nature, this presents an intriguing case of relatively low fecundity, raising questions about potential compensatory reproductive strategies employed by this species. Our study delves into the examination of fecundity and the Gonadosomatic Index (GSI) in the Pygmy Halfbeak, D. colletei (Meisner, 2001), an intriguing viviparous fish indigenous to Sarawak, Borneo. We hypothesize that the Pygmy halfbeak, D. colletei, may exhibit unique reproductive adaptations to offset its low fecundity, thus enhancing its survival and fitness. To address this, we conducted a comprehensive study utilizing 28 mature female specimens of D. colletei, carefully measuring fecundity and GSI to shed light on the reproductive adaptations of this species. Our findings reveal that D. colletei indeed exhibits low fecundity, with a mean of 16.76 ± 2.01, and a mean GSI of 12.83 ± 1.27, providing crucial insights into the reproductive mechanisms at play in this species. These results underscore the existence of unique reproductive strategies in D. colletei, enabling its adaptation and persistence in Borneo's diverse aquatic ecosystems, and call for further ecological research to elucidate these mechanisms. This study lends to a better understanding of viviparous fish in Borneo and contributes to the broader field of aquatic ecology, enhancing our knowledge of species adaptations to unique ecological challenges.
Recently uploaded (20)
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...
Cytokines and their role in immune regulation.pptx
Cytokines and their role in immune regulation.pptx
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Remote Sensing and Computational, Evolutionary, Supercomputing, and Intellige...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Deep Behavioral Phenotyping in Systems Neuroscience for Functional Atlasing a...
Equivariant neural networks and representation theory
Equivariant neural networks and representation theory
bordetella pertussis.................................ppt
bordetella pertussis.................................ppt
20240520 Planning a Circuit Simulator in JavaScript.pptx
20240520 Planning a Circuit Simulator in JavaScript.pptx
Sharlene Leurig - Enabling Onsite Water Use with Net Zero Water
Sharlene Leurig - Enabling Onsite Water Use with Net Zero Water
mô tả các thí nghiệm về đánh giá tác động dòng khí hóa sau đốt
mô tả các thí nghiệm về đánh giá tác động dòng khí hóa sau đốt
8.Isolation of pure cultures and preservation of cultures.pdf
8.Isolation of pure cultures and preservation of cultures.pdf
Deep Software Variability and Frictionless Reproducibility
Deep Software Variability and Frictionless Reproducibility
3D Hybrid PIC simulation of the plasma expansion (ISSS-14)
3D Hybrid PIC simulation of the plasma expansion (ISSS-14)
Nucleic Acid-its structural and functional complexity.
Nucleic Acid-its structural and functional complexity.
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...
SNP genotyping using Affymetrix' Axiom Genotyping Solution
- 1. CNNNNNNNN-Hapten2-5 ~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAA [A/G] 3 5 ~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAAA TT ~ACCGTCTACGAAATATCTTTCACGTTGTCGTATAAT AT Average HapMap ≥99.5% Concordance Average Reproducibility SNP genotyping using Affymetrix’ Axiom® Genotyping Solution M. Shapero, M. Purdy, R. Kurapati, J. Law, H. Lee, H. Loi, D. Nguyen, P. H. Wang, A. Yan, C. S. Yu, M. Shirazi, L. Bellon Affymetrix, Inc. Santa Clara, CA 95051 USA ABSTRACT #7310 The use of DNA microarrays for easy, cost-effective genotyping of single nucleotide polymorphisms (SNPs) and insertion/deletion polymorphisms (indels) Probe design for interrogation of SNPs and indels ACATTAAAAGCTATCATTTAAATTTGGTTGAGACA[C/T]AATATGCTGTTGCACTTTCTATAAAGCATCTGCCA TGTAATTTTCGATAGTAAATTTAAACCAACTCTGT[G/A]TTATACGACAACGTGAAAGATATTTCGTAGACGGT 3 5 Non C/G & Non A/T SNPs: 1 probe, 2 colors continues to play an important role in genotype-trait association studies and marker-assisted selection in both plant and animal breeding programs. Axiom® Genotyping Solution enables complete automation of DNA target preparation, DNA amplification, and enzymatic fragmentation of post-amplification products on the Biomek® FXP Target Prep Express platform. Following target preparation, arrays are processed using GeneTitan® Multi-Channel (MC) Instrument. Here we describe a new Axiom® product