1- In terms of the environment of early earth- what resulted from the.docx
•Download as DOCX, PDF•
0 likes•2 views
1. In terms of the environment of early earth, what resulted from the development of photosynthesis? Cell Membranes Oceans An aerobic environment An anaerobic environment 2. Which of the following enzymes will create an RNA strand? DNA Polymerase Primase Helicase RNA Polymerase 3. Which of the following I S NOT a characteristic of living organisms? Can live with no energy provided by the external world Can convert molecules obtained from their environment into a new biological molecule Use genetic information to reproduce themselves Consist of one or more cells They evolve 4. Which of the following is not a force of evolution? Natural Selection Genetic Drift Mutation Gene Flow Vestigial Structures 5. True or False: Evolution is the optimization of organisms over multiple generations. 6. Which of the following is needed for natural selection to occur? (Select all that apply) Variation within a population Time Geographic isolation More offspring are produced than can survive. Traits are inherited by offspring. Two populations mating 7. Select all of the statements that are true of DNA DNA is double-stranded DNA is single-stranded DNA is less stable than RNA DNA is more stable than RNA DNA is directly involved in the synthesis of proteins. DNA is antiparallel. 8. True or False: Speciation due to two populations breeding at different times in the same area is an example of sympatric speciation 9. True or False: Allele frequencies can change within an organism 10. Which of the following is not a DNA sequence? AUGUGCGUAACUGUGA ATTTTGGGGGCCCCGGAATT ATGTGCGTAACTGTGA .
Report
Share
Report
Share
Recommended
Recommended
The purpose of this lab exercise is to review terminology co.pdf
The purpose of this lab exercise is to review terminology concerning DNA, genetics, and evolution.
Note that the crossword puzzle has no blanks between words if there are several words in
an answer.
Across
3. A change in allele frequencies of a population.
4. The genotype of a trait for which the two alleles are the same.
5. A trait controlled by a gene on a sex chromosome.
7. A sudden reduction in population size because of an event such as a famine that can lead to
changes in the allele frequencies of a population.
15. Reproduction in which the offspring inherit their DNA from a single parent.
16. The molecule that is the product of transcription. It moves from the nucleus to the cytoplasm.
17. A process of nuclear division in humans that produces sperm and egg.
18. Division of a nucleus into two genetically identical nuclei that lead to the formation of two
identical daughter cells.
19. An allele whose phenotypic effect is masked by a dominant allele for the trait.
20. Cells that will combine at fertilization to produce offspring called a reproductive cell.
22. A given trait increases fitness at one extreme of the phenotype and reduces fitness at the
other, leading to an increase or decrease in the mean value of the trait.
23. The expression of the genes that an organism carries for a particular trait.
24. An allele that masks the phenotype effect of the other.
25. A strand of DNA on which are found specific sequences of base pairs that carry the
information necessary for producing a protein.
Down
1. A populations organisms become better matched to their environment.
2. A diagram showing the possible outcomes of a cross between two individuals.
4. The genotype of a trait for which the two alleles an individual carries differ from each other.
6. Phase in the cell cycle during which the cell grows and functions.
8. The two identical strands of a replicated chromosome.
9. Division of the cytoplasm (cell)
10. An alternate version of a gene.
11. A group of organisms of the same species living in a particular geographic region.
12. The fusion of egg and sperm.
13. The genes that an organism carries for a particular trait.
14. Heritable variation for a trait occurs and individuals with one version of the trait have greater
reproductive success than individuals with a different version of that trait.
21. Produces the greatest fitness at the intermediate point of the phenotypic range.
22. A given trait increases fitness at both extremes of the phenotype distribution and reduces
fitness at middle values..
Please answer the following multiple choice question. Note that ther.docx
Please answer the following multiple choice question. Note that there might be more than one answer correct.
1. Living organisms share a number of characteristics. These unifying characteristics separate them from non-living things. For each of the following statements, check the statements that correctly distinguish living things from non-living things?
1. All living organisms are made up of one or more cells.
2. Only living organisms are complex.
3. All living organisms reproduce by passing on specific genetic information to future generations.
4. Only living organisms are capable of movement.
5. Only living organisms (populations) are capable of evolving.
6. Only living organisms require an input of energy to drive cellular activities.
7. Only living organisms produce heat as a byproduct of chemical reactions.
8. All living organisms are dependent on a constant supply of oxygen for survival.
9. Only living organisms respond to external stimuli.
10. All living organisms grow by increasing cell size and/or cell number.
2. The formulation of a hypothesis is based on observations and refined by available information from past observations or research. Place the following statements in the appropriate sequence showing the progression from an observation to a testable hypothesis.
