1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
•Download as DOCX, PDF•
0 likes•2 views
1. Reflected and stored are types of XSS attacks. 2. An attack has occurred on your network. An attacker was able to traverse several files and folders, looking for sensitive data. What type of attack has occurred? 3. AH is the protocol within IPSec used for encryption services. 4. As network administrator, you are concerned with the plaintext transmission of sensitive data on the network. Which of the following protocols are used to help secure communications? (Select three.) A. IPSec . HITP 5. To increase network security, you have decided to use HTTPS on your shopping cart site. Which of the following ports does HTTPS use? A. 80 B. 53 C. 443 D. 51 6. _____and AH are used to secure IPSec transmissions. 7. CSRF attacks exploit the trust a Web site has in a user's Web browser. 8. Kerberos is a(n)___ protocol. 9. To increase overall communication security, you decide to implement 3DES encryption. Which of the following statements is true of 3DES? 10. You are concerned about a cross-site forgery attack. Which of the following can you do to help prevent such an attack? 11. To establish IPSec encryption, two hosts must create a shared key with each other before SA negotiations can take place. .
Report
Share
Report
Share
Recommended
1- What is the purpose of Lightweight Directory Access Protocol Secure.pdf
1. What is the purpose of Lightweight Directory Access Protocol Secure (LDAPS)?
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control measures
3. What is the purpose of geofencing?
1) It can be used to remotely wipe a lost device.
2) It makes securing the mobile device simpler.
3) It enables devices to be recognized by location and have actions taken.
4) It can enforce device locking with a strong password
4. A site survey will reveal all of the following except which one?
1) Optimal access point placement
2) Captive portal location
3) Channel allocations
4) Link speeds across the site
5. Why is pinning more important on mobile devices ?
1) It uses elliptic curve cryptography .
2) uses less power for pinned certificate requests .
3) It reduces network bandwidth usage by combining multiple CA requests into one .
4 ) It allows caching of a known good certificate when roaming to low-trust networks .
1. What is the purpose of Lightweight Directory Access Protocol Secure (LDAPS)?
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control measures
3. What is the purpose of geofencing?
1) It can be used to remotely wipe a lost device.
2) It makes securing the mobile device simpler.
3) It enables devices to be recognized by location and have actions taken.
4) It can enforce device locking with a strong password
4. A site survey will reveal all of the following except which one?
1) Optimal access point placement
2) Captive portal location
3) Channel allocations
4) Link speeds across the site
5. Why is pinning more important on mobile devices ?
1) It uses elliptic curve cryptography .
2) uses less power for pinned certificate requests .
3) It reduces network bandwidth usage by combining multiple CA requests into one .
4 ) It allows caching of a known good certificate when roaming to low-trust networks .
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control mea.
Ch11 Basic Cryptography
Security+ Guide to Network Security Fundamentals, 3rd Edition, by Mark Ciampa
Knowledge and skills required for Network Administrators and Information Technology professionals to be aware of security vulnerabilities, to implement security measures, to analyze an existing network environment in consideration of known security threats or risks, to defend against attacks or viruses, and to ensure data privacy and integrity. Terminology and procedures for implementation and configuration of security, including access control, authorization, encryption, packet filters, firewalls, and Virtual Private Networks (VPNs).
CNIT 120: Network Security
http://samsclass.info/120/120_S09.shtml#lecture
Policy: http://samsclass.info/policy_use.htm
Many thanks to Sam Bowne for allowing to publish these presentations.
IRJET- A Secure File Storage & Retrieval using Blockchain Technology
https://www.irjet.net/archives/V6/i4/IRJET-V6I4543.pdf
Recommended
1- What is the purpose of Lightweight Directory Access Protocol Secure.pdf
1. What is the purpose of Lightweight Directory Access Protocol Secure (LDAPS)?
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control measures
3. What is the purpose of geofencing?
1) It can be used to remotely wipe a lost device.
2) It makes securing the mobile device simpler.
3) It enables devices to be recognized by location and have actions taken.
4) It can enforce device locking with a strong password
4. A site survey will reveal all of the following except which one?
1) Optimal access point placement
2) Captive portal location
3) Channel allocations
4) Link speeds across the site
5. Why is pinning more important on mobile devices ?
1) It uses elliptic curve cryptography .
2) uses less power for pinned certificate requests .
3) It reduces network bandwidth usage by combining multiple CA requests into one .
4 ) It allows caching of a known good certificate when roaming to low-trust networks .
1. What is the purpose of Lightweight Directory Access Protocol Secure (LDAPS)?
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control measures
3. What is the purpose of geofencing?
1) It can be used to remotely wipe a lost device.
2) It makes securing the mobile device simpler.
3) It enables devices to be recognized by location and have actions taken.
4) It can enforce device locking with a strong password
4. A site survey will reveal all of the following except which one?
1) Optimal access point placement
2) Captive portal location
3) Channel allocations
4) Link speeds across the site
5. Why is pinning more important on mobile devices ?
1) It uses elliptic curve cryptography .
2) uses less power for pinned certificate requests .
3) It reduces network bandwidth usage by combining multiple CA requests into one .
4 ) It allows caching of a known good certificate when roaming to low-trust networks .
A- It leverages encryption protections of SSH to secure FTP transfers.
B- It uses an SSL/TLS tunnel to connect LDAP services.
C- It digitally signs DNS records
D- It provides both symmetric and asymmetric encryption.
2. Which of the following is er a PCI DSS control objective?
1) Build and maintain a secure network
2) Maintain a vulnerability management program
3) Establish a CSO position
4) Implement strong access control mea.
Ch11 Basic Cryptography
Security+ Guide to Network Security Fundamentals, 3rd Edition, by Mark Ciampa
Knowledge and skills required for Network Administrators and Information Technology professionals to be aware of security vulnerabilities, to implement security measures, to analyze an existing network environment in consideration of known security threats or risks, to defend against attacks or viruses, and to ensure data privacy and integrity. Terminology and procedures for implementation and configuration of security, including access control, authorization, encryption, packet filters, firewalls, and Virtual Private Networks (VPNs).
