1- T-F- Annual borius plans are long-term executive inctitives- and at.docx

•Download as DOCX, PDF•

0 likes•2 views

1. T.F. Annual borius plans are long-term executive inctitives, and atsce optiona arw shos. highs incured to erpolorets bused on heir. objoctives. developing a training plan, claritying a training budget and desging the traniog 7. T.F.As compared to time series analysis, controlled experimentaton a a vald and relable training evaluation mothod. 8. T.F. Upward 1 subordinates appraisal is when a supervisor conducts. the arnul Pertormance appraisal of empioyee under his her supervision. 9. T.F. The basic puipose of a performance appraisal system is to improve the petormatice of individuals, fearns, and the entire organ zation 10. T.F. Simulators are training and delivery systems commonly usod for training airline pilats. 11. T.F. Exit interviews are typically used as an employee selection method. 12. T.F. Achievament tests measure a candidate's knowledge of the job dubes. 13. T.F. Unlike other forms of tests, personalify tests do not focus an-qualites but are ratur designed to predict an employeels future perfocmance by locking at personal trats. temperamente, attitudes or dispositions. 14. T.F. Behavioral interviews ask applicants about specif everts as opposed to just hang them tell about themselves. 15. T.F. Sifuational interviews focus on how an individual handled job-related ciraumstances in the past. 16. T.F. According to Vroom's theory, if expectancy, instrumentaity, or valence is equal ts zarp. there will be no employee motivation. 17. T.F. Direct finaricial compensation consists of the poy that a person receses in the form of wages, salaries, and corminissions. 18. T.F. Edward Dec found that extrintic rewards could at times actualy detract hon the parson's intrifsic motivation. 19. T.F. Interviews are vald predictors of sucoess on the job, which is ahy they are commoriy used to evaluate applicants 20. T.F. During the proces of test validation, predictive validation invelves asminatering the test of the cufrent employees. 21 T.F. Intervidws can be made more efledive f the interviener studes the job deserigton and ustesz siandardized interview iorm. 23 The Pinis organizational stuctuce and gouis. at il ipencific bine .

Education

Similar to 1- T-F- Annual borius plans are long-term executive inctitives- and at.docx

chapter6-mktg5

Irene Simon

Staffing

maryam Hamid

performance appraisal PPT

AvkeshNigam

Chapter 09

Indankal suresh

Hrm selecting employees

Alvin Niere

Selection and Appointment

Manage Train Learn

Untitled document

Divi Dhivya

#RecruitmentManager #HumanResourcesManager #TalentAcquisition #TalentManager #RecruitmentCoordinator #RecruitmentSpecialist #TechnicalRecruiter #HRCoordinator #HumanResourdesManager #HRManager #OperationsManager #AdministrationManager #Recruitment Manager #HumanCapitalManager #TalentAcquisitionManager #TalentDevelpmentManager #HumanResourcesAssessor #HumanResourcesCraftsmaster #HumanResourcesExpert #RecruitmentOfficer #HROfficer #HRBusinessPartner #RecruitmentConsultant #Headhunter #Emiratisation #DueDiligence #MarketResearch #socialmediamarketing #digitalmarketing #digitalstrategy #socialmedia #CommercialBrokerage #GlobalTrading #InternationalBusinessDevelopment #BusinessMediation #ProjectManagement #ProgramManagement #BusinessSetup #StartUpsSupport #UAEBusiness #InternationalBusiness #HumanResourcesManagement #TeamLeadership #Recruitment #TalentAcquisition #Headhunting #LearningAndDevelopment #Training #Mentoring #Coaching #Administration #Operations #EmployeeRelations #RussianLanguage #ArabicLanguage #LanguageSupport

