1. Type Essays For Money
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
Type Essays For MoneyType Essays For Money
2. Mccloskey Imperfection Vs Evil
assumed that the machine was made by someone with specific skills to build and maintain the
equipment in order for the machine to continue to produce equipment. The similar situation is
occurring as God left his machine to do his work and has no need to change anything that it is
producing.
McCloskey further argued the presence of imperfection and evil in the world argues against divine
design or divine purpose. While the cosmological argument has limitations regarding his argument
as mentioned prior, he does seem to contradict himself when he says, the first cause must be
explained as an uncaused cause, otherwise we are left with an infinite regress of causes (51). This
implies that evil which McCloskey does believe in may have been from
... Get more on HelpWriting.net ...
3. Joyce Carol Oates Short Story Analysis
Most teens learn to use irony as a way to avoid telling the truth, tip toeing around the truth. They
do this to deal with or avoid issues in their lives that they do not want to face directly. They would
prefer to mask their feelings with lies, then be direct and turn to irony to convey emotions they
cannot be honest about. In Joyce Carol Oatesshort story, this is exactly what Sunny does. The
understanding and meaning of a free world between Sunny and Zachary display just how
differently people view and relate the outside world to their life choices and responsibilities. A
discussion could be brought on about this topic, or if teens view it as a free world too, and how
they feel about their own responsibilities and choices, in this free world. Oates uses irony in her
writing to point out this distinct difference in her two main characters . Sunny saw the world as
free of her, but as for Zachary, he did not. Prior to the response, Sunny gave him, Oate s mentions
as to why he may not see it as a free world. Zachary s parents were urging him to go to
Muhlenberg College...Zachary hoped to go elsewhere (42). Zachary was having his choices
almost made for him despite his want to do something else. Having someone else control his
actions and thinking of others when making decisions, affected how he carried out his personal
and school life actions. Sunny was popular and like the good looking girls, club officers, prom
queens, cheerleaders.... (14). She was kind and wholesome.
... Get more on HelpWriting.net ...
4. Women s Responsibility Of Rear The Children And Keep The...
Introduction:
From the beginning of times it has always been the women s responsibility to rear the children
and keep the house tidy, traditional wifely duties. Why? Because kids come from inside of
women? Pew Research Center, reports that men spend 4.8 hours a week (in 2011) more with
their children than they did in 1965 and six more hours a week (in 2011) on household duties
and chores. Women actually spend less time than they did in 1965, a reported fourteen hours
less a week in 2011 (USA Today, 2013) .Men and women are learning to work together. Work/life
balance is becoming a shared priority which in 1965 was not as women spent most the time in the
home. I do find it very interesting that men and women with children both spend about 10 hours
less doing leisure activities with kids (USA Today, 2013); I find it interesting only because the
number is so much higher than originally thought which suggests that teamwork between husband
and wife is beneficial to everyone making better relationships. The percentage of stay at home dads
has increased by 3% in 1989 to 7% in 2012 (Pew Research Center, USA Today).
Fathers are extremely conflicted today, says Christopher Brown of Cedar Park, Texas, who is
executive vice president of the National Fatherhood Initiative, a nonprofit based in Germantown,
Md. Many years ago, the father was looked at primarily as a financial provider. Now he s looked
at in a much more holistic sense of what providing means. It s not just financial
... Get more on HelpWriting.net ...
5. The Importance Of Doping In Sports
Doping in sport has been prominent since the Olympics were first introduced in Ancient Greece,
with competitors supposedly ingesting Strychnine as a performance enhancer (Fitch, 2012). This
has continued into today with new research commencing weekly investigating performers using
performance enhancing drugs in a world where the difference between first and second can cost an
athlete millions in sponsorship and reward money. The regulation of doping in sport was not
introduced until the 1960 s, when the sudden death of a cyclist at the 1960 Rome Olympics was
attributed to the amphetamines in his system taken as a performance enhancer. Consequently this
kick started the fight against doping with the IOC creating a list of prohibited substances in 1967,
containing mostly stimulants. World Anti Doping Agency(2003 [online]) states that The spirit of
sport is the celebration of the human spirit, body, and mind. and is characterised as keeping true to
ethics, fair play and honesty; health; and respect for rules and laws. (p.3), this alludes to the fact
that doping is in breach of these characteristics and should be eradicated to maintain the spirit of
sport. This essay will review current thinking about performance enhancing drugs in elite
competitions, the research undertaken and the resolutions suggested.
Savulescu et al., (2004) argues that lifting the prohibition on doping with some drugs would level
the playing field in elite competitions as it would eliminate genetic
... Get more on HelpWriting.net ...
6. Examples Of Rekindle Candle
Rekindle Candle
Introduction Generally, we are so persistent with our own view and thinking, seldom think out of
the box. Sometimes, a great invention that brings advantages to humankind just needs our
creativity. When we are able to think critically and creatively, a lot of things will be definitely
different. For an instance, if Newton did not think deeply why the apple will fall to the ground
instead of accelerate towards the sky, then he will never realise the gravity. Therefore, we would
like to introduce a simple and nice rekindle candle invented by Benjamin Shine. In the past, candle
played an important role in each family whenever power cut and brought us precious and
unforgettable memories with shadow games. Nowadays, candle has become a dispensable
presence as its role to bring light in the dark has been replaced by torch and flashlight. But
sometimes when we want to revive our childhood memories or have a candlelight dinner with our
loved ones, we could not find a single candle because we did not buy a new one when the old
candles burnt out. This is the moment when we need a candle that is reusable so we can use it for
plenty times. The clever candle holder is so simple that many would wonder how comes we did not
think about it before? It may not as popular as the common one, but this invention ... Show more
content on Helpwriting.net ...
The difference between rekindle candle and common candle is rekindle candle can last at least
twice as long and even twelve times after being used. He had redesigned the candle holder by
replacing it with a long hollow tube with a wick inside it. As the candle burns, the melting wax
will drip from the candle and accumulate inside the transparent stem until the candle s life ends.
After it is dried and harden, just broke out the reformed candle. This process can be replay
whenever the wax is not running out. This Benjamin s candle really
... Get more on HelpWriting.net ...
7. The Annexation Of The United States
The annexation of Texas was a path that many Texans wanted. Nearly ninety percent of Texans
wanted to become part of the United States. People hadn t come to Texas to become part of the
British Empire; most were particularly incensed by the British insistence on emancipation of the
slaves; responding to public sentiment, the TexasSenate demanded that President Houston give
them a full accounting of his dealings with Great Britain . Before annexation, The Republic of
Texas was a sovereign nation that existed for nearly ten years. The annexation process was
proposed by John Tyler. Unfortunately, President Martin Van Buren struck down the annexation of
Texas out of fear that this would expand slave territory and ensue war with Mexico. The Treaty of
Annexation, Treaty of Guadalupe Hidalgo, Mexican American War and Joint Resolution of
Congress all impacted the annexation process.
In June of 1844, the United States Senate considered a treaty which had been submitted for
ratification; this treaty was the Treaty of Annexation. The purpose of this treaty was designed to
bring The Republic of Texas into United States of America as one of its states. This proposal was
defeated in the United States Senate. The annexation process started when Texas declared
independence from Mexico. The unanimous vote of the people of Texas in favor of annexation to
the United States will be remembered, as also the diplomatic correspondence between Mr. Forsyth
and Mr. Hunt, in 1837 on the
... Get more on HelpWriting.net ...
8. Relationship Quality As An Outcome Of Co-Rumination
Relationship Quality (good). Increased friendship quality is typically cited as an outcome of co
rumination. Friendships are important factors in socioemotional development as they provide
positive functions like companionship, protection, guidance, and validation (Rose 2007; Dirhangi
et al 2015). These peer relationship become increasingly important for adolescents as they begin to
turn more towards friends for company, sources of comfort and emotional support (Ruitjen et al
2010). These aspects are vital to friendships and create a welcome environment for co rumination to
commence. Co rumination was shown to have a significant positive correlation with reports on
relationship quality among adolescent best friends (Rose 2002). This is increasingly
... Get more on HelpWriting.net ...