CNIT 120: Network Security
http://samsclass.info/120/120_S09.shtml#lecture
Policy: http://samsclass.info/policy_use.htm
Many thanks to Sam Bowne for allowing to publish these presentations.
IRJET- A Secure File Storage & Retrieval using Blockchain Technology
https://www.irjet.net/archives/V6/i4/IRJET-V6I4543.pdf
SECRY - Secure file storage on cloud using hybrid cryptography
Final project presentation of Final year B.tech CSE Project APJ Abdul Kalam Technological University.
About the project
Cloud computing has now become a major trend, it is a new data hosting technology that is very popular in recent years. In this project, we are developing an web application that can securely store the files to a cloud server. We proposes a system that uses hybrid cryptography technique to securely store the data in cloud. The hybrid approach when deployed in cloud environment makes the remote server more secure and thus, helps the users to fetch more trust of their data in the cloud. For data security and privacy protection issues, the fundamental challenge of separation of sensitive data and access control is fulfilled. Cryptography technique translates original data into unreadable format. This technique uses keys for translate data into unreadable form. So only authorized person can access data from cloud server.
We provide a cloud storage that uses multiple crypotraphic technique which is known by hybrid cryptography. The product provides confidentiality by using security for both upload and download. The data will be secured since we use multi level security techniques and multiple servers for storage.
Formative Task 3: Social Engineering Attacks
Describe briefly the OSI Reference model and its relevance to computer security. [4 Marks]
• Ans 1: The Open System Interconnection Model (OSI) is a standardized framework for describing how computers communicate with each other over a network system. The OSI model also conceptualizes how data flows through a stack of seven layers, beginning with the physical layer and continuing through the datalink, network, transport, session, presentation, and finally the application layer (Simoneau, 2006)
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...BRNSSPublicationHubI
AJCSEWeb Security
Web Security Considerations,SSL (Secure Socket Layer),TLS (Transport Layer Security),SET (Secure Electronic Transaction)
Computer Security Lecture 1: Overview
https://mloey.github.io/courses/security2017.html
We will discuss the following: Cryptography, Computer Security, OSI Security Architecture, Security Structure Scheme, Key Properties, Symmetric Encryption, Asymmetric Encryption, finally Our Book
Network security protocols.pptx
A presentation includes all network security protocols and the threats on our network
Comparative Analysis of Open-SSL Vulnerabilities & Heartbleed Exploit Detection
Since its introduction in 1994 the Secure Socket Layer (SSL) protocol (later renamed to Transport Layer Security (TLS)) evolved to the de facto standard for securing the transport layer. SSL/TLS can be used for ensuring data confidentiality, integrity and authenticity during transport. A main feature of the protocol is its flexibility. Modes of operation and security aims can easily be configured through different cipher suites. During its evolutionary development process several flaws were found. However, the flexible architecture of SSL/TLS allowed efficient fixes in order to counter the issues. This paper presents an overview on theoretical and practical attacks of the last 20 years.
HTTPI BASED WEB SERVICE SECURITY OVER SOAP
Now a days, a new family of web applications 'open applications’, are emerging (e.g., Social Networking, News and Blogging). Generally, these open applications are non-confidential. The security needs of these applications are only client/server authentication and data integrity. For securing these open applications, effectively and efficiently, HTTPI, a new transport protocol is proposed, which ensures the entire security requirements of open applications. Benefit of using the HTTPI is that it is economical in use, well-suited for cache proxies, like HTTP is, and provides security against many Internet attacks (Server Impersonation and Message Modification) like HTTPS does. In terms of performance HTTPI is very close to the HTTP, but much better than HTTPS. A Web service is a method of communication between two ends over the Internet. These web services are developed over XML and HTTP. Today, most of the open applications use web services for most of their operations. For securing these web services, security design based on HTTPI is proposed. Our work involves securing the web services over SOAP, based on the HTTPI. This secure web service might be applicable for open applications, where authentication and integrity is needed, but no confidentiality required.
In our paper, we introduce a web service security model based on HTTPI protocol over SOAP and develop a preliminary implementation of this model. We also analyze the performance of our approach through an experiment and show that our proposed approach provides higher throughput, lower average response time and lower response size than HTTPS based web service security approach.
Authenticated key exchange protocols for parallel
Chennai Office: JP INFOTECH, Old No.31, New No.86, 1st Floor, 1st Avenue, Ashok Nagar, Chennai-83. Landmark: Next to Kotak Mahendra Bank/Bharath Scans
Landline: (044) - 43012642 / Mobile: (0)9952649690
Pondicherry Office: JP INFOTECH, #45, Kamaraj Salai, Thattanchavady, Puducherry - 9
Landmark: Opp. to Thattanchavady Industrial Estate & Next to VVP Nagar Arch.
Landline: (0413) - 4300535 / Mobile: (0)8608600246 / (0)9952649690
Internet Protocol Security as the Network Cryptography System
Internet Protocol Security (IP Security) is a security protocol that serves to secure information in the event of an exchange on the internet. It happens if there is a connection between private IP and public IP. This protocol will exchange packets on the IP layer safely. It provides two types of encryption options, transport, and tunnel. Transport mode will encrypt the data section without changing the packet header. The algorithm used to encrypt data is a symmetric cryptography algorithm. This protocol authenticates and encrypts every packet from a data transmission session. Also, it can generate keys between the sender and the recipient at the first time it is activated and can negotiate the cryptographic keys that will be used during the session. IP Security is an end-to-end cryptosystem that works at the internet layer of the Internet Protocol Suite. The protocol serves to protect the data flow in host-to-host, network-to-network, and network-to-host as well.