1. You notice that the bread you left on the counter has more mold on it than do the rolls that you put in the refrigerator.You notice that the bread you left on the counter has more mold on it than do the rolls that you put in the refrigerator.
2. Does temperature affect the growth of mold or is the difference in mold growth related to differences between the bread and the rolls?Does temperature affect the growth of mold or is the difference in mold growth related to differences between the bread and the rolls?
3. Bread placed in warmer temperatures should develop mold faster and more extensively than bread placed in colder temperatures.
4. Colder temperatures impede the growth of mold.
3. Drag the part of the scientific method on the left to the example on the right it best matches. Then, drag the sentences into the sequence they would most likely happen following a simplified scientific method.
observation
peer review
hypothesis
data collection
analysis
1. John runs some statistics on his distances to see if he can find any significance in his study. Part: ____________
2. On a walk around a pond John sees that small frogs on the shore only allow him to get within 5 feet before jumping into the water. Part: ____________
3. John uses mechanical “predators” to approach frogs at a pond shore, and he records the distance between predator and frog as the frogs jump. Part:
4. John writes up and sends out his experimental results for other scientists to critique. Part: ____________
5. John thinks that frogs vary the proximity to which they allow predators to approach based on the size of the predator. Part: ____________
4. The four major groups of organic compou.
Choose the property of life best illustrated by each fact Muscle.pdf
Choose the property of life best illustrated by each fact: Muscle cells use chemical energy from
glucose to power contractions. [ Choose ] When two people with red hair have a baby, it's
common for the baby to have organisation red hair, too. Even as your body produces acidic
waste metabolism products, your blood pH stays very close to 7.4 . homeostasis All living things
are made of one or more cells enclosed by a membrane.
Based on the fossil record, all the following are true statements about the history of life on Earth
except: The first eukaryotes were multicellular plants. Life on Earth arose at least 3.5 billion year
ago. Cyanobacteria were undergoing photosynthesis long before the first plants arose. There
were single-celled organisms for roughly 3 billion years before the first multicellular organisms
arose. Humans arose well after the colonisation of land by plants and the extinction of (non-
avian) dinosaurs.
Select the domain of life that matches each description: Abundant group of prokaryotes; includes
many species that cause disease in humans v[ Choose ] Lesser-known group of prokaryotes;
includes species that live in extreme environments Archaea Group that includes all multicellular
organisms and some single-celled organisms Question 4 1 pts The process of copying a segment
of DNA to make MRNA is called Using mRNA as instructions for making a type of protein is
called A segment of DNA that is copied to make mRNA is called a
Match the eukaryotic organelles to their descriptions: Synthesis of proteins that will be exported
from the cell [ Choose ] ribosome
Binomial nomenclature is a system of scientifically naming species, attributed to Carl Linnaeus.
The power of this system is that each individual species has a unique name, which avoids
confusion. You will be writing species names a lot during practicals so it is important to
understand the scientific convention. Below are 12 examples of different species names. Which
one is the correct way to write a species name in binomial nomenclature? vampyroteuthis
infernalis Ophiocordyceps Unilateralis Eunice-Aphroditois glyptapanteles demeter Cymothoa
exigua Lasiorhynchus-barbicornis Regalecus glesne pleurodeles-walt! Attacus-atlas
chlamyphorus-truncatus Turritopsis-Dohrnii.
1. What major biomolecule has the most number of functions and why.pdf
1. What major biomolecule has the most number of functions and why?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
1. What major biomolecule has the most number of functions and why?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
Solution
1. There are four major types of biomolecules. Carbohydrates, proteins, lipids and nucleic acid.
Out of these, the nucleic acid has the most number of function. Nucleic acid are polymers present
in the living cells and are of two types: Ribonucleic acid (RNA) and Deoxyribonucleic acid
(DNA). DNA carry genes which are responsible for storing and transmitting the hereditary
information from one generation to the next. RNA help in protein formation and also have
functional activity as enzymes.
2. The entire length of DNA in each cell could reach up to 2 meters if measured end to end. The
DNA is coiled with the help of proteins called histones to form nucleosomes which are
compacted together to form chromatin fibre. The reason for it to be compacted : to accomodate
in the small size of the cell which has the size in micro meteres. It is also required to be
specifically coiled which is required to enter cell division.
3. Crossing Over is the process of exchange of genes between two homologous chromosomes
during sexual reproduction. This results in non-identical chromatids called recombinant
chromosomes. It happens in the pachytene stage of Prophase I of meiosis.
Independent assortment is the independent separation of homologous chromosomes. The alleles
of different genes get sorted into gametes randomly. This gives different hereditary traits equal
probability to occur together. in the offspring. It occurs in Metaphase I of meiosis..