9. Divorce Is A Win And A Loss For Parents And Children
Divorce is a Win and a Loss for Parents and Children The divorce rate in today s society according
to Barbara Dafoe Whitehead is higher than ever. Although people have a legal right to file for
divorce, it is still viewed as an ethical problem. Barbara Dafoe Whitehead writes in The Making of
a Divorce Culture , that divorcehas become an ethical problem in the United States. In today s
society, divorce is viewed as a social norm, and that couples should have a right to file for
divorce with no stigma. Although Whitehead argues that divorce is an ethical issue, she also
shows reasons why couples should carefully think of filing for divorce before making a final
decision such as their children s consideration. Whitehead successfully presents the divorce
culture as a very serious ethical problem by giving ideas of why parents are getting divorced, and
how their children can be effected by it. Although divorce is viewed as an ethical problem,
people still have the right to file for a divorce if it is for their own satisfaction. We never know
what happens behind closed doors between a couple, and what types of issues they are going
through. Whitehead mentions in her article about how abusive and how demolorizing some
relationships can be. In her article, Whitehead states We must assume that divorce is necessary as
a remedy for irretrievably broken marriages, especially those that are marred by severe abuse such
as chronic infidelity, drug addiction, or physical
... Get more on HelpWriting.net ...
10. Genetic Modification Pros And Cons
Most parents would want their child to be free of disease, impairment or maybe even want them
to be perfect. Genetic modification provides the opportunity for parents to edit their child s
genome while still inside the mother s embryo. For example, Clustered Regularly Interspaced
Short Palindromic Repeats, or CRISPR for short, is an editing technique that in short, is like two
pairs of scissors. When a virus infects a cell, it inserts its RNA into the cell s DNAand tricks the cell
into replicating hundreds of viruses until the cell bursts and the newly created viruses target new
unsuspecting cells. CRISPR finds and cuts the RNA that the virus injected into the cell multiple
times until it turns into small, separate pieces that pose no threat to the cell and then creates a
normal cell. This also passes down through generations, so the offspring of whoever had CRISPR
is now also immune to that certain virus. CRISPR also can edit humanfeatures, change skin or eye
color, or maybe make them stronger. Genetic modification is the right direction if parents want
their child to live a good life.... Show more content on Helpwriting.net ...
To be able to fix problems such as freeing them from a birth defect that impairs them. One of the
things that it can do is that it can allow scientists to make precise changes to DNA, and has the
potential to transform the treatment of genetic disorders by correcting faulty genes (Sample, 1).
Genetic modification can provide people the chance to stop a defect that was passed down for
generations like CRISPR. For example, if there is a defect that was passed down from generations
before and the baby will have Autism, scientist can change the baby s genomes to stop the defect
and create better traits that replace the
... Get more on HelpWriting.net ...
11. Dulce et Decorum est, by Wilfred Owen. Essay
Dulce et Decorum est, by Wilfred Owen.
The First World War was an event that brought to many people, pain, sorrow and bitterness.
Accounts of the war shows that no other war challenged existing conventions, morals and ideals in
the same way as did World War. Many people touched by the terrror of the war have written pieces
of literature about the massacre that was World War 1, wishing people to understand the horror and
tragedy that befell those involved. Dulce et Decorum est , by Wilfred Owen, is one such elegy that
presents to the reader a vivid, horrifying description of World
War 1, aiming to illustrate that war is not romantic and heroic, but a senseless and devastating
event. In this poem, techniques such as
imagery, ... Show more content on Helpwriting.net ...
He describes the soldiers as bent double, like old beggars under sacks , knock kneed , limping on ,
all lame, all blind , being drunk with fatigue and deaf . All these descriptions of the soldiers show
the reader the suffering they had to endure and the hardships that they had to face. This is backed
up by the description that men marched asleep . This description of the soldiers, of how they
limped on, blood shod gives the reader an impression that they can no longer comprehend what is
going on around them, that they are blind and deaf to the world.
Metaphors are used to illustrate more vividly the descriptions used in the poem. This is evident
in the description of the soldiers as old beggars under sacks . This not only says that they are
tired, but that they are so tired they have been brought down to the level of beggars who have
not slept in a bed for weeks on end. In the description his hanging face, like a devil s sick of sin
Owen compares the gas victim s face to the devil seeming corrupted and baneful. A metaphor even
more effective is one that compares ...vile, incurable sores... with the memories of the troops. It not
only tells the reader how the troops will never forget the experience, but also how they are
frightening tales, ones that will the troops will never be able to tell without remembering the
extremely painful experience. These
... Get more on HelpWriting.net ...
12. False Eyewitness Testimony
It is easy for people that have been presented with false information to report witnessing events
that never happened. In the article Can fabricated evidence induce false eyewitness testimony? by
Wade, Green, Nash discusses the way in which fabricated evidence impact the accuracy of
someone being able to accuse a person of a crimethey did not commit.The participants included 60
university students, who were then divided into three groups of 20. Participants were told that
researchers were going to study the way in which people behave when gambling real money versus
virtual money and were told that the one with the most profit would get a cash price at the end.
Participants were instructed that they would be taking a multiple choice quiz... Show more content
on Helpwriting.net ...
Phase two consisted of researchers tampering with the video and replacing the check mark with
an X on the video recording of the accomplice playing, making it seem as if she was cheating
although in reality she followed the rules. Some subjects viewed a digitally manipulated video of
their partner cheating; some were told that video evidence of the cheating exists; and others were
not told anything about the evidence. Subjects were asked to sign a statement confirming that they
witnessed the incident and that it could be used in disciplinary actions against the accomplice. The
results showed that see video subjects were three times more likely to sign the statement than Told
video and Control subjects. Wade et al concludes that visual and verbal false evidence can lead to
false eyewitness testimonies while being aware there would be consequences and penalties against
the accomplice. In a different study by Szpitalak and Polczyk Mental fatigue, mental warm up, and
self reference as determinants of the misinformation effect the conclusion made by wade et al is
... Get more on HelpWriting.net ...
13. Lactose Intolerant People Research Paper
HELP FOR LACTOSE INTOLERANT PEOPLE
Who is a lactose intolerant person? This is a person who cannot digest lactose when ingested into
his body. How do you know that you are lactose intolerant? If you take fresh dairy products and
diarrhoea or get stomach upsets like bloating, pain, or cramps, regurgitation, flatulence, or gas,
borborygmi rumbling and gurgling in the stomach, nausea sometimes accompanied by vomiting,
you could most likely be a victim.
All is not lost if you still like dairy products, only in this case you may need to take tem in a
different state.
Milk has several components although many people take it as a source of protein, well it has
3.5% protein but more than that it has a 2 8% of carbohydrates which majorly is lactose or what
we call milk sugar. This is what that gives the fresh milk a sweet taste.
In the digestion process, carbohydrates are digested from the mouth by the enzyme by salivary
amylase, in the stomach there isn t much further break down until when it gets to the small
intestines. Every sugar requires its enzyme to digest it, for example maltose requires maltase so
lactose requires lactase. Lactase enzyme is naturally produced by cells in the small intestine lining;
it breaks lactose into its simple sugars which are glucose and galactose. It cannot be absorbed in its
complex state. ... Show more content on Helpwriting.net ...
Same way herbivores digest green forage while carnivores cannot. Lactase is present in babies
but wears off in some people as they grow older, mostly from the age of six. Premature babies may
have less lactase and they may be lactose intolerant to a significant amount. There is also a
congenital lactose intolerance in some people all together, though rare it cannot be ruled out. There
are other factors that can cause intolerance of fresh milk as well as fresh dairy products, these
include gastroenteritis and
... Get more on HelpWriting.net ...
14. WCLR Widget Developers and Networking
WCLR Widget developers and networking LTD 1. Going it solo Many organizations are set with
different aims and objectives that are achieved through effective coordination of all departments.
These achievements are obtained when the company identifies its main business which is primary,
secondary or tertiary. The main primary business of WCLR limited is to come up with widget
developers groups with support and networking. Communication refers to the process of
transferring information in a given organization through the use of a medium (Lacar, 2011). This is
very essential to a business organization if done efficiently and information understood by the
receiver. A well planned overview of communication within an organizational department like HR is
very important as it allows effective implementation of business responsibilities. This benefits the
employees as they understand their responsibilities well through the communication department.
Supervisors, managers and board of directors also benefits from such a plan as they also
understand their roles and ensures effective running of the organization. Roles and responsibilities
In every organization, it is necessary for every stakeholder such as employees, supervisors and
managers to understand their roles. This reduces confrontations as each team understands its
responsibility. Employees are expected to play the following responsibilities: Technical expert: it is
the role of employees to ensure that they perform properly in
... Get more on HelpWriting.net ...