SURVEY OF UNITED STATES RELATED DOMAINS: SECURE NETWORK PROTOCOL ANALYSIS
Over time, the HTTP Protocol has undergone significant evolution. HTTP was the internet's foundation for data communication. When network security threats became prevalent, HTTPS became a widely accepted technology for assisting in a domain defense. HTTPS supported two security protocols: secure socket layer (SSL) and transport layer security (TLS). Additionally, the HTTP Strict Transport Security (HSTS) protocol was included to strengthen the HTTPS protocol. Numerous cyber-attacks occurred in the United States, and many of these attacks could have been avoided simply by implementing domains with the most up-to-date HTTP security mechanisms. This study seeks to accomplish two objectives: 1. Determine the degree to which US-related domains are configured optimally for HTTP security protocol setup; 2. Create a generic scoring system for a domain's network security based on the following factors: SSL version, TLS version, and presence of HSTS to easily determine where a domain stands. We found through our analysis and scoring system incorporation that US-related domains showed a positive trend for secure network protocol setup, but there is still room for improvement. In order to safeguard unwanted cyber-attacks, current HTTPS domains need to be extensively investigated to identify if they possess lower version protocol support. Due to the infrequent occurrence of HSTS in the evaluated domains, the computer science community necessitates further HSTS education.
Key Terms Quiz Use terms from the Key Terns list to complete the sen-.docx
Key Terms Quiz Use terms from the Key Terns list to complete the sen- 5. cryptosystem to is the evaluation of a tences that follow. Don't use the same term more than once. Not all terms will be used. 6. referens to every possible value 1. Making two inputs result in the exact same 7. is the function most commonly cryptiggaphic hash is called a(n) 2. A simple way to hide information the 8. The measure of randomness in a data stream is moves a letter a set number called of places down the alphabet. 9. Processing through an algorithm more than once 3. To provide for perfect forward security, one with different keys is called 4. is required for symmetric 10. The basis for symmetric cryptography is the principle of a(n) Multiple-Choice Quiz 1. When a message is sent, no matter what its format, why do we care about its integrity? 2. How is 3DES different from many other types of A. To ensure proper formatting encryption described in this chapter? B. To show that the encryption keys are undamaged A. It only encrypts the hash. C. To show that the message has not been edited B. It hashes the message before encryption. in transit C. It uses three keys and multiple encryption D. To show that no one has viewed the message and/or decryption sets. D. It can display the key publicly. 3. It a messege has a hasty hon tivat aprotect the myessago in transit? A. If the message is editid, the hath witl irs P: Ifintuing longer match. What algurithin can be used to provide for bulk. 5. Hashing destroys the messages to that if cincryption of data? cannot be nead by anyone. A. kifs C. Hashing encrypts the message se that only 13. 1264 the private key holder can read it. C. RI'EMA D. The hash makes the mestage uneditable. D. ElGamal 4. What is the biggeat drawback to symmetric 8. A good hash function is resistant to what? encryption? A. Beute-forcing A. It is too easily broken. B. Rainbow tablest B. It is too slow to beeasily used on mobile C. Lnterceptian devices. D. Collisions C. It requires a key to be securely shared. 9. How is 3DES an improvement over normal EES? D. It is available only on UNIX. A. It uses public and private keys. 5. What is Diffie-Hellman most comimonly used for? B. It hashes the message before encryption. A. Symmetric encryption key exehange C. It uses throe keys and multiple encryption D. Sigrung digital contracts. and/or decryption sets. C. Sectre e-mail D. It is faster than DES. D. Storing encrypted passwords: 10. What is the best kind of key to have? 6. What is public key cryptography a more A. Easy to remember cokmmon name for? B. Long and random Key Terms Quiz Use terms from the Key Terms list to complete the sentences that follow. Don't use the same term more than once. Not all terms will be used. 6. Emails and their attachments can be secuked i. is a protocol used to secune DNS 7. The use of multiple nearly identical messages can packets during transmission across a network: lead to the cryptographic altack. 2. A common encryption metho.
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...IJCSIS Research Publications
Today information security is a challenging factor that touches a lot of areas, including computers and communications. Message communication is kept secure through cryptography so that an eavesdropper is not able to decipher a transmitted message. One of the oldest and simplest known algorithms for cryptography is the Caesar cipher algorithm. In this paper, three programs based on Java, C++, and Python languages have been developed to implement the Caesar cipher algorithm to aid information security students and help them understand this fundamental algorithm. A code flow chart is used for each program to describe the code’s flow. It also reveals the sequence of steps for the code’s main methods, as well as the relationships between them. Furthermore, various technical descriptions are presented in detail for each of the methods used in both the encoding and the decoding of the messages.Hallwaze security snapshot
Purpose built for large enterprises, their security & privacy concerns and the requisite controls that they need for unlocking communication channels
An Enhanced Encryption Technique using BCD and Bit Complementation
https://irjet.net/archives/V4/i1/IRJET-V4I1158.pdf
Modified MD5 Algorithm for Password Encryption
Modified MD5 Algorithm for Password EncryptionInternational Journal of Computer and Communication System Engineering
Modified MD5 Algorithm for Password Encryption1- The following represent various stages of cell division (mitosis-me.docx
1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell.
.
1- In cats- again- black color is dominant to a special- temperature-s.docx
1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents?
.
More Related Content
Similar to 1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
SECRY - Secure file storage on cloud using hybrid cryptography
Final project presentation of Final year B.tech CSE Project APJ Abdul Kalam Technological University.
About the project
Cloud computing has now become a major trend, it is a new data hosting technology that is very popular in recent years. In this project, we are developing an web application that can securely store the files to a cloud server. We proposes a system that uses hybrid cryptography technique to securely store the data in cloud. The hybrid approach when deployed in cloud environment makes the remote server more secure and thus, helps the users to fetch more trust of their data in the cloud. For data security and privacy protection issues, the fundamental challenge of separation of sensitive data and access control is fulfilled. Cryptography technique translates original data into unreadable format. This technique uses keys for translate data into unreadable form. So only authorized person can access data from cloud server.
We provide a cloud storage that uses multiple crypotraphic technique which is known by hybrid cryptography. The product provides confidentiality by using security for both upload and download. The data will be secured since we use multi level security techniques and multiple servers for storage.