1- The following represent various stages of cell division (mitosis-me.docx
1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell.
.
1- In cats- again- black color is dominant to a special- temperature-s.docx
1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents?
.
More Related Content
Similar to 1- In terms of the environment of early earth- what resulted from the.docx
The purpose of this lab exercise is to review terminology co.pdf
The purpose of this lab exercise is to review terminology concerning DNA, genetics, and evolution.
Note that the crossword puzzle has no blanks between words if there are several words in
an answer.
Across
3. A change in allele frequencies of a population.
4. The genotype of a trait for which the two alleles are the same.
5. A trait controlled by a gene on a sex chromosome.
7. A sudden reduction in population size because of an event such as a famine that can lead to
changes in the allele frequencies of a population.
15. Reproduction in which the offspring inherit their DNA from a single parent.
16. The molecule that is the product of transcription. It moves from the nucleus to the cytoplasm.
17. A process of nuclear division in humans that produces sperm and egg.
18. Division of a nucleus into two genetically identical nuclei that lead to the formation of two
identical daughter cells.
19. An allele whose phenotypic effect is masked by a dominant allele for the trait.
20. Cells that will combine at fertilization to produce offspring called a reproductive cell.
22. A given trait increases fitness at one extreme of the phenotype and reduces fitness at the
other, leading to an increase or decrease in the mean value of the trait.
23. The expression of the genes that an organism carries for a particular trait.
24. An allele that masks the phenotype effect of the other.
25. A strand of DNA on which are found specific sequences of base pairs that carry the
information necessary for producing a protein.
Down
1. A populations organisms become better matched to their environment.
2. A diagram showing the possible outcomes of a cross between two individuals.
4. The genotype of a trait for which the two alleles an individual carries differ from each other.
6. Phase in the cell cycle during which the cell grows and functions.
8. The two identical strands of a replicated chromosome.
9. Division of the cytoplasm (cell)
10. An alternate version of a gene.
11. A group of organisms of the same species living in a particular geographic region.
12. The fusion of egg and sperm.
13. The genes that an organism carries for a particular trait.
14. Heritable variation for a trait occurs and individuals with one version of the trait have greater
reproductive success than individuals with a different version of that trait.
21. Produces the greatest fitness at the intermediate point of the phenotypic range.
22. A given trait increases fitness at both extremes of the phenotype distribution and reduces
fitness at middle values..
Please answer the following multiple choice question. Note that ther.docx
Please answer the following multiple choice question. Note that there might be more than one answer correct.
1. Living organisms share a number of characteristics. These unifying characteristics separate them from non-living things. For each of the following statements, check the statements that correctly distinguish living things from non-living things?
1. All living organisms are made up of one or more cells.
2. Only living organisms are complex.
3. All living organisms reproduce by passing on specific genetic information to future generations.
4. Only living organisms are capable of movement.
5. Only living organisms (populations) are capable of evolving.
6. Only living organisms require an input of energy to drive cellular activities.
7. Only living organisms produce heat as a byproduct of chemical reactions.
8. All living organisms are dependent on a constant supply of oxygen for survival.
9. Only living organisms respond to external stimuli.
10. All living organisms grow by increasing cell size and/or cell number.
2. The formulation of a hypothesis is based on observations and refined by available information from past observations or research. Place the following statements in the appropriate sequence showing the progression from an observation to a testable hypothesis.
1. You notice that the bread you left on the counter has more mold on it than do the rolls that you put in the refrigerator.You notice that the bread you left on the counter has more mold on it than do the rolls that you put in the refrigerator.
2. Does temperature affect the growth of mold or is the difference in mold growth related to differences between the bread and the rolls?Does temperature affect the growth of mold or is the difference in mold growth related to differences between the bread and the rolls?
3. Bread placed in warmer temperatures should develop mold faster and more extensively than bread placed in colder temperatures.
4. Colder temperatures impede the growth of mold.
3. Drag the part of the scientific method on the left to the example on the right it best matches. Then, drag the sentences into the sequence they would most likely happen following a simplified scientific method.
observation
peer review
hypothesis
data collection
analysis
1. John runs some statistics on his distances to see if he can find any significance in his study. Part: ____________
2. On a walk around a pond John sees that small frogs on the shore only allow him to get within 5 feet before jumping into the water. Part: ____________
3. John uses mechanical “predators” to approach frogs at a pond shore, and he records the distance between predator and frog as the frogs jump. Part:
4. John writes up and sends out his experimental results for other scientists to critique. Part: ____________
5. John thinks that frogs vary the proximity to which they allow predators to approach based on the size of the predator. Part: ____________
4. The four major groups of organic compou.
Choose the property of life best illustrated by each fact Muscle.pdf
Choose the property of life best illustrated by each fact: Muscle cells use chemical energy from
glucose to power contractions. [ Choose ] When two people with red hair have a baby, it's
common for the baby to have organisation red hair, too. Even as your body produces acidic
waste metabolism products, your blood pH stays very close to 7.4 . homeostasis All living things
are made of one or more cells enclosed by a membrane.