15. Key Differences In The Tang Dynasty And Mughal Dynasties
There are many key differences to both dynasties works. Firstly, in terms of display, the Tang
Dynasty has more of a simple, serene look while Mughal has more of a crowded scenery. This
shows a big difference in order considering Chinese works are more Confucian and Indian works
are more Daoist. Secondly, the choices of colors are different as well because the Tang Dynasty
limits colors to very somber ones with the only bright color is red to show influences. Mughal
paintings have a variety of colors and different patterns that one may not know where to begin in
looking at the painting. Thirdly, in space within the painting the Tang Dynasty has more space
because it only puts one object as the spotlight with no background comparing to Mughal paintings
which lack total space and show many things going on that one of high status is not always center
of attention. Backgrounds within Mughal paintings are very detailed and show different aspects of
life. Fourthly, a detailed difference between these paintings is that in the Tang Dynasty it is shown
that an emperor who is standing is more powerful than one sitting, while Mughal is the complete
opposite, as shown in the painting selected, because Akbar is sitting while he is one of highest
status. Fifthly, influences are different from both where the Tang involves Central Asian influences
while Mughal has European Renaissance, Hindu, and Persian influences. Lastly, another difference
is that Mughal paintings show more life
... Get more on HelpWriting.net ...
16. Analysis Of The Movie The Dark Night Rises
The Dark Night Rises July 20th 2012 held the midnight premiere of the anticipated film, The
Dark Night Rises, this night was also the premiere of an idea in my head, that I passionately
hated guns. The Aurora shooting was a massacre that carved a deep impression on my beliefs in
relation to guns and even more so, the moral people. It was after that incident that I began to see
America s ethical spine for what it really was, bent and partially broken. As the ethical backbone of
this country continues to twist and curve in uncomfortable directions, I fear the safety of the future.
A dark night did rise in that midnight hour and continues to do so with every incident and
heartbreak this country endures. Life is no longer sacred, hope is deferred and this nation is lost
searching for a solution. Guns have become somewhat of an arch nemesis to many in this country.
There is only one implication that guns reveal, and that is death. To possess, to use, to practice with
a gunis to imply that one intends to inflict bodily harm on another and although in some cases this
intention may be good, in most, it is not. Even in the hands of those who assume the duty to
protect this country, are questioned on whether or not using a gun was the right decision. If a
police officer can be found guilty of misuse of a firearm; men and women who have trained and
practiced physically and mentally on how to operate a gun, how then can a normal citizen expect to
use one correctly? American is
... Get more on HelpWriting.net ...
17. Research Paper On Larpool Viaduct
Whether your interests lie in history and culture, vampires and Goths, or just fish and chips this
walk ticks all those boxes. It begins with a leisurely stroll along a former railway trackway to
cross the River Esk at the Larpool Viaduct. After exploring the many attractions of Whitby, a
bracing walk along the Cleveland Way returns us to Hawsker. The village of Hawsker consists of
two parts, known as High and Low, and it originally had a cobbler, tailor, blacksmith and a
windmill. Of these only the mill at Low Hawsker remains. The mill, built c.1861, stood 64 feet
(19.5m) in height with three storeys and four sails, and it remained in use until around 1915, and
the upper storeys removed in 1960. Standing in an enclosure further along... Show more content on
Helpwriting.net ...
Captain Cook, Dracula and Whitby Abbey have each played a part in Whitby s fame and
prosperity. Captain Cook s association with Whitby began in 1746 when he became a merchant
navy apprentice with Quaker shipowners, John and Henry Walker, ferrying coal between the
North East and London. The Captain Cook Memorial Museum is in a seventeenth century house
in Grape Lane on the harbourside. According to long standing Whitby tradition, this is where
Cook lodged during his apprenticeship when he was not at sea. (For more on Captain Cook see
prominent people on page 50). The route from Whitby climbs the 199 steps, known locally as the
Church Stairs. Every tenth step and the last one has a small brass plate denoting the step number
so there s no need to count them! The stairway leads to the East Cliff and St. Mary s Church
where there are panoramic views back over Whitby. The Abbey ruins stand next to St Mary s
Church, overlooking the old town of Whitby clustered at the mouth of the River Esk. Like all
Abbeys, it suffered at the hands of Henry VIII, but the gaunt silhouette of the ruin still presents a
dramatic sight against the sky, particularly at
... Get more on HelpWriting.net ...
18. Women s Rights In A Worn Path
The twentieth century saw many changes in the treatment of African Americans and Women. After
the Civil War ended in 1865, the Thirteenth Amendment was passed. African Americans were now
free, but this freedom came at a cost. Blacks were still treated awfully, their rights were limited,
and they were segregated from the whites. Women were also very limited in their rights during
this time. They could not vote and were often expected to work at home and raise a family. Jim
Crow Laws, laws they enforced racial segregation, were put in place from the late nineteenth
century through the 1950s (Shi and Brown 599). Although they had the right to vote, unlike
women, many actions were also taken to keep blacks from voting. Poll fees were charged and...
Show more content on Helpwriting.net ...
From slavery to segregation, being of black skin was no easy task. During this crucial point in
American History, African Americans slowly lost the majority of the racial discrimination that
tore them down. In the 1930s 1940s violence grew against blacks and the Great Depression hit
black Americans the hardest. Phoenix was born in roughly the 1850s. She grew up as a slave and
was lucky enough to see emancipation. Phoenix is illiterate because she was too old to go to
school when the slaves were freed. She faces racism along her path from the hunter and the
receptionist. The hunter derogatively calls Phoenix Granny and points a gun to her head asking,
Doesn t the gun scare you? Phoenix responds to the hunter by saying, I seen plenty go off closer
by, in my day, and for less than what I done 0(Welty 4). This act shows the hunter s blatant
disrespect for Phoenix. If she had been white, the hunter would have treated extremely different.
Additionally, the receptionist in the clinic calls Phoenix a charity case and speaks to her rudely.
The color of your skin mattered heavily to white folk of this time period. In the other story, Silver
Sparrow, most of the characters are African American. At this point, African Americans grew to be
normal within society. However, it is apparent how they still seem to largely associate with their
same race. Dana s mother had a department store job at a gift wrap counter; this was a nice job for a
... Get more on HelpWriting.net ...
19. Doug Flutie Research Paper
Doug flutie, a professional quarterback, always criticized for being too short, and a Heisman
trophy winner. This hardly describes doug and who he is because he is so much more. Only one
offer from a division one college because of his height, but he did the most he could with it and
became a legend for the gameof football. Weather it was his no huddle offence in canada or his
famous hail mary in college, or being a great father he will always be remembered. He will
always be most remembered for being the first successful quarterback that was short. Douglas
Richard Flutie was born in Manchester, Maryland in 1962. He was the type of kid who was playing
sports all of the time. He ended up playing high schoolsports in Natick, Massachusetts. He played
baseball, basketball, and football in high school and was successful at all three. Basketball was
always always my first love doug said .( Doug Flutie Newsmakers 1). Being an all league
performer in all three sports made it very hard for doug to make a choice on which sport to
choose. The only thing holding doug back from getting any big scholarships was his size. Standing
at five foot nine many colleges were not interested in a small quarterback or basketball player. In
fact, major universities were even unwilling to offer him... Show more content on Helpwriting.net ...
His junior year was a little better with a record of 9 3 ( Doug Flutie Stats 1). The Boston Eagles in
1983 were good enough to make the liberty bowl. They lost 19 18 to Notre Dame in the liberty
bowl. Doug was still drawing very little interest from NFL clubs. His senior season would put him
on the radar of all NFL scouts. His senior season was one of the best seasons a quarterback has ever
had. Doug led the Eagles to a 10 2 record and a cotton bowl win over houston. His stats for that
year were astonishing, he threw for over 3,500 yards and threw 30 touchdowns ( Doug Flutie Stats
... Get more on HelpWriting.net ...
20. The Diabetes Association The Blood Glucose Level Should Be...
A portable glucose measuring device is a meter that displays the amount of sugar in your blood.
What is glucose? Glucose is sugar that your body uses as a source of energy. You should use this
device if you have diabetes or if you need to monitor your sugar level. The device can help you
determine what you need to do to stabilize the levels and know if your levels can be dangerous
threat to your health. The American Diabetes Associationthe blood glucoselevel should be below
100mg/dL before meals and less than 140mg/dL after without diabetes.
The term diabetes was first coined by Araetus of Cappodocia in Ancient Greece (81 133AD). The
horrific disease was described by Araetus as A wonderful affection being a melting down of the
flesh and limbs into urine. The patient never stops drinking water but the 373). During the time of
Araetus, there was nothing that could be done to help the patient with flow is incessant as if from
the opening of the aqueducts. The patient is short lived. (Ahmed, this disease. As noted by Araetus,
life lasts only for a time, but not very long.
