2. BIOFORTIFICATION
• Greek word “bios” means “life” and Latin word “fortificare” means
“make strong”.
• Fortification the addition of an ingredient to food to increase the
concentration of a particular element.
• Biofortification is a process for improving the nutritional value of
the edible parts of the plants, through mineral fertilization,
conventional breeding, or transgenic approaches.
3. NEED FOR BIOFORTIFICATION
• Hunger is the physical sensation of desiring food.
• The term “hidden hunger” has been used to describe the
micronutrient malnutrition inherent in human diets that are
adequate in calories but lack vitamins and/or mineral
elements.
• India is one of the countries having problem of malnutrition
• More than 50% of women, 46% of children below 3 years are
underweight and 38% are stunted.
• As per India state hunger index, all the states are with serious to
alarming indices with M.P. most alarming.
4. • There are 16 essential minerals, but 11 of them are required
in such small amounts and are so abundant in food and
drinking water that deficiency arises only in very unusual
circumstances. The remaining five are present in limiting
amounts in many foods, so a monotonous diet can easily
result in deficiency.
• These minerals are iodine (I), iron (Fe), zinc (Zn), calcium
(Ca), and selenium (Se).
5. • India is one of the worst affected countries in the world, with more
than 50 million cases of goiter and more than two million of
cretinism.
• The UN Standing Committee on Nutrition (UN/SCN) estimates that
140 million children and 7 million pregnant women are VA
deficient, primarily in Africa and South/Southeast Asia.
• The immediate outcome of Fe deficiency is iron deficiency anemia
(IDA), which is thought to affect at least two billion people
worldwide.
• Nearly two billion people are at risk of Zn deficiency,
predominantly children and pregnant women. Signs of severe zinc
deficiency include hair loss, skin lesions, wasting, and persistent
diarrhea.
6. Goal
• The ultimate goal of the biofortification strategy is to reduce mortality and
morbidity rates related to micronutrient malnutrition and to increase food
security, productivity, and the quality of life for poor populations of
developing countries by breeding staple crops that provide, at low cost,
improved levels of bioavailable micronutrients in a fashion sustainable way
over time.
11. Approach/protocol Successful examples
• Marker Technology Marker assisted Selection (MAS) a) High lysine in maize: First successful demonstration of marker
assisted selection; Several QPM hybrids in maize (Gupta et al., 2009,
2013)
b) High provitamin-A in maize (Muthusamy et al., 2014).
• Genetic Engineering (GE) Recombinant DNA approach
(rDNA)
a) High lysine: sorghum (Zhao et al., 2003), rice (Sindhu et al., 1997,
Katsube et al., 1999, Stoger et al., 2001, Christou and Twyman,
2004), wheat (Stoger et al., 2001; Christou and Twyman, 2004)
b) High methionine: rice (Hagan et al., 2003), maize (Lai and Messing,
2002).
• Gene stacking approach a) The three vitamin corn with five stacked genes (Naqvi et al., 2009)
b) Multi-biofortified rice with enhanced pro-vitamin A, zinc, iron and
folate concentrations (De Steur et al., 2012)
• Gene silencing (GS) approach a) Changing of the relative proportions of starch components amylose
and amylopectin in wheat and potato (Lafiandra et al., 2008);
enhanced B-glucan in wheat
b) Modifying levels of proteins and amino acids (Uauy et al., 2006),
GilHumanes et al., 2010 in wheat; O’Quinn et al., 2000); Yang et al.
(2002) in maize c) Modifying levels of fatty acids (Liu et al., 2002a,
2002b; Young et al., 2004, ILSI, 2008) in maize.