Based on the fossil record, all the following are true statements about the history of life on Earth
except: The first eukaryotes were multicellular plants. Life on Earth arose at least 3.5 billion year
ago. Cyanobacteria were undergoing photosynthesis long before the first plants arose. There
were single-celled organisms for roughly 3 billion years before the first multicellular organisms
arose. Humans arose well after the colonisation of land by plants and the extinction of (non-
avian) dinosaurs.
Select the domain of life that matches each description: Abundant group of prokaryotes; includes
many species that cause disease in humans v[ Choose ] Lesser-known group of prokaryotes;
includes species that live in extreme environments Archaea Group that includes all multicellular
organisms and some single-celled organisms Question 4 1 pts The process of copying a segment
of DNA to make MRNA is called Using mRNA as instructions for making a type of protein is
called A segment of DNA that is copied to make mRNA is called a
Match the eukaryotic organelles to their descriptions: Synthesis of proteins that will be exported
from the cell [ Choose ] ribosome
Binomial nomenclature is a system of scientifically naming species, attributed to Carl Linnaeus.
The power of this system is that each individual species has a unique name, which avoids
confusion. You will be writing species names a lot during practicals so it is important to
understand the scientific convention. Below are 12 examples of different species names. Which
one is the correct way to write a species name in binomial nomenclature? vampyroteuthis
infernalis Ophiocordyceps Unilateralis Eunice-Aphroditois glyptapanteles demeter Cymothoa
exigua Lasiorhynchus-barbicornis Regalecus glesne pleurodeles-walt! Attacus-atlas
chlamyphorus-truncatus Turritopsis-Dohrnii.
1. What major biomolecule has the most number of functions and why.pdf
1. What major biomolecule has the most number of functions and why?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
1. What major biomolecule has the most number of functions and why?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
2. How does DNA coil or become more compact? Give two reasons why it must be compacted?
3. Explain what crossing over and independent assortment are. Where does each happen in
meiosis?
Solution
1. There are four major types of biomolecules. Carbohydrates, proteins, lipids and nucleic acid.
Out of these, the nucleic acid has the most number of function. Nucleic acid are polymers present
in the living cells and are of two types: Ribonucleic acid (RNA) and Deoxyribonucleic acid
(DNA). DNA carry genes which are responsible for storing and transmitting the hereditary
information from one generation to the next. RNA help in protein formation and also have
functional activity as enzymes.
2. The entire length of DNA in each cell could reach up to 2 meters if measured end to end. The
DNA is coiled with the help of proteins called histones to form nucleosomes which are
compacted together to form chromatin fibre. The reason for it to be compacted : to accomodate
in the small size of the cell which has the size in micro meteres. It is also required to be
specifically coiled which is required to enter cell division.
3. Crossing Over is the process of exchange of genes between two homologous chromosomes
during sexual reproduction. This results in non-identical chromatids called recombinant
chromosomes. It happens in the pachytene stage of Prophase I of meiosis.
Independent assortment is the independent separation of homologous chromosomes. The alleles
of different genes get sorted into gametes randomly. This gives different hereditary traits equal
probability to occur together. in the offspring. It occurs in Metaphase I of meiosis..
Similar to 1- In terms of the environment of early earth- what resulted from the.docx (20)
The purpose of this lab exercise is to review terminology co.pdf
The purpose of this lab exercise is to review terminology co.pdf
The Biological and environmental causes of Developmental Disabilities
The Biological and environmental causes of Developmental Disabilities
Please answer the following multiple choice question. Note that ther.docx
Please answer the following multiple choice question. Note that ther.docx
Choose the property of life best illustrated by each fact Muscle.pdf
Choose the property of life best illustrated by each fact Muscle.pdf
Biology - Chp 13 - Genetic Engineering - PowerPoint
Biology - Chp 13 - Genetic Engineering - PowerPoint
1. What major biomolecule has the most number of functions and why.pdf
1. What major biomolecule has the most number of functions and why.pdf
More from Nicholas3uGPooled
1- The following represent various stages of cell division (mitosis-me.docx
1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell.
.