The portable glucose measuring device is a quantitative test. A quantitative test is that you will find
out the amount of glucose in your body. How does the test work? You poke your finger with a
lancet to get a drop of blood. Then you place the blood on the test strip that will be inserted into the
device. After that, the test has chemicals that react with the electricity that passes through the
... Get more on HelpWriting.net ...
21. Hank And House Character Analysis
Hank and House the
Most doctors on television accomplish heroic medical procedures to save their patients; Royal
Pains and House are no different. The main character on Royal Pains is Dr. Henry Hank Lawson,
a former ER doctor that was dismissed from his previous job when one of the hospitals wealthy
benefactors died under his care. Hank struggles to locate work, but soon finds himself as with the
title concierge doctor who treats the rich in their Hampton homes. On the television show House,
the main character, Dr. Gregory House, is portrayed as an egotistic, yet remarkable diagnostician
that solves the toughest medical mysteries by using radical and unethical means to not only
diagnose, but also treat his patients. Both television shows ... Show more content on Helpwriting.net
...
Hank accompanied one his patients families to a private island that does not have cell service.
While on the island, the caretaker, Will, is involved in an accident where he suffers from a
compound fracture, but he also has a rare blood type. Hank uses what is on hand to determine if
anyone is a compatible donor, So you can do all this with a tray? Yeah, the mirror bounces the
light so I can see how the bloods mix. If they are incompatible, they clump ( No Man is an Island
). Hank utilized what he had available to not only treat his patient, but prepared for the inevitable
blood transfusion. House, on the other hand, was having difficulty determining how to give a
terminal cancer patient another year to live when he decides, I want to induce a hypothermic
cardiac arrest, once the patient is on bypass, we will siphon off two liters of blood, and reperfuse
the brain while she is in a MRI. ( Autopsy ). This is typical for House who is known for his often
controversial, although successful diagnostic tests and treatments. Both doctors employ their
instincts to apply the techniques and resources that are
... Get more on HelpWriting.net ...
22. Freudian Psychology Lord Of The Flies
Freudian Psychology in Lord of the Flies: In William Golding s allegorical novel Lord of the Flies,
examples of Sigmund Freud s psychological theories are illustrated within the main characters
through there personal thoughts and actions. Freud s theory explores the inner separations of the
mind and the effects on ones personality. Jack, the antagonist, can be seen as the immature and
bloodthirsty Id, who hungers for meat and stops at nothing to get what he wants. Piggy and Simon
can be seen on the other end of the spectrum as the SuperEgo, through their intellect and
compassion. Ralph represents the Ego, the middle ground between the two extremes, by his
responsible decision making skills and leadership qualities. All three characters balance each other
out, and when either extreme gains too much power, turmoil issues as seen in the end of the novel.
Jack Meriweather is representative of the Id in the novel Lord of the Flies by William Golding. The
Id is defined as the part of the psyche associated with instinctual, repressed, or antisocial desires,
usually sexual or aggressive. In its efforts to satisfy these desires, the id comes into conflict with
the social and practical constraints enforced by the ego and superego. ( Freud). Throughout his
time on the Island, the choir boy and eventual chief partakes in several activities that lead readers
to believe he depicts the Id. The Id represents the unconscious part of the mindthat is always within
an individual. This
... Get more on HelpWriting.net ...
23. Essay Marketsoft Harvard- Case Study
Market Soft Case study
Situation:
MarketSoft founded by Greg Erman, in 1999 had designed an innovative software product that
addressed the problem of managing sales leads across the extended enterprise . The product
eLeads was strategically developed upon extensive research to address three critical areas many of
the fortune 1000 companies in the modern times are facing: 1.Leads get lost 2. No qualifying
systems for the leads exist and 3.The leads are never tracked.
Problems:
1. The entire product was built based on customer needs that were identified by querying an
extensive network of sales and marketing industry professionals. While MarketSoft used an
elaborate LP language to ensure that what they heard translated to all of ... Show more content on
Helpwriting.net ...
The obvious benefit of targeting this particular blue chip market segment as addressed in the
second problem could be both monetary and that a greater number of market leads can be fed into
the software when mining a larger market and could lead to minimization of the confidence
interval error ratio. However mid size markets and companies who are players in this segment
should not be ignored. The problem in ignoring them is that MarketSoft is leaving a large segment
of the market unattended and these mid level companies have a potential to grow into larger
corporations. By ignoring this market segment MarketSoft will essentially have lost an opportunity
to have developed a future clientele base
Recommendation:
Problem 1 can be addressed by following the open ended questions with specific targeted questions
that would allow focused answering, leading to better data mining which will help zero in on
exactly what the need is and ultimately help refine the product characteristics with more finesse.
A suitable recommendation to address the second problem is that these middle markets should also
be targeted and the software should be refined to cater to these current needs with an ability to
expand along with the client s business needs. To make MarketSoft accessible to also companies that
... Get more on HelpWriting.net ...
24. World Commission On Environment And Development Essay
2. 4. CONFERENCES AND REPORTS ON ENVIRONMENT
UN activity in the field of environment has been driven by major conferences and reports.
UN Conference on the Human Environment (1972)
World Commission on Environment and Development (1987)
United Nations Conference on Environment and Development (1992)
General Assembly Special Session on the Environment (1997)
World Summit on Sustainable Development (2002)
UN Conference on Sustainable Development (2012)
U N CONFERENCE ON THE HUMAN ENVIRONMENT (1972)
Economic and Social Council resolution 1346 (XLV) of 30 July 1968 recommended the General
Assembly consider convening a UN conference on problems of the human environment.
Conference convened by General Assembly resolution 2398 (XXIII) of 3 December 1968
Held in Stockholm, 5 16 June 1972
Led to the establishment of the United Nations Environment Programme (UNEP)
Outcome document: A/CONF.48/14/Rev.1
WORLD COMMISSION ON ENVIRONMENT AND DEVELOPMENT (1987)
Established by General Assembly resolution 38/161of 19 December 1983
Prepared a report for General Assembly in 1987 o Based on a four year study o Transmitted by A
/42/427 o Entitled Our Common Future, also known as the Brundtland report o Developed the
theme of sustainable development
UNITED NATIONS CONFERENCE ON ENVIRONMENT AND DEVVELOPMENT (1992)
Convened by General Assembly resolution 44/228 of 20 December 1988
Held in Rio de Janeiro, 3 14 June 1992
Known at the time as the Earth Summit
Later came
... Get more on HelpWriting.net ...
25. Seedling Research Paper
The first structure to appear in a germinating seedling is a root. This is so that the seedling can
acquire nutrients and water from the soil as well as begin its journey to the surface for sunlight.
The first structure to appear in a germinating seedling is a root. This is so that the seedling can
acquire nutrients and water from the soil as well as begin its journey to the surface for sunlight.
The seedlings should be a color of white. This is due to the fact that the seedlings have not seen any
sunlight previously, preventing the formation of chlorophyll. Once the seedlings are exposed to
sunlight, they can begin to produce chlorophyll and attain their signature green color.
An example of negative gravitropism would be the stem of the plant. Unlike root growth which
grows with gravity and grows downward toward the earth, ... Show more content on Helpwriting.net
...
The sepals are the leaf like development from the receptacle. The sepal s function is to be the
beginning of the first floral aspects of a flower.
The petals are another leaf like development from the receptacle. The function of the petals is to
attract insects in order to carry its pollen to other plants for fertilization (known as cross pollination).
The stamens are another development from the receptacle. The function of the stamen is to produce
spores and sporangia for cross pollination.
The anther is responsible for the development and production of a flower s pollen.
The filament works alongside the anther in the production of a plant s pollen, of which will be used
for fertilization and reproduction.
The carpel is another leaf like development from the receptacle. The function of the carpel is being
part of the reproduction system of a flowering plant, as it acts as a pollen catcher and ovary.
The stigma is another part of the carpel. The stigma catches the pollen and promotes germination of
said pollen within the same species of flowering
... Get more on HelpWriting.net ...