The Effectiveness of a Pre-Selection Decision At a Search and Selection Firm

Natalie Lewes

Recruitment & selection ch 11 & 12

Dreams Design

FOCUS ON BUSINESS PRACTICES 383 maintaining visibility in the job market are vital to success. As communication teachers and practitioners, we need to highlight strate- gies such as these that will best equip our graduates for the global job market. References Gilleard, C., & Hawkins, P. (2004). If only I’d known. Making the most of higher education— A guide for students and parents. Warwick, UK: Association of Graduate Recruiters Publication. Grant, T., & Borcherds, R. (2008). Communicating @ work—Boosting your spoken, written and visual impact (2nd ed). Pretoria, South Africa: Van Schaik. Rosa, C. 2007. The effectiveness of the job applicant selection process. Retrieved March 9, 2008, from http://www.mba.co.za/article.aspx?rootid=6&subdirectoryid=1666 Address correspondence to Terri Grant, Professional Communication Unit, School of Management Studies, University of Cape Town, Private Bag, Rondebosch, 7701, Cape Town, South Africa; email: [email protected] A REVIEW OF A TELEPHONE-ADMINISTERED BEHAVIOR-BASED INTERVIEW TECHNIQUE Gary C. Oliphant Stetson University Katharine Hansen Quintessential Careers Becky J. Oliphant Stetson University DOI: 10.1177/1080569908321429 THE EMPLOYMENT INTERVIEW is intended to provide insight into a candidate’s future performance by evaluating the oral responses to the questions presented by the interviewer. For decades, researchers have studied many facets of the interview and have produced mixed results as to the predictive validity of the employment interview (McDaniel, Hartman, Whetzel, & Grubb, 2007; Posthuma, Morgeson, & Campion, 2002). Still, interviewing represents the most popular employee selection method among practitioners. If hiring the right person for the job is crucial to the success of any organization, why do employers continue using the employment interview? We offer some explanations and then describe a technique that has offered promising predictive results for a Midwestern consulting firm. Why Use Interviews? The following are offered as reasons that practitioners continue to use employment interviews even though academic research has shown low predictive validity. First, the interview indirectly adds value to the process beyond that of a selection tool in such areas as recruitment, public relations, and feedback. Second, managers believe a face-to- face interview will yield more valid judgments on several observable interpersonal dimensions of behavior (i.e., interpersonal skills, self- assurance, and social poise). Third, managers may continue to use the interview because of company policies, habits, experience, ease, or the feeling of power. Fourth, the employment interview may be a valid pre- dictor of performance that academic researchers have failed to replicate. Recent studies of employment interviews have concluded that struc- tured interviews offer greater predictive validity (Judge, Higgins, & Cable, 2000; McDaniel et al., 2007; Weekley & Ployhart, 2006). Structure.

FOCUS ON BUSINESS PRACTICES 383maintaining visibility in t.docx

keugene1

Job Analysis and Design Introduction This section focuses on three issues in the field of personnel psychology: job analysis, job description, and job design. Job analysis and job description are foundation issues in the field that are often looked at closely from a legal perspective. Job design focuses on the motivation, efficiency, and effectiveness of the worker. Job Analysis A job analysis is the foundation for a variety of human resource functions. For example, recruitment, selection, placement, training and development, compensation, and promotion all rely upon the information gained through a job analysis. A job analysis is, essentially, a snapshot of the job and includes specific information such as the tasks performed by the worker, why the worker performs those tasks, the tools or techniques the worker uses to perform the tasks, and the conditions under which the tasks may be performed. For example, one task statement for a police officer might be, "Under various weather conditions, patrols are assigned an area on foot for the purpose of checking on the security of business establishments." A task statement for a telephone installation technician might read, "Using a staple gun, a screwdriver, and a handheld drill, install inside wiring and telephone instrument connection point." A job analysis may also list the knowledge, skills, abilities, and personality characteristics (or the KSAPCs) required to successfully perform the job. For instance, the requirements for the police officer task statement might be knowledge of criminal law, knowledge of patrol procedures, and ability to observe details. It is important to note that instead of KSAPCs, job analysts may use the acronym KSAO for knowledge, skills, abilities, and other characteristics. There is no one way to perform a job analysis. Choice of a job analysis technique depends upon the purpose of the analysis as well as the training of the analyst. Job analysis data may be collected by observing workers performing the job, having the analyst perform the job, reviewing training materials, interviewing persons who perform the job, interviewing those who supervise the workers, or having workers complete a survey which asks them about the job. The job analyst may design the survey or use a published job analysis survey. Often, more than one data collection method is used. This multimethod approach increases the probability of achieving an in-depth understanding of the job. Assessing Job Descriptions A job description is one of the results of a job analysis. It is a brief statement that summarizes the information contained in the job analysis. A job description is the document that job candidates typically see during the recruitment or selection process. By reviewing a job description, a candidate for the position should have a fairly good understanding of the duties, responsibilities, and requirements of the jo ...