1- In cats- again- black color is dominant to a special- temperature-s.docx
1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents?
.
1- The ability of a virus to infect one type of organism and not anoth.docx
1. The ability of a virus to infect one type of organism and not another is called?
A. Host specificity
B. Tissue tropism
C. Capsid assembly
D. Viral specificity
2. Which of the following are used in the classification of viruses?
A. Capsid Shape
B. Replication Process
C. Type of host
D. Viral Genetics
E. All of these
.
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1. The 3-part, multiple human brain refers to the
A. brainstem, limbic system and cortex
B. the somatic, sympathetic and parasympathetic systems
C. dendrites, soma and axons
2. Fluid leaves closed circulatory systems
A. lymph nodes
B. fenestrated capillaries
C. septa
D. valves
3. Myelin is formed by
A. axons
B. the retina
C. oligodendroglia
D. astroglia
4. Neurons summarize information in their
A. dendrites
B. soma
C. axon
5. Proprioceptors are located within
A. bone
B. muscle
C. skin
D. spinal cord
6. A major contributing factor to age-related disorders of the nervous system is
A. humans live much longer than they used to
B. genetic predisposition
C. nutritional deficiencies
D. all of these
7. The lymph system
A. produces blood cells
B. drains fluid from the body
C. removes CO2 from tissues
8. The hippocampus participates in
A. memory formation
B. memory retrieval
C. both
9. An artificial pacemaker
A. maintains regular heartbeat
B. controls pressure within arteries
C. controls valve opening and closing
10. A myocardial infarction refers to
A. a drop in blood pressure
B. fatty deposits in arterie
C. a tear in the wall of a vessel
D. death of heart muscle
11. Hemoglobin
A. carries oxygen
B. carries CO2
C. carries both
D. carries neither
.
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1. System in science/ Types/ Feedbacks 2. Nature of Physical Geography 3. How do we depict Earth's surface lelevation, depthirelief. 4. Latitude and Longitude, Time Zones, Great circles and Small circles. 5. Remote Sensing - basic concepts (Textbook P. 24-29) 6. Solar energy, Electromagnetic spectrum 7. Methods of energy transfer, Albedo, Heat and temperature / Greenhouse effect. 8. Sun-earth relation/ Sun anglel Why do we have seasons? 9. Atmospheric Structure (layers)/composition, Atmospheric Ozone 10. Air Pressure, Air Temperature and Air Density Their vertical variation. 11. Forces affecting airflow, Pressure gradient force, Coriolis force, Frictional force, Gravitational force. 12. Global Wind Patterns, Tropical Easterlies, MidLatitude Westerlies, Polar Easterlies, winds at upper levels/ Jet streams/ rotating winds, monsoons, Local winds, 13. Atmospheric Moisture, Moisture Parameters, moisture distribution. 14. What is Latent heat and Phase changes, types? 15. Air Lifting Mechanisms, Cloud Classification. Forms of Precipitation
.
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1. T.F. Annual borius plans are long-term executive inctitives, and atsce optiona arw shos. highs incured to erpolorets bused on heir. objoctives. developing a training plan, claritying a training budget and desging the traniog 7. T.F.As compared to time series analysis, controlled experimentaton a a vald and relable training evaluation mothod. 8. T.F. Upward 1 subordinates appraisal is when a supervisor conducts. the arnul Pertormance appraisal of empioyee under his her supervision. 9. T.F. The basic puipose of a performance appraisal system is to improve the petormatice of individuals, fearns, and the entire organ zation 10. T.F. Simulators are training and delivery systems commonly usod for training airline pilats. 11. T.F. Exit interviews are typically used as an employee selection method. 12. T.F. Achievament tests measure a candidate's knowledge of the job dubes. 13. T.F. Unlike other forms of tests, personalify tests do not focus an-qualites but are ratur designed to predict an employeels future perfocmance by locking at personal trats. temperamente, attitudes or dispositions. 14. T.F. Behavioral interviews ask applicants about specif everts as opposed to just hang them tell about themselves. 15. T.F. Sifuational interviews focus on how an individual handled job-related ciraumstances in the past. 16. T.F. According to Vroom's theory, if expectancy, instrumentaity, or valence is equal ts zarp. there will be no employee motivation. 17. T.F. Direct finaricial compensation consists of the poy that a person receses in the form of wages, salaries, and corminissions. 18. T.F. Edward Dec found that extrintic rewards could at times actualy detract hon the parson's intrifsic motivation. 19. T.F. Interviews are vald predictors of sucoess on the job, which is ahy they are commoriy used to evaluate applicants 20. T.F. During the proces of test validation, predictive validation invelves asminatering the test of the cufrent employees. 21 T.F. Intervidws can be made more efledive f the interviener studes the job deserigton and ustesz siandardized interview iorm. 23 The Pinis organizational stuctuce and gouis. at il ipencific bine
.