26. Critique Of Rendition
Current Topic Critique II Rendition is a legal tool used by the U.S Government to transfer
captured individuals from one country to another without going through formal extradition
procedures (Rosenbach and Peritz, 2010). This process can be described as the governments
terrorist catching tool, and like most government tools has been the subject of controversy
regarding civil liberties. Catching Mir Aimal Kasi is described by Rosenbach and Peritz (2010)
as the poster child for the good that properly using rendition can do, while Jane Mayer (2008)
shows what happens when it is used with no accountability when she shares the story of Maher
Arar. Extraordinary rendition is an even more streamlined version of rendition, it is rendition that
does not require consent from the other nation involved. The use of rendition is among the most
controversial pieces of U.S policy on the global stage. Legal Rendition... Show more content on
Helpwriting.net ...
The textbook example of this is the capture and rendition of Mir Aimal Kasi, who gunned down
two CIA employees outside the CIA headquarters building in 1993. Mir Aimal Kasi managed to
flee the scene and escape to Pakistan, where he would hide for several years (Rosenbach and
Peritz, 2010). Four years later a joint CIA and Pakistani operation would capture him and use the
rendition process to hastily get him back to the U.S to stand trial (Rosenbach and Peritz, 2010).
When both governments are afraid of keeping the detainee in the country where captured due to
anti American sentiments in the local population or various other reasons, the rendition process is
used to quickly and quietly move them to the U.S. By using rendition, instead of extradition, the
host country can avoid any potential political backlash by speeding up the process and not keeping
the detainee any longer than they
... Get more on HelpWriting.net ...
27. Neighbourhood Disputes Resolution Act Of 2011
Introduction
Neighbourhood disputes are a common occurrence to this day with many types of issues regarding
aspects such as fencing, building, tree and property issues continually being arisen in suburban
areas. The Queensland Civil and Administrative Tribunal (QCAT) is an establishment that contains
certain laws and rules which help resolve any issues that are to come up between one or more
parties. The main source of act that will be used most commonly throughout this piece is the
Neighbourhood Disputes Resolution Act of 2011 which acts as a source of providing rules about
each neighbours responsibilities and rights for dividing fences and trees so that they are able to
resolve the issue without involving any legal actions. There will ... Show more content on
Helpwriting.net ...
In regard to s. 13 of the (Neighbourhood Disputes Resolution Act , 2011) it states that the fence
that divides the properties between Robert and Charlie is considered to be a sufficient dividing
fence , which is stated as a fence for adjoining land of two section of residential land . The act
states that a sufficient dividing fence should be a minimum height of 0.5 metres and should not
exceed 1.8 metres in height. The underlying issue that is evident is that the fence between the two
was in fact 3 metres in height which is well over legal limits. In addition to this, Robert had an
inspection on the fence and discovered that the fence was not in appropriate condition for it to stay
there and he did not take actions to apply for the fence to be removed.
Due to the fact that part of the fence has fallen down, there is no question that there has to be a
replacement built. Because the original fence was over the legal length of 1.8 metres, the
remaining length of the fence has to also be removed as it cannot be renewed or rebuild back to
its original height of 3 metres. Therefore, Robert should take immediate action in regards to the
removal of the rest of the fence that still current stands. This is due to the fact that the other parts
of the oversized fence could still quite possibly injure someone and or damage something of either
Robert s and Charlie s property, which luckily for Robert s instance didn t happen when the
... Get more on HelpWriting.net ...
28. Are Humans To Blame For Global Warming Research Paper
Humans are to blame for global warming, there is no question about it. Humans and human actions
are causing a rise in temperature worldwide. We have recorded a steady rise in temperature for the
last fifty years. This rise is caused by an estimated 95% of human actions.Humans are to blame for
global warming because of deforestation, population growth, and the use of non environmentally
safe products.
Deforestation is a process of cutting down too many trees and it largely affects the climate. The
Amazon rain forest is a perfect example of this. In the past 40 years a full 20% has been removed
from that single rainforest alone.When cutting down trees the process of photosynthesis can not
take place. Therefore large amounts of carbon dioxide are left in the air, and there is less oxygen.
These C02 bonds interfere with the C03 in the ozone. Global warming is greatly affected by
deforestation due to the increase in greenhouse gases it causes. Tens of Millions of acres are being
cut down each week. These acres are as large as Italy. When these trees have been burned carbon
dioxide enters the atmosphere. Trees are 50% carbon dioxide, so when deforestation takes place lots
of carbon dioxide is released. It accounts for 25% of carbon dioxide emissions. ... Show more
content on Helpwriting.net ...
More people means more transportation. Most of which using fossil fuels, which cause cause
more C02 to enter the air. Most people acknowledge we need to make big changes in our way of
living. Most global increases are due to increases in carbon dioxide from fossil fuels, says CNN.
Fossil fuels that are burned from vehicles in cities worldwide equal up to around 7.5 million tons
of carbon dioxide. More people equates to more emissions being burned whether its creating
products for the population to transportation. Using gas saving vehicles or hybrids will help
reduce emissions, but a full switch will need to be made for the world to
... Get more on HelpWriting.net ...
29. Exhibitionistic Disorder Research Paper
Most people who suffer from Exhibitionistic Disorder do not seek treatment on their own even
after conviction. Exhibitionists will seek treatment because a judge enforces that they do so to
prevent jail time or more serious consequences. Reasons why exhibitionists do not seek treatment
on their own is because they are addicted to the arousal received when they expose themselves and
because they are too embarrassed of their loved ones finding out. There is a various amount of
treatments for exhibitionists. Therapies are a very common form of treatment for exhibitionists.
There is different type of therapies to treat this disorder. Cognitive Behavioral Therapy is a very
common and effective therapy used for exhibitionists. This therapy consists of changing the
thoughts and behavior or the exhibitionist to decrease thoughts and acts of exposing his/her
intimate body parts. Another type of therapy that is used to treat Exhibitionistic Disorder is
Aversion Therapy. Aversion Therapy is a form of behavior therapy that uses classical conditioning
in which an adverse stimulus is combined with... Show more content on Helpwriting.net ...
Ways to decrease the diagnosis of paraphilias is to fund programs that offer treatment on disorders
such as Pedophilia, Exhibitionism, Voyeurism, and other dangerous disorders. Exhibitionists are
very unpredictable due to their biological state of being. Exhibitionists operate on uncontrollable
impulses and work [from] uncontrollable impulses (Indecent Exposure: Exhibitionism par: 15).
Exhibitionists have the highest recidivism rate of all paraphilias and it is important that this gets
taken into account to prevent these situations in society (Exhibitionism par: 29). Whenever
encountered in situations like these it is important to ignore the exhibitionist at the moment and
report the case to officials as soon as possible recommending officials to take them to places that
will give them
... Get more on HelpWriting.net ...
30. Perry Patetic s Essay
The 21st century has opened up new ways of travel for the newer and future generations. Perry
Patetic in his passage suggests that due to the level of mobility in our lifetime there lacks the
close relationships of living in one general area. He continues by listing hypothetical advantages
and disadvantages of traveling. The authors purpose is to point out that the current generations
have become less attached to other people and should stay in one spot and create close
relationships. The author creates a monotone tone for our generation and generations to come.
Due to the easy access of traveling, people tend to leave behind close friends and parts of their
past. ...that makes it too easy for us to move away from the people and our past.
... Get more on HelpWriting.net ...
31. Romeo And Juliet Light And Dark Imagery Essay
Shakespeare s Romeo and Juliet contributes a portion of its prosperity due to it s almost
exaggerated use of dramatic irony and Light and Dark Imagery, which introduces an almost
eccentric way for Romeo and Juliet to express their newfound love. Imagery, perhaps the most
common example of any literary devices, is the articulate formation of words to develop a vivid
scene in the reader s mind. There are many subcategories of imagery, albeit this particular essay
will specifically cover his continuous usage of Light and Dark Imagery , which are forms of
imagery that reference nouns resembling literal light objects in conjunction with being good
objects, and dark objects being bad objects. Interestingly enough, just how Light and Dark
imagery are polar opposites, the family feud between the Capulet and Montague family
compose of most of the conflicts in this play. However, Light and Dark imagery are also used to
convey and even exaggerates Romeo s love for Juliet, and Juliet s love for Romeo. The second
scene primarily consists of Romeo and his remarks for Juliet, as seen here: It is the east, and Juliet
is the sun/Arise, fair sun, and kill the moon(2.2.4 5) It is evident that this quotation by Romeo has
examples of both light and dark imagery. Romeo metaphorically compares the sun and moon to
Juliet and Rosaline,... Show more content on Helpwriting.net ...
Such a moral would teach the audience that the love in two being s relationship is paramount, and
authority should have no jurisdiction on their love. Metaphorically speaking, in the real world,
relationships seem to be controlled less by the two individuals, and more by the, (possibly),
disapproving parents, who do not approve of their choices. In essence, Shakespeare emphasizes that
love is, and should be, the couple s own mentality in terms of why they love each other, and nothing
... Get more on HelpWriting.net ...