Formative Task 3: Social Engineering Attacks
Describe briefly the OSI Reference model and its relevance to computer security. [4 Marks]
• Ans 1: The Open System Interconnection Model (OSI) is a standardized framework for describing how computers communicate with each other over a network system. The OSI model also conceptualizes how data flows through a stack of seven layers, beginning with the physical layer and continuing through the datalink, network, transport, session, presentation, and finally the application layer (Simoneau, 2006)
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...BRNSSPublicationHubI
AJCSEWeb Security
Web Security Considerations,SSL (Secure Socket Layer),TLS (Transport Layer Security),SET (Secure Electronic Transaction)
Computer Security Lecture 1: Overview
https://mloey.github.io/courses/security2017.html
We will discuss the following: Cryptography, Computer Security, OSI Security Architecture, Security Structure Scheme, Key Properties, Symmetric Encryption, Asymmetric Encryption, finally Our Book
Network security protocols.pptx
A presentation includes all network security protocols and the threats on our network
Comparative Analysis of Open-SSL Vulnerabilities & Heartbleed Exploit Detection
Since its introduction in 1994 the Secure Socket Layer (SSL) protocol (later renamed to Transport Layer Security (TLS)) evolved to the de facto standard for securing the transport layer. SSL/TLS can be used for ensuring data confidentiality, integrity and authenticity during transport. A main feature of the protocol is its flexibility. Modes of operation and security aims can easily be configured through different cipher suites. During its evolutionary development process several flaws were found. However, the flexible architecture of SSL/TLS allowed efficient fixes in order to counter the issues. This paper presents an overview on theoretical and practical attacks of the last 20 years.
HTTPI BASED WEB SERVICE SECURITY OVER SOAP
Now a days, a new family of web applications 'open applications’, are emerging (e.g., Social Networking, News and Blogging). Generally, these open applications are non-confidential. The security needs of these applications are only client/server authentication and data integrity. For securing these open applications, effectively and efficiently, HTTPI, a new transport protocol is proposed, which ensures the entire security requirements of open applications. Benefit of using the HTTPI is that it is economical in use, well-suited for cache proxies, like HTTP is, and provides security against many Internet attacks (Server Impersonation and Message Modification) like HTTPS does. In terms of performance HTTPI is very close to the HTTP, but much better than HTTPS. A Web service is a method of communication between two ends over the Internet. These web services are developed over XML and HTTP. Today, most of the open applications use web services for most of their operations. For securing these web services, security design based on HTTPI is proposed. Our work involves securing the web services over SOAP, based on the HTTPI. This secure web service might be applicable for open applications, where authentication and integrity is needed, but no confidentiality required.
In our paper, we introduce a web service security model based on HTTPI protocol over SOAP and develop a preliminary implementation of this model. We also analyze the performance of our approach through an experiment and show that our proposed approach provides higher throughput, lower average response time and lower response size than HTTPS based web service security approach.
Authenticated key exchange protocols for parallel
Chennai Office: JP INFOTECH, Old No.31, New No.86, 1st Floor, 1st Avenue, Ashok Nagar, Chennai-83. Landmark: Next to Kotak Mahendra Bank/Bharath Scans
Landline: (044) - 43012642 / Mobile: (0)9952649690
Pondicherry Office: JP INFOTECH, #45, Kamaraj Salai, Thattanchavady, Puducherry - 9
Landmark: Opp. to Thattanchavady Industrial Estate & Next to VVP Nagar Arch.
Landline: (0413) - 4300535 / Mobile: (0)8608600246 / (0)9952649690
Internet Protocol Security as the Network Cryptography System
Internet Protocol Security (IP Security) is a security protocol that serves to secure information in the event of an exchange on the internet. It happens if there is a connection between private IP and public IP. This protocol will exchange packets on the IP layer safely. It provides two types of encryption options, transport, and tunnel. Transport mode will encrypt the data section without changing the packet header. The algorithm used to encrypt data is a symmetric cryptography algorithm. This protocol authenticates and encrypts every packet from a data transmission session. Also, it can generate keys between the sender and the recipient at the first time it is activated and can negotiate the cryptographic keys that will be used during the session. IP Security is an end-to-end cryptosystem that works at the internet layer of the Internet Protocol Suite. The protocol serves to protect the data flow in host-to-host, network-to-network, and network-to-host as well.
SURVEY OF UNITED STATES RELATED DOMAINS: SECURE NETWORK PROTOCOL ANALYSIS
Over time, the HTTP Protocol has undergone significant evolution. HTTP was the internet's foundation for data communication. When network security threats became prevalent, HTTPS became a widely accepted technology for assisting in a domain defense. HTTPS supported two security protocols: secure socket layer (SSL) and transport layer security (TLS). Additionally, the HTTP Strict Transport Security (HSTS) protocol was included to strengthen the HTTPS protocol. Numerous cyber-attacks occurred in the United States, and many of these attacks could have been avoided simply by implementing domains with the most up-to-date HTTP security mechanisms. This study seeks to accomplish two objectives: 1. Determine the degree to which US-related domains are configured optimally for HTTP security protocol setup; 2. Create a generic scoring system for a domain's network security based on the following factors: SSL version, TLS version, and presence of HSTS to easily determine where a domain stands. We found through our analysis and scoring system incorporation that US-related domains showed a positive trend for secure network protocol setup, but there is still room for improvement. In order to safeguard unwanted cyber-attacks, current HTTPS domains need to be extensively investigated to identify if they possess lower version protocol support. Due to the infrequent occurrence of HSTS in the evaluated domains, the computer science community necessitates further HSTS education.