Job Analysis and Design Introduction This section focu.docx

priestmanmable

Problems faced by both the interviewer and the interviewee during an intervie...

Azas Shahrier

RECRUITMENT AND SELECTION

Neelam Asad

evidence shows that linear models can lead to better organizational outcomes: graduate-school admissions decisions and hiring decisions. Improving Admissions Decisions The value of using linear models in hiring, admissions, and selection decisions is highlighted by work Moore and his colleagues undertook on the interpretation of grades (Moore, Swift, Sharek, & Gino, 2007). They found substantial differences in the grading practices of colleges, even between institutions of similar quality and selectivity. The results show that students from colleges with more lenient grading are more likely to get into graduate school, even after controlling for the quality of the institution and the quality of its students. Due to a variant of the representativeness heuristic called the correspondence bias (Gilbert & Malone, 1995), graduate schools misinterpret the high GPAs of alumni from lenient-grading institutions as indicating high performance. The correspondence bias describes the tendency to take others at face value, assuming that their behavior (or their GPAs) corresponds to their innate traits. This bias persists even when those making the admissions decisions have full information about different institutions' grading practices. It seems that people have trouble sufficiently discounting high grades that are due to lenient grading. By contrast, it would be easy to set up a linear program to avoid this error. Indeed, Dawes (1971) did just that in his work on graduate-school admissions decisions. Dawes used a common method for developing his linear model: he first modeled the admissions decisions of a four-person committee. In other words, he systematically analyzed how the committee made its admissions decisions relying on three factors: (1) Graduate Record Examination scores, (2) undergraduate grade point average, and (3) the quality of the undergraduate school. Dawes then used the variable weightings he obtained from modeling the experts in a linear model to predict the average rating of 384 other applicants. He found that the model could be used to rule out 55 percent of the applicant pool without ever rejecting an applicant that the selection committee had in fact accepted. In addition, the linear model was better than the committee itself in predicting future ratings of the accepted and matriculated applicants by faculty! In 1971, Dawes estimated that the use of a linear model as a screening device by the nation's graduate schools (not to mention by the larger domains of undergraduate admissions, corporate recruiting, and so on) could result in an annual savings of about $18 million in professional time. Adjusted for today's dollars and the current number of graduate-school applications, that number would easily exceed $500 million. Improving Hiring Decisions Hiring decisions are among the most important decisions an organization can make. Virtually every corporation in the world relies on unstructured, face-to-face employment interviews as t ...

evidence shows that linear models can lead to better organizationa.docx

gitagrimston

01. HUMAN RESOURCE MANAGEMENT- ETEEAP. presentation (1).pptx

MoisesMacaranasJr

Selection of Human Resource

aizellbernal

ls 5_ch_7_mgt351_qti.pptx

ssuserbea996

HBO employee orientation.pdf

JeanniferMV

Selection-HRM Ppt.pptx

SuveerJain2

HR Management

Yodhia Antariksa

Similar to 1- T-F- Annual borius plans are long-term executive inctitives- and at.docx (20)

chapter6-mktg5

Staffing

performance appraisal PPT

Chapter 09

Hrm selecting employees

Selection and Appointment

Untitled document

The Effectiveness of a Pre-Selection Decision At a Search and Selection Firm

Recruitment & selection ch 11 & 12

FOCUS ON BUSINESS PRACTICES 383maintaining visibility in t.docx

Job Analysis and Design Introduction This section focu.docx

Problems faced by both the interviewer and the interviewee during an intervie...