• Metabolic engineering Desired levels of qualitative and quantitative enhancement of compounds
of significance in human nutrition. (Dharmapuri et al., 2002- xanthophylls
content in tomato; Diretto et al., 2007a -carotenoid in potato; Fujisawa et
al., 2008-carotenoid in flax seed; Shintani and DellaPenna, 1998-vitamin E
in plants, Storozhenko et al., 2007-folate in rice)
• Direct multiple gene transfer approach a) Expression of complex recombinant macromolecules into the plant
genome in rice (Nicholson et al., 2005).
b) Engineered minichromosomes segregating independently of the
host chromosomes in maize (Carlson et al., 2007)
• Synthetic proteins and nucleotides approach Synthetic storage protein in sweet potato (Egnin and Prakash, 1997;
Prakash and Jaynes, 2000)
• Gene Editing Protocols Transcription Activator‐Like
Effector Nucleases (TALENs) approach
a) Several mutations in barley (Wendt et al., 2013) b) Improved quality of
soybean oil (Huan et al., 2014)
16. Pearl millet
MTPs, metal tolerance proteins;
FRO2, ferric chelate reductase;
ZIP, zinc regulator transporter
proteins;
AtIRT1, divalent metal transporter;
NA, Nicotianamine;
YSLs, yellow stripe like transporters;
ITPs, Iron transport proteins;
17. ZIP=ZRT-,IRT-like protein,
YSL=yellow stripe like transporter,
MFS=major facilitator superfamily transporter,
MTP=metal tolerance protein,
HMA=heavy metal ATPase,
FPN=ferroportin, NRAMP=natural resistance-
associated macrophage protein,
VIT=vacuolar iron transporter,
NA=nicotianamine,
Cit=citrate,
SP=small proteins
Protein storage vacuoles(PSVs),
phytate(Phy)
WHEAT
18.
19. Organizations working for biofortification
• The Consortium of International Agricultural Research Centers
(CGIAR) is an independent international organization established
under international law, with full international legal authority and
capacity to enter into treaties, agreements, and contracts, and
which responds to legal proceedings.
• HarvestPlus is the most significant, systematic, and symbolic
program of biofortification through conventional breeding. It is
an interdisciplinary program of plant breeders, molecular
biologists, nutritionists, economists, and communication and
behaviour change experts. The program was launched in 2004
with funding from the Bill and Melinda Gates Foundation and is
now coordinated through the CGIAR.
20. CIAT and IFPRI are the co-convening Centers of HarvestPlus
21.
22. Yadava, D. K., Hossain, F., & Mohapatra, T. (2018). Nutritional security through crop biofortification in India:
Status & future prospects. The Indian journal of medical research, 148(5), 621.
23. CROP VARIETY QUALITY INSTITUTE
Rice
CR Dhan 310
high protein (10.3%) ICAR-National Rice Research Institute,
Cuttack, Odisha.
DRR Dhan 45 high zinc (22.6 ppm) ICAR-Indian Institute of Rice Research,
Hyderabad, Telangana.
Wheat
WB 02
High zinc (42.0 ppm) and iron (40.0 ppm) ICAR-Indian Institute of Wheat and Barley
Research, Karnal, Haryana.
Pusa Vivek QPM9
improved
high provitamin-A (8.15 ppm) and also
contains high tryptophan (0.74%) and lysine
(2.67%) in endosperm protein
ICAR-IARI, New Delhi.
Pearl millet
HHB 299
high iron (73.0 ppm) and zinc (41.0 ppm)
content
Chaudhary Charan Singh-Haryana
Agricultural University, Hisar in
collaboration with (ICRISAT), Patancheru,
Hyderabad, Telangana, under ICAR-All
India Coordinated Research Project on
Pearl millet.
Pomegranate
Solapur Lal
high iron (5.6-6.1 mg/100 g), zinc (0.64-0.69
mg/100 g) and vitamin C (19.4-19.8 mg/100
g) in fresh arils
ICAR-National Research Centre on
Pomegranate, Pune, Maharashtra
Soybean
NRC-127
18.5-20.0 per cent oil and 38.0-40.0 per cent
protein content
ICAR-Indian Institute of Soybean Research,
Indore, Madhya Pradesh.
26. Advantages
• Investment is only required at the research and development
stage, and thereafter the nutritionally enhanced crops are entirely
sustainable.
• Mineral rich plants tend to be more vigorous and more tolerant
of biotic stress, which means yields are likely to improve in line
with mineral content.
• greatest long-term cost-effectiveness overall and is likely to have
an important impact over the next few decades.
• Moreover, plants assimilate minerals into organic forms that are
naturally bioavailable and contribute to the natural taste and
texture of the food.
• Further, fortified or enriched seeds also have more plant vigour,
seedling survival, faster initial emergence and grain yield.