32. The Literary Aspects Of Science Fiction And Detective Fiction
The literary genres of science fiction and detective fiction offer differing approaches when
addressing a contextual fear of the unknown, as the former poses the question of what if? rather
than answering these fears as the latter does. Exemplars of this include Ray Bradbury s A Sound
of Thunder and Conan Doyle s The Adventures of the Dancing Men as their societal context
necessitated a narrative to address the notion of foreign. These short stories employ various
conventions as they both alleviate and build upon the public s fearthrough notions such as justice,
help and control.
Both science and detective fiction possess inherent conventions that allow them to contextually
address society s fear of foreignness contrarily. Science fiction, as a genre, asks what if? , providing
alternative possibilities of reality, a concept emphatically prevalent in time travel. The fantastic
elements of time travel are considered in direct contrast to known reality (Burton 106) in order to
address contextual fears by asking, rather than answering, the question of what if? . This ability to
view and change the past and future thus encourages the genre to address contextual fears by
providing alternatives to reality (NГ Fhlainn 180). Detective fiction takes the opposite approach
however, as its inherent desire to solve consequently requires answering society s fears. This genre
provides a process of question and answer in regards to addressing fears and ultimately engages in a
... Get more on HelpWriting.net ...
33. Hipster Research Paper
Meet Josh. Josh is a 30 year old artist/chef who resides in a transformed stockroom in Hackney,
east Greater london. Josh has a beard, glasses and appreciates the provenance of his coffee. He
pays his tax, does not have a 9 to 5 job and also, along with his 5 polymathic roommates, avoids
public transportation, preferring to use a bike. On paper, Josh is the stereotypical hipster just don
t call him one: I do not dislike the word hipster, and also I don t hate hipsters, yet being a hipster
doesn t suggest anything any more. So God forbid anybody calls me one. . Eventually in the last
couple of years, the hipster transformed. Or at the very least its meaning did. What was when an
umbrella term for a counter culture people of young innovative... Show more content on
Helpwriting.net ...
While the meaning of hipster hasn t changed significantly over the years, there was a time when
it was considered to be something both meaningful and particular. The word was created in the
1940s to specify a person who rejected social norms such as middle class white individuals who
listened to jazz. Then came a responsive literary subculture, understood via the work of beatniks
such as Jack Kerouac and William Burroughs. It was Norman Mailer which attempted to define
hipsters in his essay The White Negro as postwar American white generation of rebels, disillusioned
by battle, which decided to divorce oneself from society, to exist without roots, to set out on that
undiscovered trip into the rebellious imperatives of the self . A decade later on, we had the counter
culture movement hippies that lugged their lantern in a relatively obvious manner, divorced from
the mainstream. The word mainly disappeared until the 1990s, when it was redefined so about
explain middle class youths with an interest in the
... Get more on HelpWriting.net ...
34. The United States Of America Website
In assignment one, I choose to explore the United States of America website. The website is divided
into seven sections including: government agencies and elected officials, health, housing and
community, jobs and unemployment, money and shopping, travel and immigration, and more
services. Government services and information are found by topic in the center of the website. The
amazing part is we can contact U.S government agencies and elected officials like the president,
U.S Senators, U.S. Representative, federal agencies, governor, state legislators, state agencies,
local, and tribal. At the bottom of the website, it shows USA.gov s contact information and the
basic information, and their social media pages like Facebook, Twitter,... Show more content on
Helpwriting.net ...
According to the website information, the constitution of the United States divides the federal
government into three branches to make sure no individual or group gains too much control (
United States America, n.d). United States in total has 100 senators in Senate and 435 elected
representatives in the House of Representatives agencies to support to Congress. The president, vice
president, and the cabinet are what hold the executive branch and their key roles are carrying out
and enforcing laws. The judicial branch has interpreted the meaning of the laws, applies laws to
individual cases, and decides if laws violate the Constitution, as described in the website ( United
States America, n.d). The Supreme Court and other federal courts are part of the judicial branch.
Benefits, consumer products and safety, government officials, health, military and veterans, travel
and transportation, children and education, fraud, law enforcement, and crime, government social
media and mobile apps, home, community and work, and money and business can all be found in
the contact government section page. In the health page, it explains the information about blood
and organ donations, child care and related issues, doctors and medical facilities, food and nutrition,
health insurance, health issues, medications, and vaccines and immunizations. To qualify for the
medical health insurance, your annual or monthly income have to be under the certain number
decided by
... Get more on HelpWriting.net ...
35. paul hoang answers
Paul Hoang and IBID Press
1
Business Management Answer Book
Important message from the author
Dear Colleagues,
Thank you for purchasing my textbook and for the encouraging words that many of you have
passed on from around the world.
In the final installment, I have put together answers/solutions to all 217 case studies. I hope you
will find these solutions as a useful starting point. As with all B M mark schemes, the solutions in
this Answer
Book should be used with caution and flexibility. Students who take an alternative approach to the
suggested solutions should still be credited where appropriate; teachers should use their
professional judgment in such cases.
Since the Answer Book is 178 pages long, ... Show more content on Helpwriting.net ...
[1 2 marks]
The answer is vague and/or descriptive. There may be no distinction made between the influences
on training and recruitment.
Paul Hoang and IBID Press
3
c)
Definition of conflict should be given. The possible solutions will depend on the cause(s) of
conflict within the department. For instance:
Poor communication channels lead to misunderstandings; look into improving communications
within the department, e.g. regular team briefings.
Lack of promotional opportunities; perhaps investigate the possibility of delegating responsibility
to allow subordinates to gain valuable experiences.
Given the culture, the new HOD might be expected to be more democratic in his/her approach to
conflict management, e.g. perhaps by using forms of empowerment.
36. Conflict may also arise if the Principal uses external recruitment to appoint the new HOD.
Any conflict between subordinates will most likely to be dealt with by the HOD, i.e. conflict is
resolved within the department.
The new HOD will therefore need to have good interpersonal and communications skills. S/he may
also need to develop situational management styles with clear goals and objectives for the
Department.
[5 6 marks]
There is a thorough examination of the various ways in which different sources of conflict can be
handled by the Head of Department. Appropriate terms are used with good application.
[3 4 marks]
The examination
... Get more on HelpWriting.net ...
37. Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
content on Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)
... Get more on HelpWriting.net ...
38. Abraham Lincoln Research Paper Thesis
Undoubtedly, Abraham Lincoln is among the most celebrated figure in American history. Lincoln
reshaped the United States for the lasting benefit of all Americans. Lincoln began his civil career
as a lawyer and later becoming a member of the United States and Illinois House of Representatives
and soon after the President of the United States. I respect Abraham Lincoln, the sixteenth President
of the United States, for his dedication, courage, and leadership. Abraham Lincoln had a humble
beginning. He was born in a small cabin in Kentucky and worked on his father s farm. Through
Lincoln s determination and dedication, he continued his studies beyond his minor education.
Largely self educated Lincoln studied to become a lawyer. Lincoln
... Get more on HelpWriting.net ...
39. The Problem Of Cyber Crime
Introduction
Qualified candidates are limited since, for those investigating or examining cyber crime must be
highly trained specialists, requiring detective and technical skills, including knowledge of various
IT hardware and software, and forensic tools. Nevertheless, in the modern world computer or
computer related crime makes up a great amount of percentage of all the crimes happiness which is
bound to increase. The Office for Victim Assistance ensures that victims of crimes investigated by
the FBI are presented the opportunity to receive the services and notification as required by federal
law guidelines
Issues law enforcement must deal with regarding digital crime and terrorism.
The number of police agencies with advanced or computer crime unit has increased extensively
over the last several years, but the majority of these agencies serve large urban populations (Wolf,
2009). Also, prosecutors and judges are turning out to be well versed in computer crime and the
unique law and vagaries inherent in these cases. Thus, it has been unclear how well the state and
local law enforcement agencies are equipped to handle these offenses.
For instance, a study of forensic examiners found that they are frequently overworked and
experience stress related to their work. Actually, for those who were interviewed, half of them felt
that they did not have the workforce to complete their tasks at work (Wolf, 2009). In addition,
assessors recognize that they need greater training
... Get more on HelpWriting.net ...