Key Terms Quiz Use terms from the Key Terns list to complete the sen-.docx
Key Terms Quiz Use terms from the Key Terns list to complete the sen- 5. cryptosystem to is the evaluation of a tences that follow. Don't use the same term more than once. Not all terms will be used. 6. referens to every possible value 1. Making two inputs result in the exact same 7. is the function most commonly cryptiggaphic hash is called a(n) 2. A simple way to hide information the 8. The measure of randomness in a data stream is moves a letter a set number called of places down the alphabet. 9. Processing through an algorithm more than once 3. To provide for perfect forward security, one with different keys is called 4. is required for symmetric 10. The basis for symmetric cryptography is the principle of a(n) Multiple-Choice Quiz 1. When a message is sent, no matter what its format, why do we care about its integrity? 2. How is 3DES different from many other types of A. To ensure proper formatting encryption described in this chapter? B. To show that the encryption keys are undamaged A. It only encrypts the hash. C. To show that the message has not been edited B. It hashes the message before encryption. in transit C. It uses three keys and multiple encryption D. To show that no one has viewed the message and/or decryption sets. D. It can display the key publicly. 3. It a messege has a hasty hon tivat aprotect the myessago in transit? A. If the message is editid, the hath witl irs P: Ifintuing longer match. What algurithin can be used to provide for bulk. 5. Hashing destroys the messages to that if cincryption of data? cannot be nead by anyone. A. kifs C. Hashing encrypts the message se that only 13. 1264 the private key holder can read it. C. RI'EMA D. The hash makes the mestage uneditable. D. ElGamal 4. What is the biggeat drawback to symmetric 8. A good hash function is resistant to what? encryption? A. Beute-forcing A. It is too easily broken. B. Rainbow tablest B. It is too slow to beeasily used on mobile C. Lnterceptian devices. D. Collisions C. It requires a key to be securely shared. 9. How is 3DES an improvement over normal EES? D. It is available only on UNIX. A. It uses public and private keys. 5. What is Diffie-Hellman most comimonly used for? B. It hashes the message before encryption. A. Symmetric encryption key exehange C. It uses throe keys and multiple encryption D. Sigrung digital contracts. and/or decryption sets. C. Sectre e-mail D. It is faster than DES. D. Storing encrypted passwords: 10. What is the best kind of key to have? 6. What is public key cryptography a more A. Easy to remember cokmmon name for? B. Long and random Key Terms Quiz Use terms from the Key Terms list to complete the sentences that follow. Don't use the same term more than once. Not all terms will be used. 6. Emails and their attachments can be secuked i. is a protocol used to secune DNS 7. The use of multiple nearly identical messages can packets during transmission across a network: lead to the cryptographic altack. 2. A common encryption metho.
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...IJCSIS Research Publications
Today information security is a challenging factor that touches a lot of areas, including computers and communications. Message communication is kept secure through cryptography so that an eavesdropper is not able to decipher a transmitted message. One of the oldest and simplest known algorithms for cryptography is the Caesar cipher algorithm. In this paper, three programs based on Java, C++, and Python languages have been developed to implement the Caesar cipher algorithm to aid information security students and help them understand this fundamental algorithm. A code flow chart is used for each program to describe the code’s flow. It also reveals the sequence of steps for the code’s main methods, as well as the relationships between them. Furthermore, various technical descriptions are presented in detail for each of the methods used in both the encoding and the decoding of the messages.Hallwaze security snapshot
Purpose built for large enterprises, their security & privacy concerns and the requisite controls that they need for unlocking communication channels
An Enhanced Encryption Technique using BCD and Bit Complementation
https://irjet.net/archives/V4/i1/IRJET-V4I1158.pdf
Modified MD5 Algorithm for Password Encryption
Modified MD5 Algorithm for Password EncryptionInternational Journal of Computer and Communication System Engineering
Modified MD5 Algorithm for Password EncryptionSimilar to 1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx (20)
SECRY - Secure file storage on cloud using hybrid cryptography
SECRY - Secure file storage on cloud using hybrid cryptography
The Time-Consuming Task Of Preparing A Data Set For...
The Time-Consuming Task Of Preparing A Data Set For...
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...
Integrity and Privacy through Authentication Key Exchange Protocols for Distr...
Comparative Analysis of Open-SSL Vulnerabilities & Heartbleed Exploit Detection
Comparative Analysis of Open-SSL Vulnerabilities & Heartbleed Exploit Detection
Internet Protocol Security as the Network Cryptography System
Internet Protocol Security as the Network Cryptography System
SURVEY OF UNITED STATES RELATED DOMAINS: SECURE NETWORK PROTOCOL ANALYSIS
SURVEY OF UNITED STATES RELATED DOMAINS: SECURE NETWORK PROTOCOL ANALYSIS
Key Terms Quiz Use terms from the Key Terns list to complete the sen-.docx
Key Terms Quiz Use terms from the Key Terns list to complete the sen-.docx
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...
Caesar Cipher Method Design and Implementation Based on Java, C++, and Python...
An Enhanced Encryption Technique using BCD and Bit Complementation
An Enhanced Encryption Technique using BCD and Bit Complementation
More from Nicholas3uGPooled
1- The following represent various stages of cell division (mitosis-me.docx
1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell.
.
1- In cats- again- black color is dominant to a special- temperature-s.docx
1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents?
.
1- The ability of a virus to infect one type of organism and not anoth.docx
1. The ability of a virus to infect one type of organism and not another is called?
A. Host specificity
B. Tissue tropism
C. Capsid assembly
D. Viral specificity
2. Which of the following are used in the classification of viruses?
A. Capsid Shape
B. Replication Process
C. Type of host
D. Viral Genetics
E. All of these
.