RECRUITMENT AND SELECTION

evidence shows that linear models can lead to better organizationa.docx

01. HUMAN RESOURCE MANAGEMENT- ETEEAP. presentation (1).pptx

Selection of Human Resource

ls 5_ch_7_mgt351_qti.pptx

HBO employee orientation.pdf

Selection-HRM Ppt.pptx

HR Management

More from Nicholas3uGPooled

1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell. .

1- The following represent various stages of cell division (mitosis-me.docx

Nicholas3uGPooled

1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents? .

1- In cats- again- black color is dominant to a special- temperature-s.docx

Nicholas3uGPooled

1- The ability of a virus to infect one type of organism and not anoth.docx

Nicholas3uGPooled

1. The 3-part, multiple human brain refers to the A. brainstem, limbic system and cortex B. the somatic, sympathetic and parasympathetic systems C. dendrites, soma and axons 2. Fluid leaves closed circulatory systems A. lymph nodes B. fenestrated capillaries C. septa D. valves 3. Myelin is formed by A. axons B. the retina C. oligodendroglia D. astroglia 4. Neurons summarize information in their A. dendrites B. soma C. axon 5. Proprioceptors are located within A. bone B. muscle C. skin D. spinal cord 6. A major contributing factor to age-related disorders of the nervous system is A. humans live much longer than they used to B. genetic predisposition C. nutritional deficiencies D. all of these 7. The lymph system A. produces blood cells B. drains fluid from the body C. removes CO2 from tissues 8. The hippocampus participates in A. memory formation B. memory retrieval C. both 9. An artificial pacemaker A. maintains regular heartbeat B. controls pressure within arteries C. controls valve opening and closing 10. A myocardial infarction refers to A. a drop in blood pressure B. fatty deposits in arterie C. a tear in the wall of a vessel D. death of heart muscle 11. Hemoglobin A. carries oxygen B. carries CO2 C. carries both D. carries neither .

1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx

Nicholas3uGPooled

1. System in science/ Types/ Feedbacks 2. Nature of Physical Geography 3. How do we depict Earth's surface lelevation, depthirelief. 4. Latitude and Longitude, Time Zones, Great circles and Small circles. 5. Remote Sensing - basic concepts (Textbook P. 24-29) 6. Solar energy, Electromagnetic spectrum 7. Methods of energy transfer, Albedo, Heat and temperature / Greenhouse effect. 8. Sun-earth relation/ Sun anglel Why do we have seasons? 9. Atmospheric Structure (layers)/composition, Atmospheric Ozone 10. Air Pressure, Air Temperature and Air Density Their vertical variation. 11. Forces affecting airflow, Pressure gradient force, Coriolis force, Frictional force, Gravitational force. 12. Global Wind Patterns, Tropical Easterlies, MidLatitude Westerlies, Polar Easterlies, winds at upper levels/ Jet streams/ rotating winds, monsoons, Local winds, 13. Atmospheric Moisture, Moisture Parameters, moisture distribution. 14. What is Latent heat and Phase changes, types? 15. Air Lifting Mechanisms, Cloud Classification. Forms of Precipitation .

1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx

Nicholas3uGPooled

1. Select all that apply. Software testing is a process that helps in __________ Group of answer choices Identifying systems issues/bugs. Mitigating legal liability Maximizing profits Increasing product value 2. Group of answer choices ___________________ gives a valuation for all program input variables. Test set Test review Test case Test inspection 3. Group of answer choices Which of the following is not a quality attribute of software? Interoperability Validity Efficiency Recoverability .