40. Pit Bull Terrier Case Study
There is an American Pit Bull Terrier right now on the police force in New York, it is the first
American Pit Bull Terrier to be on the police force in New York. A male named Brad Croft had
been introduced to and abandoned shelter in Texas, and there he seen a group of puppies and
one of the puppies that he had seen caught his eye. The puppy had an injury to the skull and they
were surprised that the dog had lived. Also, the dog did not seem to show any aggression
towards humans whatsoever. Croft took the dog to UniversalK9 where he and the dog received
training to become a successful K 9 Unit. Croft said, At first, Kiah was hard to train. She didn t
understand what she was supposed to do. But soon it was clear to Croft: She was a fast learner. ...
Show more content on Helpwriting.net ...
This paper informed the society about the American Pit Bull Terrier being good service dogs for
veterans with PTSD. They are good service dogs because they simply share an emotional neglect
from society because they are misunderstood and society will not try to actually figure out their
problems and learning them. PTSD is a mental health problem that can affect all people at any
given moment. PTSD stand for Post Traumatic Stress Disorder. Dog as well can have PTSD. A
dogs PTSD is called C PTSD. Lastly, the veteran and the American PitbullTerrier benefit one
another. One way the dog helps the veteran is by helping keep them calm when they are having
one of their moments. The way the veteran helps that dog is by showing the dog that they do not
have a reason to fear humans anymore and that all humans are not bad like how their previous
owner may have been. They both benefit each other by loving each other and being there
... Get more on HelpWriting.net ...
41. Social Tensions In Remember The Titans
The setting for the movie Remember the Titans is post April of 1971 significant because that is
when the United States Supreme Court issued a ruling that ended all state imposed segregation
in public schools. T. C. Williams High School located in Alexander Virginia was integrated, but
is now desegregated, and the film starring Denzel Washington as head football coach deals with
these cultural and social tensions. He s an African American who is replacing a previously white
coach. Now, social tensions in America when it comes to race are not perfect today; racism still
exists but we have come a long way. The film Remember the Titans was made in the year 2000.
This film, more than any other for my generation, gives us a sense of how we got to where we are
today, and I m going to discuss... Show more content on Helpwriting.net ...
First, the diner not wanting to serve blacks. Was this happening in 2000? Not quite. However, it
could have happened in isolated incidents, and in fact a misunderstanding happened at a Chili s
this week in which an African American veteran was denied food and given a hard time by an
apparent racist in a Trump tee shirt . In other news, people have been denied services for being
gay. In the film, we saw a blond, long haired white guy given a hard time for being gay. During
the 1970s, gay men and lesbians tried to gain equality and argued that since minorities were
gaining equal treatment they should as well. Sex between two people of the same sex was illegal
in almost every state at this time. The film creates fights before our eyes where these situations are
played out, but the ultimate conclusion is mutual respect. Sometimes we have to test ourselves,
and express ourselves; if we watch it play out on film, does it save us those steps, and allow us to
skip to the point where we can see right from wrong and have that mutual respect? The differences
are pointed out, and then mutually
... Get more on HelpWriting.net ...
42. College Education In College
College is a place where most go to further their education. A high school diploma will not get
students by in life anymore. While college is said to be considered the best time of your life , it
has many downfalls, the price. This leads to a high number of student debt and student loans. It is
estimated that the average outstanding student loan balance per debtor is $30,000. A college
educationwas not always this expensive however. Loans were originally only offered to Harvard
alumni in the 1840 s. It was not until the twentieth century that the problems of student loans
arose. In 1944 the GI Bill was introduced which fulfilled the need for more affordable education.
It subsidized or completely covered the cost of college education for nearly half of WW2 veterans.
By the 1990 s student loan debtbegan to change, and not for the better. In 1993, the average debt
of a bachelor s degree was approximately $9,000. So, when the question of a free college
education is proposed many jump and say yes but looking at it through a rational lens, it would not
be the best decision.
When applying to colleges, the first thing that should be considered is the price. Location and
other details should be important too but the main questions that every student should ask them
self is Can I afford this? or How will I pay it off? When students choose a college, we are fully
aware of the cost. It is not as if we choose a college we are in love with, get accepted and then later
be shocked
... Get more on HelpWriting.net ...
43. Parent-Child Relationships In No-No Boy
In novel No No Boy, Japanese American writer, John Okada, tells a story centered around the life
of a young Japanese American boy named Ichiro Yamada who was seen and treated as a No No
boy during/after World War II. After Japan s attack on Pearl Harbor, the United States government
ordered the mandatory relocation of people with Japanese ancestry regardless of their citizenships
and incarcerated them in internment camps. In internment camps, Japanese Americans who refused
to sign the Loyalty Oath and refused to serve in the U.S. Army were defined as No No s, and would
be sent to prison. The novel discussed the continuous struggle of Japanese American community in
the racially alienated American society during that time period... Show more content on
Helpwriting.net ...
and had little to none affection for Japan. To Ichiro, the U.S. was his homeland, and he should be
loyal to the U.S. by joining the military. This generational gap between two different immigrant
generations, Ichiro and his paranoid and controlling mother, already had the potential to create
conflicts; yet the war between Japan and the U.S. intensified the tension. To Ichiro, being a No
No Boy caused by his mother s powerful influence was destructive to him. His decision was
against his will; and this decision not only destroyed his future by sending him to jail for two
years, but also made him no longer a true American citizen which he used to identify himself to,
because he betrayed his country. However, Ichiro was not a true Japanese either, since Japan was
foreign to him in the first place. Thus, Ichiro was neither a true American nor a true Japanese; both
side rejected him. Failed to gain back his bright future and seek for belonging and acceptance,
Ichiro was constantly in confusion and rage. And this could be seen throughout Ichiro s character
development as he never felt peaceful or relieved, and he kept regretting about his decisions, kept
questioning his self identity and self worth, kept punishing himself by rejecting any possible
opportunities which might provide him a better future... not until his mother passed away. The
quote from Ichiro s mother revealed one of the major sources that caused Ichiro s
... Get more on HelpWriting.net ...
44. Gender Roles And The Media
In the 21st century, we see women in the media have many roles that men have, such as, police
officer, doctor and running to become president, while a nurse and teacher have emerged as both
men and women jobs. Over time, the media show how gender role had changed but are what the
media is showing the truth about the genderroles in the United States. Historian and scholar had
written about this subject of gender roles and how the media affect our view.
Thesis statement
Reality vs. Fiction Is the media giving the public a reality of how gender roles are portrayed during
a period or is it a fiction story that helps people cope with the fact of gender role during the time.
The media played an important role as people tried to deal with and interpreted the social change in
their midst.
Body
In A Thoroughbred girl image of female gender role in turn of the century media. They give the
history of women and how they should act by telling a story. Janet Mickish and Patricia Searles
article published in 1984, even though this article is over 32 year old, their viewpoint is still a
subject that is still talked about today. Mickish and Searles analyze The Ladies home Journal,
which first published in 1883, but they pick articles that issued in 1905. Patricia Searles and
Janet Mickish are not a historian, but many others have cited their work over the year. Melissa R.
Klapper books, Jewish Girl s Coming of Age in America, 1860 1920 use Mickish and Searle s
article in her
... Get more on HelpWriting.net ...
45. Five Guys
Entrepreneurial Leadership
Contemporary Business
October 27, 2013
Five Guys is a large fast food chain restaurant that stands out among the rest. They have different
philosophies that set them apart from other fast food companies. Many of the values that Five
Guys started with have made them succeeded and are still a huge factor in their success today.
After being around for seventeen years, Five Guys decided to start franchising the company, which
lead to a large success in such a short amount of time. We will also discuss the ethical and social
practices that Five Guys have that are a part of their company.
Five Guys have a few different ... Show more content on Helpwriting.net ...
When they first started they only accepted people that had the amount of money upfront to
invest because they knew banks would not help (Welch). This also allowed the franchisee and
the corporation to make a profit right away instead of having to pay a loan back. The third
reason that they were able to succeed is because they kept the business simple. They only
decorate the decor with red and white stripes. They also do not add anything else to the menu
other than burgers and fries. They do not want to decrease the quality of their food by adding
additional items to the menu, and they also want to be able to only serve fresh ingredients. For
years people have asked them to add different items to their menu like milkshakes, they feel that
they will not serve anything frozen so they would have to keep fresh milk and ice cream (Welch).
There are many different ways that Five Guys use ethical and social practices. One way is that
they do not use any advertising or beg their customers for surveys on feedback about their meal
or service. Five Guys feels that the customer is the best salesman they could have, treat that
person right, he ll walk out the door and sell for you (Welch). Another way that Five Guys use
ethical and social practices is the third party audits which keep their franchises clean, safe and that
their food is prepare correctly. These audits are one the secret shopper
... Get more on HelpWriting.net ...