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1. The 3-part, multiple human brain refers to the
A. brainstem, limbic system and cortex
B. the somatic, sympathetic and parasympathetic systems
C. dendrites, soma and axons
2. Fluid leaves closed circulatory systems
A. lymph nodes
B. fenestrated capillaries
C. septa
D. valves
3. Myelin is formed by
A. axons
B. the retina
C. oligodendroglia
D. astroglia
4. Neurons summarize information in their
A. dendrites
B. soma
C. axon
5. Proprioceptors are located within
A. bone
B. muscle
C. skin
D. spinal cord
6. A major contributing factor to age-related disorders of the nervous system is
A. humans live much longer than they used to
B. genetic predisposition
C. nutritional deficiencies
D. all of these
7. The lymph system
A. produces blood cells
B. drains fluid from the body
C. removes CO2 from tissues
8. The hippocampus participates in
A. memory formation
B. memory retrieval
C. both
9. An artificial pacemaker
A. maintains regular heartbeat
B. controls pressure within arteries
C. controls valve opening and closing
10. A myocardial infarction refers to
A. a drop in blood pressure
B. fatty deposits in arterie
C. a tear in the wall of a vessel
D. death of heart muscle
11. Hemoglobin
A. carries oxygen
B. carries CO2
C. carries both
D. carries neither
.
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1. System in science/ Types/ Feedbacks 2. Nature of Physical Geography 3. How do we depict Earth's surface lelevation, depthirelief. 4. Latitude and Longitude, Time Zones, Great circles and Small circles. 5. Remote Sensing - basic concepts (Textbook P. 24-29) 6. Solar energy, Electromagnetic spectrum 7. Methods of energy transfer, Albedo, Heat and temperature / Greenhouse effect. 8. Sun-earth relation/ Sun anglel Why do we have seasons? 9. Atmospheric Structure (layers)/composition, Atmospheric Ozone 10. Air Pressure, Air Temperature and Air Density Their vertical variation. 11. Forces affecting airflow, Pressure gradient force, Coriolis force, Frictional force, Gravitational force. 12. Global Wind Patterns, Tropical Easterlies, MidLatitude Westerlies, Polar Easterlies, winds at upper levels/ Jet streams/ rotating winds, monsoons, Local winds, 13. Atmospheric Moisture, Moisture Parameters, moisture distribution. 14. What is Latent heat and Phase changes, types? 15. Air Lifting Mechanisms, Cloud Classification. Forms of Precipitation
.
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1. T.F. Annual borius plans are long-term executive inctitives, and atsce optiona arw shos. highs incured to erpolorets bused on heir. objoctives. developing a training plan, claritying a training budget and desging the traniog 7. T.F.As compared to time series analysis, controlled experimentaton a a vald and relable training evaluation mothod. 8. T.F. Upward 1 subordinates appraisal is when a supervisor conducts. the arnul Pertormance appraisal of empioyee under his her supervision. 9. T.F. The basic puipose of a performance appraisal system is to improve the petormatice of individuals, fearns, and the entire organ zation 10. T.F. Simulators are training and delivery systems commonly usod for training airline pilats. 11. T.F. Exit interviews are typically used as an employee selection method. 12. T.F. Achievament tests measure a candidate's knowledge of the job dubes. 13. T.F. Unlike other forms of tests, personalify tests do not focus an-qualites but are ratur designed to predict an employeels future perfocmance by locking at personal trats. temperamente, attitudes or dispositions. 14. T.F. Behavioral interviews ask applicants about specif everts as opposed to just hang them tell about themselves. 15. T.F. Sifuational interviews focus on how an individual handled job-related ciraumstances in the past. 16. T.F. According to Vroom's theory, if expectancy, instrumentaity, or valence is equal ts zarp. there will be no employee motivation. 17. T.F. Direct finaricial compensation consists of the poy that a person receses in the form of wages, salaries, and corminissions. 18. T.F. Edward Dec found that extrintic rewards could at times actualy detract hon the parson's intrifsic motivation. 19. T.F. Interviews are vald predictors of sucoess on the job, which is ahy they are commoriy used to evaluate applicants 20. T.F. During the proces of test validation, predictive validation invelves asminatering the test of the cufrent employees. 21 T.F. Intervidws can be made more efledive f the interviener studes the job deserigton and ustesz siandardized interview iorm. 23 The Pinis organizational stuctuce and gouis. at il ipencific bine
.
1- Select all that apply- Software testing is a process that helps in.docx
1. Select all that apply.
Software testing is a process that helps in __________
Group of answer choices
Identifying systems issues/bugs.
Mitigating legal liability
Maximizing profits
Increasing product value
2. Group of answer choices
___________________ gives a valuation for all program input variables.
Test set
Test review
Test case
Test inspection
3. Group of answer choices
Which of the following is not a quality attribute of software?
Interoperability
Validity
Efficiency
Recoverability
.
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1. Pandoravirus salinus is virus that infects amoeba, is very large ( 1 m ) and has a genome composed of double-stranded DNA that is 2.47 Mbp in size ( 247 , 000 , 000 bp). P . salinus has genes not typically associated with viruses, such as genes required for the synthesis of amino acids. In what ways might this force virologists to re-examine the definition of virus? 2. Many chemical biocides (disinfectants) target the lipid envelopes of viruses. Why would the chemical destruction of the envelope render the virus non-infectious? 3. Some viruses cause cancer. For example, Human Papillomavirus (HPV) that is associated with the development of cervical cancer and believed to play a role in head and neck tumors. Given what you know about viral replication, would the induction of cancer be beneficial to the virus? 4. What is one major way in which next generation sequencing differs from dideoxy sequencing (Sanger)?
.
1- Joe Smith works in the IT department of a large industrial company-.docx
1. Joe Smith works in the IT department of a large industrial company. He is tasked with maintaining IT security for the company. He also teaches a night class at the local career tech center. He has overheard several of the students in the class talking about a software tool they downloaded that would allow them to launch automated software attacks. If the students were to use this software, what category of attacker would these students be considered?
Cyberterrorists
Brokers
Insiders
Cybercriminals
Script Kiddies
2. Sally Wilson works for a small retail business and provides all IT support for the company. As part of her job, Sally has recently been tasked with ensuring that all IT systems are secured appropriately. To ensure company-wide IT security, Sally implemented a security awareness training program for all employees. After this training was completed, an employee informed Sally about the following situation:
1. The employee (Jim) mentioned that he was at a party and was befriended by a person that knew several of his other friends. This "new friend" began asking him about the company he worked for and was particularly interested in his company's marketing strategy for a new product being developing when Jim mentioned that he was the marketing manager. Jim was concerned and cautious as to any company information he provided.