in which 384 individual arrays, contained in the footprint of a standard microtiter plate, offer the capability to genotype approximately 50,000 variants in combination with a processing throughput of greater than 3,000 samples per week. The 384-array layout is ideal for high-throughput screening in molecular breeding or marker- assisted selection programs where ease of use, accuracy, and turnaround time are all essential. The Axiom 384-array layout retains full compatibility with the currently existing Axiom instrumentation platform and downstream data analysis stream. Genotyping performance metrics obtained with Axiom 384-array layout -p 5 ANNNNNNNN-Hapten1-5 -p 5 3 5ANNNNNNNN-Hapten1-5 TNNNNNNNN-Hapten1-5 •Mis-match occurs on 3’ side of ligation junction 3 5 -p 5 5 ACATTAAAAGCTATCATTTAAATTTGGTTGAGACA[A/T]AATATGCTGTTGCACTTTCTATAAAGCATCTGCCA 3 3 TGTAATTTTCGATAGTAAATTTAAACCAACTCTGT[T/A]TTATACGACAACGTGAAAGATATTTCGTAGACGGT 5 •Mis-match occurs on 5’ side of ligation junction C/G & A/T SNPs: 2 probes, 1 color Insertion/deletions: 1 probe, 2 colors will be presented. I In summary, new Axiom® advances to DNA sample type compatibility, high- throughput sample processing enabled with laboratory automation, and the 384- array layout further extend the platform’s capabilities to genotype thousands of samples per week with minimal manual intervention that is consistent with the needs of both animal and plant agrigenomics solutions. Axiom biochemistry and workflow overview Total genomic DNA (100 ng) is amplified and randomly fragmented into 25 to 125 base pair (bp) fragments Axiom probes are typically 30 mers that contain a 5’-phosphate group Fragmented whole-genome amplified genomic DNA hybridizes to the array- bound probes The polymorphic nucleotides are detected using two differentially labeled sets of ligation probes Axiom 384 layout automated target prep (ATP) tested on standard Axiom® Genome-Wide CEU 1 Array Plate Experiment designed to uncouple Axiom 384 layout ATP from Axiom 384 array layout in order to independently assess Axiom 384 layout ATP and compare the performance with specifications established for the Axiom 96 layout ATP DNA samples prepared using Axiom 384 layout ATP executed on three different Biomek instruments and a subset of samples were tested on standard 96-array Axiom® GW CEU 1 Array Plate (genome-wide array that includes validated markers from human populations with northern and western European ancestry) All genotyping performance specifications pass acceptance criteria These fragments are purified, re-suspended, and hybridized to customized Axiom® myDesign™ Arrays Plates Following hybridization, the bound target is washed under stringent conditions to remove non-specific background caused by random ligation events. Each polymorphic nucleotide is queried via a multi-color ligation event carried out on the array surface After ligation, the arrays are stained and imaged on GeneTitan MC Instrument 384 ATP#1 100% 0.985 99.7% 99.7% 384 ATP#3 100% 0.988 99.8% 99.7% Metrics Overall Sample Pass Rate DQC Median Average Call Rate Average HapMap Concordance Average Reproducibility Acceptance criteria ≥97% ≥99.0% ≥99.5% ≥99.8% 384 ATP#2 100% 0.984 99.7% 99.7% 99.9% Biomek FXP Target Prep Express System Axiom 384 array layout performance Axiom 384 layout Metrics Number of Input Samples Overall Sample Pass Rate 384 sample acceptance criteria ≥97% 384 ATP_I 380 100% DQC Median Average Call Rate ≥99.0% 0.984 99.7% GeneTitan® Multi-Channel Instrument Axiom 384 array layout can be processed on an existing in-market GTMC with only a software upgrade Axiom 384 array layout is capable of genotyping 100–45,000 SNPs from diploid species or up to 32,000 SNPs from polyploid species 8-plate workflow in 5 days offers a throughput in excess of 3,000 samples per week The SNP content on the Axiom 384 array layout can be selected from in- market agrigenomic arrays for plants and animals or from SNPs that have been discovered through next generation-sequencing 99.8% ≥99.8% 99.9% (100 sets) Axiom 384 layout ATP used with HapMap270 DNA samples (4 blank wells excluded from analysis; T03 YRI samples in duplicate) Axiom 384 Test Array_1 used to assess genotyping performance SNP content is from Axiom validated database and represents ~14K SNPs known to have MAF >5% in YRI samples All genotyping performance specifications pass acceptance criteria