1- Select all that apply- Software testing is a process that helps in.docx

Nicholas3uGPooled

1. Reflected and stored are types of XSS attacks. 2. An attack has occurred on your network. An attacker was able to traverse several files and folders, looking for sensitive data. What type of attack has occurred? 3. AH is the protocol within IPSec used for encryption services. 4. As network administrator, you are concerned with the plaintext transmission of sensitive data on the network. Which of the following protocols are used to help secure communications? (Select three.) A. IPSec . HITP 5. To increase network security, you have decided to use HTTPS on your shopping cart site. Which of the following ports does HTTPS use? A. 80 B. 53 C. 443 D. 51 6. _____and AH are used to secure IPSec transmissions. 7. CSRF attacks exploit the trust a Web site has in a user's Web browser. 8. Kerberos is a(n)___ protocol. 9. To increase overall communication security, you decide to implement 3DES encryption. Which of the following statements is true of 3DES? 10. You are concerned about a cross-site forgery attack. Which of the following can you do to help prevent such an attack? 11. To establish IPSec encryption, two hosts must create a shared key with each other before SA negotiations can take place. .

1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx

Nicholas3uGPooled

1. Pandoravirus salinus is virus that infects amoeba, is very large ( 1 m ) and has a genome composed of double-stranded DNA that is 2.47 Mbp in size ( 247 , 000 , 000 bp). P . salinus has genes not typically associated with viruses, such as genes required for the synthesis of amino acids. In what ways might this force virologists to re-examine the definition of virus? 2. Many chemical biocides (disinfectants) target the lipid envelopes of viruses. Why would the chemical destruction of the envelope render the virus non-infectious? 3. Some viruses cause cancer. For example, Human Papillomavirus (HPV) that is associated with the development of cervical cancer and believed to play a role in head and neck tumors. Given what you know about viral replication, would the induction of cancer be beneficial to the virus? 4. What is one major way in which next generation sequencing differs from dideoxy sequencing (Sanger)? .

1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx

Nicholas3uGPooled

1. Joe Smith works in the IT department of a large industrial company. He is tasked with maintaining IT security for the company. He also teaches a night class at the local career tech center. He has overheard several of the students in the class talking about a software tool they downloaded that would allow them to launch automated software attacks. If the students were to use this software, what category of attacker would these students be considered? Cyberterrorists Brokers Insiders Cybercriminals Script Kiddies 2. Sally Wilson works for a small retail business and provides all IT support for the company. As part of her job, Sally has recently been tasked with ensuring that all IT systems are secured appropriately. To ensure company-wide IT security, Sally implemented a security awareness training program for all employees. After this training was completed, an employee informed Sally about the following situation: 1. The employee (Jim) mentioned that he was at a party and was befriended by a person that knew several of his other friends. This "new friend" began asking him about the company he worked for and was particularly interested in his company's marketing strategy for a new product being developing when Jim mentioned that he was the marketing manager. Jim was concerned and cautious as to any company information he provided. 2. As the party progressed, a drinking game was initiated which required players to provide information like: family member names, pet names, previous addresses, favorite colors and flowers, and a variety of other personal information. 3. A week for so after the party, Jim noticed that sporadically his email account would be locked out, and he would be required to reset his password to gain access. This occurred on several times and was continuing to occur. 4. Jim also received an email that indicated that his system password needed to be changed, and a URL was provided to access the web location for making the change. Sally was concerned that someone might be trying to hack into Jim's email and corporate access account. What security attack topic should she review with the company employees that was more than likely the beginning of this situation? Identity Theft Password Cracking Social Engineering Hoaxes Spear Phishing Dumpster Diving 3. George Mills works for a government agency in the IT security department. Upon arriving at work, he reviewed last night's network security logs and found indications that there was potential for a network security breach. Upon further inspection, it seems that an intruder from the Internet gained access to the internal network, accessed a server with enhanced privileges via a documented OS flaw, and installed a keylogger. Which of the following security defenses seem to be deficient in this situation? (Choose three) effective backup strategy implementation of least privilege regular operating system patching Up-to-date malware software proper firewall rules.

1- Joe Smith works in the IT department of a large industrial company-.docx

Nicholas3uGPooled

1. In order to beat, the heart requires A. nervous system input B. hormonal signalling C. generates its own pulse 2. Voluntary movement is controlled by the A. somatic system B. autonomic system 3. __________________ means producing a few offspring, with a lot of parental care provided. A. Protective reproduction B. Shotgun reproduction C. Sexual reproduction D. Asexual reproduction 4. Following injury, a scar may form within brain tissue by A. blood vessel cells B. astroglia C. injured neurons D. microglia 5. The central nervous system consists of the A. brain and spinal cord B. sensory neurons C. motor neurons D. sensory and motor neurons 6. Background regulatory systems like are toggled up by the A. sympathetic system B. parasympathetic system C. somatic system .