2. As the party progressed, a drinking game was initiated which required players to provide information like: family member names, pet names, previous addresses, favorite colors and flowers, and a variety of other personal information.
3. A week for so after the party, Jim noticed that sporadically his email account would be locked out, and he would be required to reset his password to gain access. This occurred on several times and was continuing to occur.
4. Jim also received an email that indicated that his system password needed to be changed, and a URL was provided to access the web location for making the change.
Sally was concerned that someone might be trying to hack into Jim's email and corporate access account. What security attack topic should she review with the company employees that was more than likely the beginning of this situation?
Identity Theft
Password Cracking
Social Engineering
Hoaxes
Spear Phishing
Dumpster Diving
3. George Mills works for a government agency in the IT security department. Upon arriving at work, he reviewed last night's network security logs and found indications that there was potential for a network security breach. Upon further inspection, it seems that an intruder from the Internet gained access to the internal network, accessed a server with enhanced privileges via a documented OS flaw, and installed a keylogger.
Which of the following security defenses seem to be deficient in this situation? (Choose three)
effective backup strategy
implementation of least privilege
regular operating system patching
Up-to-date malware software
proper firewall rules.
1- In order to beat- the heart requires A- nervous system input B- h.docx
1. In order to beat, the heart requires
A. nervous system input
B. hormonal signalling
C. generates its own pulse
2. Voluntary movement is controlled by the
A. somatic system
B. autonomic system
3. __________________ means producing a few offspring, with a lot of parental care provided.
A. Protective reproduction
B. Shotgun reproduction
C. Sexual reproduction
D. Asexual reproduction
4. Following injury, a scar may form within brain tissue by
A. blood vessel cells
B. astroglia
C. injured neurons
D. microglia
5. The central nervous system consists of the
A. brain and spinal cord
B. sensory neurons
C. motor neurons
D. sensory and motor neurons
6. Background regulatory systems like are toggled up by the
A. sympathetic system
B. parasympathetic system
C. somatic system
.
1- In terms of the environment of early earth- what resulted from the.docx
1. In terms of the environment of early earth, what resulted from the development of photosynthesis?
Cell Membranes
Oceans
An aerobic environment
An anaerobic environment
2. Which of the following enzymes will create an RNA strand?
DNA Polymerase
Primase
Helicase
RNA Polymerase
3. Which of the following I S NOT a characteristic of living organisms?
Can live with no energy provided by the external world
Can convert molecules obtained from their environment into a new biological molecule
Use genetic information to reproduce themselves
Consist of one or more cells
They evolve
4. Which of the following is not a force of evolution?
Natural Selection
Genetic Drift
Mutation
Gene Flow
Vestigial Structures
5. True or False: Evolution is the optimization of organisms over multiple generations.
6. Which of the following is needed for natural selection to occur? (Select all that apply)
Variation within a population
Time
Geographic isolation
More offspring are produced than can survive.
Traits are inherited by offspring.
Two populations mating
7. Select all of the statements that are true of DNA
DNA is double-stranded
DNA is single-stranded
DNA is less stable than RNA
DNA is more stable than RNA
DNA is directly involved in the synthesis of proteins.
DNA is antiparallel.
8. True or False: Speciation due to two populations breeding at different times in the same area is an example of sympatric speciation
9. True or False: Allele frequencies can change within an organism
10. Which of the following is not a DNA sequence?
AUGUGCGUAACUGUGA
ATTTTGGGGGCCCCGGAATT
ATGTGCGTAACTGTGA
.
1- Identify one job position to develop- compentency based job descrip.docx
1. Identify one job position to develop, compentency based job description (CBJD).
2. Explain the detail of the job such as relationship, grade, category and etc.).
3. Analyze the job responsibilities /job task for the chosen job (Min 5 job tasks).
4. Determine the related knowledge, skill, attitude and other abilities for each task.
.
1- Implement a Python function that accepts an positive integer and re.docx
1. Implement a Python function that accepts an positive integer and returns a list of strings that resembles binary counting starting from aero up to the input number. A non-positive input integer must return an empty list. 2. A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward such as the number 108801 . Write a Python function that accepts either an integer or string and returns a tuple consisting of two possible palindromes that can be made from the input sequence.
.
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1. How may have the complex lifestyle of digentic trematodes evolved? (Include life cycle and hosts)
2. Which host is more negatively affected by digenetic trematodes, the first intermediate host or the definitive host? In addition, which association do you think evolved first: digenetic trematodes and mollusks or digenetic trematodes and vertebrates?
.
1- identify and discuss the two most imporant factors in population dy (1).docx
1. identify and discuss the two most imporant factors in population dynamics, birth and death , and how theh shape population charecteristics.
2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns.
3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment.
2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns.
3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment.
.
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- How does ancestry and race play into disease genetics?
2- How does ancestry play into allele distribution worldwide?
3- Do you agree with Dr. Rotimi that over time as we get better at doing genetic analysis, race and ancestry will become completely irrelevant to examining disease risks and outcomes? Why or why not?
.
1- Historical Development of Computing and Information Technology a) H.docx
1. Historical Development of Computing and Information Technology a) Historical Background b) The Development of the Microprocessor c) Development of Computer Software and the Personal Computer (PC) 2. Development of the Internet 3. Development of the World Wide Web 4. The Emergence of Social and Ethical Problems in Computing a) The Emergence of Computer Crimes b) The Present Status: An Uneasy Cyberspace 5. The Case for Computer Ethics Education a) What Is Computer Ethics? b) Why You Should Study Computer Ethics
.
1- How has examining your beliefs- assumptions- and values related to.docx
1. How has examining your beliefs, assumptions, and values related to your historical and current events impacted how you process information in your daily life? For example, consider claims made by politicians, news headlines, tweets by celebrities, or articles shared by your family on social media.