27. Future Challenges
• Detailed knowledge on mechanisms regulating iron
compartmentalization in various plant organs will offer a major
contribution for reaching such goal.
• Improve the efficiency with which minerals are mobilized in the
soil.
• Reduce the level of antinutritional compounds such as phytic
acid, which inhibit the absorption of minerals in the gut
28. CASE STUDIES
• Development and Evaluation of Low Phytic Acid Soybean by
siRNA Triggered Seed Specific Silencing of Inositol
Polyphosphate 6-/3-/5-Kinase Gene
• Biofortification of field-grown cassava by engineering
expression of an iron transporter and ferritin
29. • They designed and expressed a inositol polyphosphate 6-/3-/5-kinase gene-
specific RNAi construct in the seeds of Pusa-16 soybean cultivar and
subsequently conducted a genotypic, phenotypic and biochemical analysis of
the developed putative transgenic populations and found very low phytic acid
levels, moderate accumulation of inorganic phosphate and elevated mineral
content in some lines. These low phytic acid lines did not show any reduction in
seedling emergence and displayed an overall good agronomic performance.
30. MATERIALS AND METHODS
Construction of RNAi Expression Vector
Generation of Transgenic Plants Expressing RNAi Construct
Transgene Integration Analysis: PCR Examination; Segregation
Analysis; Analysis by Southern Blotting
Transcript Analysis by Quantitative Real-Time PCR
Estimation of Seed Phosphorus Levels
Analysis of Phytic Acid Concentration by HPLC
In Vitro Bioavailability Assay
Agronomic Evaluation of Transgenic Plants: Germination Assay
for Seed Viability; Phenotypic Analysis
Statistical Analysis
31. Vector (305 bp)
(GmIPK2_S; FP 50-CG
CGGATCCGCGTTGCAGAAGCTCAAG-30
and
RP 50-TCCCC GCGGGG
AGCGACACTAATTCAAG-30) and anti-
sense (GmIPK2_As; FP 50-
CCGCTCGAGCGGAACGTC TTCGAGT TC-
30 and
RP 50-
CCATCGATGGCGCTGTGATTAAGTTCGT
A-30)
spacer of soybean
fatty acid
oley1112
desaturase gene
intron (GmFad2-1;
FP 50-TCCCCG
CGGGGAAGGTC
TGTCTTATTTTG
AATC-30 and RP
50CCATCGATGG
TATACCGCACTA
GT AAACCAC-
30)
33. PCR Result:
(FP 50-CGCGGATCCGCGTTGC AGAA GCTCAAG-30) and GmFAD2-1 reverse
(RP 50-CCATC GATGGTATACCGCACTAGTAA ACCAC-30) primers were used to
amplify a 700 bp fragment using thermal cycling conditions of 1 min at 94◦C; 30
cycles of 30 s at 94◦C, 30 s
at 62◦C, 30 s at 72◦C; and a final extension of 10 min at 72◦C.
37. • They used genetic engineering to improve mineral micronutrient concentrations in cassava.
Overexpression of the Arabidopsis thaliana vacuolar iron transporter VIT1 in cassava accumulated three-
to seventimes-higher levels of iron in transgenic storage roots than nontransgenic controls in confined
field trials in Puerto Rico. Plants engineered to coexpress a mutated A. thaliana iron transporter (IRT1) and
A. thaliana ferritin (FER1) accumulated iron levels 7–18 times higher and zinc levels 3–10 times higher than
those in nontransgenic controls in the field. Growth parameters and storage-root yields were unaffected
by transgenic fortification in our field data. Measures of retention and bioaccessibility of iron and zinc in
processed transgenic cassava indicated that IRT1+FER1 plants could provide 40–50% of the EAR for iron
and 60–70% of the EAR for zinc in 1- to 6-year-old children and nonlactating, nonpregnant West African
women.
38. Material and method
• Molecular characterization of in vitro– and greenhouse-grown
transgenic plants
• Plant establishment and growth in the greenhouse
• Determination of total biomass in the greenhouse
• Determination of T-DNA copy number
• Measurement of mineral concentrations
• Bioaccessibility studies
• Determination of EARs.