1- Select all that apply- Software testing is a process that helps in.docx
1. Select all that apply.
Software testing is a process that helps in __________
Group of answer choices
Identifying systems issues/bugs.
Mitigating legal liability
Maximizing profits
Increasing product value
2. Group of answer choices
___________________ gives a valuation for all program input variables.
Test set
Test review
Test case
Test inspection
3. Group of answer choices
Which of the following is not a quality attribute of software?
Interoperability
Validity
Efficiency
Recoverability
.
1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
1. Reflected and stored are types of XSS attacks.
2. An attack has occurred on your network. An attacker was able to traverse several files and folders, looking for sensitive data. What type of attack has occurred?
3. AH is the protocol within IPSec used for encryption services.
4. As network administrator, you are concerned with the plaintext transmission of sensitive data on the network. Which of the following protocols are used to help secure communications? (Select three.)
A. IPSec
. HITP
5. To increase network security, you have decided to use HTTPS on your shopping cart site. Which of the following ports does HTTPS use?
A. 80
B. 53
C. 443
D. 51
6.
_____and AH are used to secure IPSec
transmissions.
7. CSRF attacks exploit the trust a Web site has in a user's Web browser.
8. Kerberos is a(n)___
protocol.
9. To increase overall communication security, you decide to implement 3DES encryption. Which of the following statements is true of 3DES?
10. You are concerned about a cross-site forgery attack. Which of the following can you do to help prevent such an attack?
11. To establish IPSec encryption, two hosts must create a shared key with each other before SA negotiations can take place.
.
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1. Pandoravirus salinus is virus that infects amoeba, is very large ( 1 m ) and has a genome composed of double-stranded DNA that is 2.47 Mbp in size ( 247 , 000 , 000 bp). P . salinus has genes not typically associated with viruses, such as genes required for the synthesis of amino acids. In what ways might this force virologists to re-examine the definition of virus? 2. Many chemical biocides (disinfectants) target the lipid envelopes of viruses. Why would the chemical destruction of the envelope render the virus non-infectious? 3. Some viruses cause cancer. For example, Human Papillomavirus (HPV) that is associated with the development of cervical cancer and believed to play a role in head and neck tumors. Given what you know about viral replication, would the induction of cancer be beneficial to the virus? 4. What is one major way in which next generation sequencing differs from dideoxy sequencing (Sanger)?
.
1- Joe Smith works in the IT department of a large industrial company-.docx
1. Joe Smith works in the IT department of a large industrial company. He is tasked with maintaining IT security for the company. He also teaches a night class at the local career tech center. He has overheard several of the students in the class talking about a software tool they downloaded that would allow them to launch automated software attacks. If the students were to use this software, what category of attacker would these students be considered?
Cyberterrorists
Brokers
Insiders
Cybercriminals
Script Kiddies
2. Sally Wilson works for a small retail business and provides all IT support for the company. As part of her job, Sally has recently been tasked with ensuring that all IT systems are secured appropriately. To ensure company-wide IT security, Sally implemented a security awareness training program for all employees. After this training was completed, an employee informed Sally about the following situation:
1. The employee (Jim) mentioned that he was at a party and was befriended by a person that knew several of his other friends. This "new friend" began asking him about the company he worked for and was particularly interested in his company's marketing strategy for a new product being developing when Jim mentioned that he was the marketing manager. Jim was concerned and cautious as to any company information he provided.
2. As the party progressed, a drinking game was initiated which required players to provide information like: family member names, pet names, previous addresses, favorite colors and flowers, and a variety of other personal information.
3. A week for so after the party, Jim noticed that sporadically his email account would be locked out, and he would be required to reset his password to gain access. This occurred on several times and was continuing to occur.
4. Jim also received an email that indicated that his system password needed to be changed, and a URL was provided to access the web location for making the change.
Sally was concerned that someone might be trying to hack into Jim's email and corporate access account. What security attack topic should she review with the company employees that was more than likely the beginning of this situation?
Identity Theft
Password Cracking
Social Engineering
Hoaxes
Spear Phishing
Dumpster Diving
3. George Mills works for a government agency in the IT security department. Upon arriving at work, he reviewed last night's network security logs and found indications that there was potential for a network security breach. Upon further inspection, it seems that an intruder from the Internet gained access to the internal network, accessed a server with enhanced privileges via a documented OS flaw, and installed a keylogger.