2. What changes, big or small, have occurred in how you apply historical inquiry skills to classes, your personal life, and/or your career?
.
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1. Given the Trilemma, if a country has the free flow of capital and an independent monetary policy, the country's exchange rates will likely be ___.
fixed
floating
2.How did the market respond during the Mexican Peso crisis? Was the response efficient or did the market overact? Why
.
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
1. Give a definition of heteroscedasticity.
2. For what reasons does heteroscedasticity arise? Explain these.
3. What are the consequences for the estimates in the face of the heteroskedasticity problem?
4. What happens if these estimators are used when there are Heteroskedasticity problems?
.
More from Nicholas3uGPooled (20)
1- The following represent various stages of cell division (mitosis-me.docx
1- The following represent various stages of cell division (mitosis-me.docx
1- In cats- again- black color is dominant to a special- temperature-s.docx
1- In cats- again- black color is dominant to a special- temperature-s.docx
1- The ability of a virus to infect one type of organism and not anoth.docx
1- The ability of a virus to infect one type of organism and not anoth.docx
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1- Select all that apply- Software testing is a process that helps in.docx
1- Select all that apply- Software testing is a process that helps in.docx
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1- Joe Smith works in the IT department of a large industrial company-.docx
1- Joe Smith works in the IT department of a large industrial company-.docx
1- In order to beat- the heart requires A- nervous system input B- h.docx
1- In order to beat- the heart requires A- nervous system input B- h.docx
1- In terms of the environment of early earth- what resulted from the.docx
1- In terms of the environment of early earth- what resulted from the.docx
1- Identify one job position to develop- compentency based job descrip.docx
1- Identify one job position to develop- compentency based job descrip.docx
1- Implement a Python function that accepts an positive integer and re.docx
1- Implement a Python function that accepts an positive integer and re.docx
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1- identify and discuss the two most imporant factors in population dy (1).docx
1- identify and discuss the two most imporant factors in population dy (1).docx
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- Historical Development of Computing and Information Technology a) H.docx
1- Historical Development of Computing and Information Technology a) H.docx
1- How has examining your beliefs- assumptions- and values related to.docx
1- How has examining your beliefs- assumptions- and values related to.docx
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
Recently uploaded
Best Digital Marketing Institute In NOIDA
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Event Link:-
https://meetups.mulesoft.com/events/details/mulesoft-mysore-presents-exploring-gemini-ai-and-integration-with-mulesoft/
Agenda
● Java 17 Upgrade Overview
● Why and by when do customers need to upgrade to Java 17?
● Is there any immediate impact to upgrading to Mule Runtime 4.6 and beyond?
● Which MuleSoft products are in scope?
For Upcoming Meetups Join Mysore Meetup Group - https://meetups.mulesoft.com/mysore/
YouTube:- youtube.com/@mulesoftmysore
Mysore WhatsApp group:- https://chat.whatsapp.com/EhqtHtCC75vCAX7gaO842N
Speaker:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Organizers:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Giridhar Meka - https://www.linkedin.com/in/giridharmeka
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Shyam Raj Prasad-
https://www.linkedin.com/in/shyam-raj-prasad/
Home assignment II on Spectroscopy 2024 Answers.pdf
Answers to Home assignment on UV-Visible spectroscopy: Calculation of wavelength of UV-Visible absorption
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
The Challenger.pdf DNHS Official Publication
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Digital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Pavilions
NGV Architecture Commission Competition
MPavilion Commission Competition
Other Pavilion Designs
Digital Tools and AI for Teaching Learning and Research
This Presentation in details discusses on Digital Tools and AI for Teaching Learning and Research
special B.ed 2nd year old paper_20240531.pdf
Instagram:-
https://instagram.com/special_education_needs_01?igshid=YmMyMTA2M2Y=
WhatsApp:-
https://chat.whatsapp.com/JVakNIYlSV94x7bwunO3Dc
YouTube:-
https://youtube.com/@special_education_needs
Teligram :- https://t.me/special_education_needs
Slide Shere :-
https://www.slideshare.net/shabnambano20?utm_campaign=profiletracking&utm_medium=sssite&utm_source=ssslideview
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptxMohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
This slide is prepared for master's students (MIFB & MIBS) UUM. May it be useful to all.Supporting (UKRI) OA monographs at Salford.pptx
How libraries can support authors with open access requirements for UKRI funded books
Wednesday 22 May 2024, 14:00-15:00.
Embracing GenAI - A Strategic Imperative
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Acetabularia Information For Class 9 .docx
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Recently uploaded (20)
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Home assignment II on Spectroscopy 2024 Answers.pdf
Home assignment II on Spectroscopy 2024 Answers.pdf
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Digital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Investigating Pavilion Designs
Digital Tools and AI for Teaching Learning and Research
Digital Tools and AI for Teaching Learning and Research
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal Labour/ Stages of Labour/ Mechanism of Labour
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptx
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
- 1. 1. Reflected and stored are types of XSS attacks. 2. An attack has occurred on your network. An attacker was able to traverse several files and folders, looking for sensitive data. What type of attack has occurred? 3. AH is the protocol within IPSec used for encryption services. 4. As network administrator, you are concerned with the plaintext transmission of sensitive data on the network. Which of the following protocols are used to help secure communications? (Select three.) A. IPSec . HITP 5. To increase network security, you have decided to use HTTPS on your shopping cart site. Which of the following ports does HTTPS use? A. 80 B. 53 C. 443 D. 51 6. _____and AH are used to secure IPSec transmissions. 7. CSRF attacks exploit the trust a Web site has in a user's Web browser. 8. Kerberos is a(n)___ protocol. 9. To increase overall communication security, you decide to implement 3DES encryption. Which of the following statements is true of 3DES? 10. You are concerned about a cross-site forgery attack. Which of the following can you do to help prevent such an attack? 11. To establish IPSec encryption, two hosts must create a shared key with each other before SA negotiations can take place.