1- In order to beat- the heart requires A- nervous system input B- h.docx

Nicholas3uGPooled

1. In terms of the environment of early earth, what resulted from the development of photosynthesis? Cell Membranes Oceans An aerobic environment An anaerobic environment 2. Which of the following enzymes will create an RNA strand? DNA Polymerase Primase Helicase RNA Polymerase 3. Which of the following I S NOT a characteristic of living organisms? Can live with no energy provided by the external world Can convert molecules obtained from their environment into a new biological molecule Use genetic information to reproduce themselves Consist of one or more cells They evolve 4. Which of the following is not a force of evolution? Natural Selection Genetic Drift Mutation Gene Flow Vestigial Structures 5. True or False: Evolution is the optimization of organisms over multiple generations. 6. Which of the following is needed for natural selection to occur? (Select all that apply) Variation within a population Time Geographic isolation More offspring are produced than can survive. Traits are inherited by offspring. Two populations mating 7. Select all of the statements that are true of DNA DNA is double-stranded DNA is single-stranded DNA is less stable than RNA DNA is more stable than RNA DNA is directly involved in the synthesis of proteins. DNA is antiparallel. 8. True or False: Speciation due to two populations breeding at different times in the same area is an example of sympatric speciation 9. True or False: Allele frequencies can change within an organism 10. Which of the following is not a DNA sequence? AUGUGCGUAACUGUGA ATTTTGGGGGCCCCGGAATT ATGTGCGTAACTGTGA .

1- In terms of the environment of early earth- what resulted from the.docx

Nicholas3uGPooled

1- Identify one job position to develop- compentency based job descrip.docx

Nicholas3uGPooled

1. Implement a Python function that accepts an positive integer and returns a list of strings that resembles binary counting starting from aero up to the input number. A non-positive input integer must return an empty list. 2. A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward such as the number 108801 . Write a Python function that accepts either an integer or string and returns a tuple consisting of two possible palindromes that can be made from the input sequence. .

1- Implement a Python function that accepts an positive integer and re.docx

Nicholas3uGPooled

1- How may have the complex lifestyle of digentic trematodes evolved-.docx

Nicholas3uGPooled

1. identify and discuss the two most imporant factors in population dynamics, birth and death , and how theh shape population charecteristics. 2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns. 3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment. 2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns. 3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment. .

1- identify and discuss the two most imporant factors in population dy (1).docx

Nicholas3uGPooled

1- How does ancestry and race play into disease genetics- 2- How does.docx

Nicholas3uGPooled

1. Historical Development of Computing and Information Technology a) Historical Background b) The Development of the Microprocessor c) Development of Computer Software and the Personal Computer (PC) 2. Development of the Internet 3. Development of the World Wide Web 4. The Emergence of Social and Ethical Problems in Computing a) The Emergence of Computer Crimes b) The Present Status: An Uneasy Cyberspace 5. The Case for Computer Ethics Education a) What Is Computer Ethics? b) Why You Should Study Computer Ethics .

1- Historical Development of Computing and Information Technology a) H.docx

Nicholas3uGPooled

1. How has examining your beliefs, assumptions, and values related to your historical and current events impacted how you process information in your daily life? For example, consider claims made by politicians, news headlines, tweets by celebrities, or articles shared by your family on social media. 2. What changes, big or small, have occurred in how you apply historical inquiry skills to classes, your personal life, and/or your career? .

1- How has examining your beliefs- assumptions- and values related to.docx

Nicholas3uGPooled

1- Given the Trilemma- if a country has the free flow of capital and a.docx

Nicholas3uGPooled

1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx

Nicholas3uGPooled

More from Nicholas3uGPooled (20)