Which of the following security defenses seem to be deficient in this situation? (Choose three)
effective backup strategy
implementation of least privilege
regular operating system patching
Up-to-date malware software
proper firewall rules.
1- In order to beat- the heart requires A- nervous system input B- h.docx
1. In order to beat, the heart requires
A. nervous system input
B. hormonal signalling
C. generates its own pulse
2. Voluntary movement is controlled by the
A. somatic system
B. autonomic system
3. __________________ means producing a few offspring, with a lot of parental care provided.
A. Protective reproduction
B. Shotgun reproduction
C. Sexual reproduction
D. Asexual reproduction
4. Following injury, a scar may form within brain tissue by
A. blood vessel cells
B. astroglia
C. injured neurons
D. microglia
5. The central nervous system consists of the
A. brain and spinal cord
B. sensory neurons
C. motor neurons
D. sensory and motor neurons
6. Background regulatory systems like are toggled up by the
A. sympathetic system
B. parasympathetic system
C. somatic system
.
1- Identify one job position to develop- compentency based job descrip.docx
1. Identify one job position to develop, compentency based job description (CBJD).
2. Explain the detail of the job such as relationship, grade, category and etc.).
3. Analyze the job responsibilities /job task for the chosen job (Min 5 job tasks).
4. Determine the related knowledge, skill, attitude and other abilities for each task.
.
1- Implement a Python function that accepts an positive integer and re.docx
1. Implement a Python function that accepts an positive integer and returns a list of strings that resembles binary counting starting from aero up to the input number. A non-positive input integer must return an empty list. 2. A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward such as the number 108801 . Write a Python function that accepts either an integer or string and returns a tuple consisting of two possible palindromes that can be made from the input sequence.
.
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1. How may have the complex lifestyle of digentic trematodes evolved? (Include life cycle and hosts)
2. Which host is more negatively affected by digenetic trematodes, the first intermediate host or the definitive host? In addition, which association do you think evolved first: digenetic trematodes and mollusks or digenetic trematodes and vertebrates?
.
1- identify and discuss the two most imporant factors in population dy (1).docx
1. identify and discuss the two most imporant factors in population dynamics, birth and death , and how theh shape population charecteristics.
2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns.
3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment.
2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns.
3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment.
.
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- How does ancestry and race play into disease genetics?
2- How does ancestry play into allele distribution worldwide?
3- Do you agree with Dr. Rotimi that over time as we get better at doing genetic analysis, race and ancestry will become completely irrelevant to examining disease risks and outcomes? Why or why not?
.
1- Historical Development of Computing and Information Technology a) H.docx
1. Historical Development of Computing and Information Technology a) Historical Background b) The Development of the Microprocessor c) Development of Computer Software and the Personal Computer (PC) 2. Development of the Internet 3. Development of the World Wide Web 4. The Emergence of Social and Ethical Problems in Computing a) The Emergence of Computer Crimes b) The Present Status: An Uneasy Cyberspace 5. The Case for Computer Ethics Education a) What Is Computer Ethics? b) Why You Should Study Computer Ethics
.
1- How has examining your beliefs- assumptions- and values related to.docx
1. How has examining your beliefs, assumptions, and values related to your historical and current events impacted how you process information in your daily life? For example, consider claims made by politicians, news headlines, tweets by celebrities, or articles shared by your family on social media.
2. What changes, big or small, have occurred in how you apply historical inquiry skills to classes, your personal life, and/or your career?
.
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1. Given the Trilemma, if a country has the free flow of capital and an independent monetary policy, the country's exchange rates will likely be ___.
fixed
floating
2.How did the market respond during the Mexican Peso crisis? Was the response efficient or did the market overact? Why
.
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
1. Give a definition of heteroscedasticity.
2. For what reasons does heteroscedasticity arise? Explain these.
3. What are the consequences for the estimates in the face of the heteroskedasticity problem?
4. What happens if these estimators are used when there are Heteroskedasticity problems?
.
