Your SlideShare is downloading. ×
0
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Understanding Variations in Oligonucleotide OD and Yield
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Understanding Variations in Oligonucleotide OD and Yield

610

Published on

Published in: Technology, Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
610
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
32
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Understanding Variations in Oligonucleotide OD and Yield CHIA Jin Ngee Integrated DNA Technologies
  • 2. Terminology  Scale is the starting amount of material  nanomoles (nmol)  Yield is the delivered amount of material  nanomoles (nmol)  OD units  OD (optical density) is a measure of concentration
  • 3. Areas of Confusion  1 OD of single-stranded DNA = 33 µg/mL  True for large single-stranded DNA 1 kb and longer  Why does this not apply to short oligonucleotides?     Each base exerts an influence on the overall absorbance Each neighboring base exerts an influence on the overall absorbance Each oligonucleotide is custom made and has a unique sequence Therefore, what constitutes 1 OD is unique for each oligonucleotide
  • 4. What is Absorbance or OD? 
  • 5. Molar Extinction Coefficient for Oligonucleotides  Nearest-neighbor method  For sequence: 5′–dATGCTTC–3′  ƐdATGCTTC = ƐdApdT + ƐdTpdG + ƐdGpdC + ƐdCpdT + ƐdTpdT + ƐdTpdC - ƐpdT - ƐpdG - ƐpdC - ƐpdT - ƐpdT  Wavelength of 260 nm, neutral pH  General constant extinction coefficient for single-stranded DNA  33 ng-cm/µL*  Use IDT OligoAnalyzer® program to determine the value of 1 OD  http://sg.idtdna.com/analyzer/Applications/OligoAnalyzer/ *Some instruments use this constant extinction coefficient by default
  • 6. Molar Extinction Coefficient for Bases DNA RNA Stack or monomer Extinction coefficient Stack or monomer Extinction coefficient pdA 15400 pA 15400 pdC 7400 pC 7200 pdG 11500 pG 11500 pdT 8700 pU 9900 dApdA 27400 ApA 27400 dApdC 21200 AdC 21000 dApdG 25000 ApG 25000 dApdT 22800 ApU 24000 dCpdA 21200 CpA 21000 dCpdC 14600 CpC 14200 dCpdG 18000 CpG 17800 dCpdT 15200 CpU 16200 dGpdA 25200 GpA 25200 dGpdC 17600 GpC 17400 dGpdG 21600 GpG 21600 dGpdT 20000 GpU 21200 dTpdA 23400 UpA 24600 dTpdC 16200 UpC 17200 dTpdG 19000 UpG 20000 dTpdT 16800 UpU 19600
  • 7. Sequence-Influenced OD Results Name GC+AT=Length Sequence Mol. wt Ɛ nmol/OD µg/OD 50/50 mix 10+10=20 AGAGAGAGAGAGAGAGAGAG 6362.2 234700 4.26 27.11 50/50 separated 10+10=20 AAAAAAAAAAGGGGGGGGGG 6362.2 223900 4.47 28.42 Actin B F 10+10=20 TTGCTGACAGGATGCAGAAG 6206.1 200500 4.99 30.95 Actin B R 10+10=20 TGATCCACATCTGCTGGAAG 6117.0 190800 5.24 32.06 Tubb5 F 11+10=21 GATCGGTGCTAAGTTCTGGGA 6517.3 205900 4.86 31.65 Tubb5 R 11+10=21 AGGGACATACTTGCCACCTGT 6406.2 199300 5.02 32.14
  • 8. Variation Due to Calculation Method Used  Assume absorbance = 1.0 and path length = 1.0 cm Nearest neighbor Constant Sequence (5′–3′) AGAGAGAGAGAGAGAGAGAG 4.26 27.11 5.81 33.00 AAAAAAAAAAGGGGGGGGGG 4.47 28.42 5.81 33.00 TTGCTGACAGGATGCAGAAG 4.99 30.95 5.32 33.00 TGATCCACATCTGCTGGAAG 5.24 32.06 5.39 33.00 GATCGGTGCTAAGTTCTGGGA 4.86 31.65 5.06 33.00 AGGGACATACTTGCCACCTGT 5.02 32.14 5.15 33.00
  • 9. OD Unit 
  • 10. Variation Due to Instruments  A major source of variation  IDT calibrates spectrophotometers regularly  Variations between our measurements and customers’ are always observed  Despite using the same nearest neighbor method  20–30% variation between IDT readings and yours
  • 11. Yield  Yield is calculated from OD  Variation between your measured and calculated OD and ours  Yield is based on OD; therefore, variations are due to the OD measurements  For more details, see the article:  “Oligo Quantification—Getting it Right” in DECODED 3.1 (January 2013 issue) at www.idtdna.com/decoded
  • 12. Conclusions  OD variation will always exist between us and you due to differences in instruments used  Do not be alarmed at these variations  What if your OD determinations reveal a very large variation?  Contact us:  asiacustcare@idtdna.com  Chat with us through our webpage www.idtdna.com  Call us at +65 6775 9187 (IDT Asia)
  • 13. Follow Us!

×