More from Nicholas3uGPooled (20)
1- The following represent various stages of cell division (mitosis-me.docx
1- The following represent various stages of cell division (mitosis-me.docx
1- In cats- again- black color is dominant to a special- temperature-s.docx
1- In cats- again- black color is dominant to a special- temperature-s.docx
1- The ability of a virus to infect one type of organism and not anoth.docx
1- The ability of a virus to infect one type of organism and not anoth.docx
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1- T-F- Annual borius plans are long-term executive inctitives- and at.docx
1- Select all that apply- Software testing is a process that helps in.docx
1- Select all that apply- Software testing is a process that helps in.docx
1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1- Pandoravirus salinus is virus that infects amoeba- is very large (1.docx
1- Joe Smith works in the IT department of a large industrial company-.docx
1- Joe Smith works in the IT department of a large industrial company-.docx
1- In order to beat- the heart requires A- nervous system input B- h.docx
1- In order to beat- the heart requires A- nervous system input B- h.docx
1- Identify one job position to develop- compentency based job descrip.docx
1- Identify one job position to develop- compentency based job descrip.docx
1- Implement a Python function that accepts an positive integer and re.docx
1- Implement a Python function that accepts an positive integer and re.docx
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1- How may have the complex lifestyle of digentic trematodes evolved-.docx
1- identify and discuss the two most imporant factors in population dy (1).docx
1- identify and discuss the two most imporant factors in population dy (1).docx
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- How does ancestry and race play into disease genetics- 2- How does.docx
1- Historical Development of Computing and Information Technology a) H.docx
1- Historical Development of Computing and Information Technology a) H.docx
1- How has examining your beliefs- assumptions- and values related to.docx
1- How has examining your beliefs- assumptions- and values related to.docx
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1- Given the Trilemma- if a country has the free flow of capital and a.docx
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx
Recently uploaded
Operation Blue Star - Saka Neela Tara
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Supporting (UKRI) OA monographs at Salford.pptx
How libraries can support authors with open access requirements for UKRI funded books
Wednesday 22 May 2024, 14:00-15:00.
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Chapter -12, Antibiotics (One Page Notes).pdf
This is a notes for the D.Pharm students and related to the antibiotic drugs.
Embracing GenAI - A Strategic Imperative
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
1.4 modern child centered education - mahatma gandhi-2.pptx
Child centred education is an educational approach that priorities the interest, needs and abilities of the child in the learning process.
special B.ed 2nd year old paper_20240531.pdf
Instagram:-
https://instagram.com/special_education_needs_01?igshid=YmMyMTA2M2Y=
WhatsApp:-
https://chat.whatsapp.com/JVakNIYlSV94x7bwunO3Dc
YouTube:-
https://youtube.com/@special_education_needs
Teligram :- https://t.me/special_education_needs
Slide Shere :-
https://www.slideshare.net/shabnambano20?utm_campaign=profiletracking&utm_medium=sssite&utm_source=ssslideview
Acetabularia Information For Class 9 .docx
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
"Protectable subject matters, Protection in biotechnology, Protection of othe...
Protectable subject matters, Protection in biotechnology, Protection of other biological materials, Ownership and period of protection
Synthetic Fiber Construction in lab .pptx
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Recently uploaded (20)
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
Normal Labour/ Stages of Labour/ Mechanism of Labour
Normal Labour/ Stages of Labour/ Mechanism of Labour
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
1.4 modern child centered education - mahatma gandhi-2.pptx
1.4 modern child centered education - mahatma gandhi-2.pptx
Group Presentation 2 Economics.Ariana Buscigliopptx
Group Presentation 2 Economics.Ariana Buscigliopptx
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
"Protectable subject matters, Protection in biotechnology, Protection of othe...
"Protectable subject matters, Protection in biotechnology, Protection of othe...
1- In terms of the environment of early earth- what resulted from the.docx
- 1. 1. In terms of the environment of early earth, what resulted from the development of photosynthesis? Cell Membranes Oceans An aerobic environment An anaerobic environment 2. Which of the following enzymes will create an RNA strand? DNA Polymerase Primase Helicase RNA Polymerase 3. Which of the following I S NOT a characteristic of living organisms? Can live with no energy provided by the external world Can convert molecules obtained from their environment into a new biological molecule Use genetic information to reproduce themselves Consist of one or more cells They evolve 4. Which of the following is not a force of evolution? Natural Selection Genetic Drift Mutation Gene Flow Vestigial Structures 5. True or False: Evolution is the optimization of organisms over multiple generations.
- 2. 6. Which of the following is needed for natural selection to occur? (Select all that apply) Variation within a population Time Geographic isolation More offspring are produced than can survive. Traits are inherited by offspring. Two populations mating 7. Select all of the statements that are true of DNA DNA is double-stranded DNA is single-stranded DNA is less stable than RNA DNA is more stable than RNA DNA is directly involved in the synthesis of proteins. DNA is antiparallel. 8. True or False: Speciation due to two populations breeding at different times in the same area is an example of sympatric speciation 9. True or False: Allele frequencies can change within an organism 10. Which of the following is not a DNA sequence? AUGUGCGUAACUGUGA ATTTTGGGGGCCCCGGAATT ATGTGCGTAACTGTGA Cell Membranes Oceans An aerobic environment An anaerobic environment