46. The World s First Billionaire John D Rockefeller
The world s first billionaire John D Rockefeller was born July 8, 1839 in Richford New York. He
began his career when he built his first oil refinery near Cleveland Ohio and 1870 incorporated
the standard oil company. By the year 1822 he had monopolized the oil industry. John Davidson
Rockefeller was the second born of the six Rockefeller children born to William and Eliza
Rockefeller. William was a traveling salesman who claimed to have the ability to cure patients
with cancer and charged up to $25 per treatment, while Eliza, a devout Christian, raised their six
children at home. His mother taught strict discipline and the need to save what you earn and
donate to charity every chance you can, which left a lasting impact on John. His father also
played a major role in Rockefeller s success by teaching young Rockefeller the tricks to the trade
of a traveling salesman. Even as a child it was said that John would hustle the neighborhood by
raising turkeys, selling candies, and doing odd jobs around his home. Though the Rockefeller
men were not always known for their honesty, they were known as some of the best salesmen
around. John D Rockefeller once said It is a good thing to let my money be the servant and not
make myself slave to the money. John Rockefeller began his education in 1852 at Owego
Academy in Owego, New York, where his family relocated to in 1851. Rockefeller excelled in
mental arithmetic. He was able to solve extremely difficult equations in his head, a
... Get more on HelpWriting.net ...
47. How Does Elie Wiesel Use Of Figurative Language In Night
Figurative Language in Night
The book night by Elie Wiesel has a lot of figurative language in it; almost all of the figurative
language used has its own significance and gives you more information on how bad life was
when you were a Jew in the 1940 s. There are eighty of you in the wagon, added the German
officer. If anyone is missing. You ll all be shot, like dogs... This simile has a very big impact and
shows how the Jews were treated. The jews being compared to dogs and the Germans almost are
saying how easy it would be for them to kill all of them if anyone is missing. This creates such a
big impact because the inhumane treatment from this point on just snowballed continuing to get
worse. The next piece of figurative language is personification; ... Show more content on
Helpwriting.net ...
There was nothing else to say. your words can t actually choke you and paralyze your lips but the
feeling of being so scared can also with such a dry throat trying to speak practically felt impossible.
I believe that Elie Wiesel used this in the book to show how when your that scared and your
throats that dry you cant speak, words are almost impossible to form and your lips feel like they
cant move to make what you re saying eligible. A prolonged whistle pierced the air. also
personification just gives a vivid description of how loud and drawn out that whistle was. Elie
Wiesel used this to show that in the midst of everything when that whistle blew it was long and
loud that it got everyone s attention. You could also bring this back to the first piece of figurative
language and say how they would be shot like dogs, they are also treated like dogs controlled by
whistles. The last piece of figurative language; My heart was about to burst. There. I was face to
face with the Angel of Death... . This hyperbole almost makes your heart race knowing everything
that s going on, that these are what he thought were his last moments knowing he was with
... Get more on HelpWriting.net ...
48. Battle Of Stalingrad Essay
The two major fronts of the war that was always fought on was the Pacfic and European fronts.
In the European war front, Allied powers fought mercily against the core threat of the Axis
powers. This is where concentration camps were located and the Holocaust took place. Major
events took place here in this region. The Battle of Stalingrad was battle between German and
Soviet forces. This battle stopped German advance into the Soviet Union. It became one of the
bloodiest battles in history that killed two million in civilian and military. After Italy surrenders to
the Allied powers in 1943, Italy declares war on Germany. This marks the end of Hitler s and
Mussolini s partnership. It also doesn t look great for the future of the Axis powers.... Show more
content on Helpwriting.net ...
This was called the Normandy invasion. It was the largest invasion in history that sparked many
deaths and haunted survivors memories for many years. The Battle of the Bulge was a surprise
attack by the German forces. American bore the blunt of the attack and they were completely
caught off gaurd. This was the highest number of casualities for the Americans. The Germans
also surrendered to the Allies and marked the end of World War two in the European front in
1945. In the Pacific war front, this is where American got involved in the war in the first place.
Japanese forces attacked Pearl Harbor that included alot of American marine troops that were
ported there. After this attack, America declared war on Japan. The U.S. surrendered the Bataan
Penninsula on the main Philippine Island to the Japanese in 1942. The American and Filipino
people were forced to make 65 mile walk to prison camps. This is called the Bataan Death
March. The Battle of the Coral Sea was a battle between Japanese and American forces with help
from Australia. The Japanese used their naval forces and America used air and naval forces. The
Battle of Midway was a battle between Japan and America
... Get more on HelpWriting.net ...
49. Case Study On Hearing Aid
COMPARITIVE RESEARCH STUDY OF FUNCTIONAL OUTCOMES WITH ADIP AND NON
ADIP DIGITAL HEARING AID
Introduction:
Electronic hearing aids have undergone recent technological changes.(Dillon, 2001; Valente,
2002a).Digital technology has brought to the hearing aid industry is that of digital signal
processing features such as more number of channel and band, multi memory HA(Chung, 2004a,
2004b). These features can offer advantages in many difficult listening situations, but the scientific
evidence that they produce a significant increase in the satisfaction of hearing aid users is still fairly
weak (Wong et al2003). It is also clear that modern hearing aids and fitting rationales do not
adequately address some of the most fundamental requirements of hearing aid users. Kochkin
(2002)reports that 83% of HA users would like to hear more soft sounds, and 81% find loud sounds
uncomfortable. As increase in number channels and band costmore money.Most modern hearing
aid manufacturers offer products at multiple technology levels. To a patient, a difference in
technology level often means a difference in cost. To an audiologist, a difference in technology
level may mean a difference in patient outcome.
NEED OF STUDY:... Show more content on Helpwriting.net ...
But, the audiologist and the patient both may question the value of a greater number of channels
and bands. Ministry of social justice and empowerment India started giving digital hearing aid free
of cost for person with hearing impairment under ADIP scheme. Therefore current research study
taken up.
AIM:
To check effectiveness and compare the performance of ADIP digital hearing aids and non ADIP
digital aids.
... Get more on HelpWriting.net ...
50. Argumentative Essay On Shopping
Argument Essay
Shopping is one of the most common social activities in our life. Lingering in one store and
another, the customers are looking for the products that meet their requirements and making
decisions to purchase while enjoying the leisure time with their families or friends. At the same
time, to achieve a better business performance, the retailers try to attract the customers to pay more
attention to the products and stay longer in their stores by using various kinds of technologies to
surveil the shoppers, such as using cameras to monitor their shopping behavior, tracking their
purchased items, and even analyzing these consumers background. However, the surveillance of
consumers by retail anthropologists is manipulative and unethical ... Show more content on
Helpwriting.net ...
As Ray Burke talked about in his speech How stores track your shopping behavior / Ray Burke
/ TEDx Indianapolis , the retailers, such as the Marsh supermarkets, are analyzing the backgrounds
and the family structures of the consumers which are their personal information, which may get
them in a dangerous situation when these data are disclosed to the third parties such as someone
with nefarious purposes and the fraud companies. If these data of the information is running
without regulation and protection, it would be easy to be used by those who want to defraud the
customers. The methods used by the retail industry as an undercurrent manipulation are not only
gathering information through the check out scanner but also recording videos through cameras
as well as many other ways such as analyzing the search records of an individual who shop
online, which may provide some malicious people with the access to the personal information. As
the result, there are many people have received tons of spammers which include numerous false
advertisement due to the information leaks. On the other hand, as to those VCRs, such as the
videotape library of Paco Underhill, according to The Science of Shopping (Malcolm Gladwell),
things will turn out to be terrible if these videos resource are hacked by criminals, such as the
stalkers and the
... Get more on HelpWriting.net ...
51. Legends Of Tomorrow Research Papers
If you haven t tuned in to DC s Legends of Tomorrow just yet, you ll be in for a surprise:
Firestorm is back in the form of Martin Stein (Victor Garber) and Jax Jackson, who is played by
Attack the Block star Franz Drameh. The British actor is officially taking over half of Firestorm
after the death of Ronnie Raymond (Rob Amell), and he has just admitted that he initially
geeked out when he found out which character he was auditioning for! Drameh recently spoke to
Comic Book Resources about Legends of Tomorrow, where he admitted his love for comic books
and the secret name for the character he was reading for. I ve been a comic book fan my whole life,
so when I was auditioning, the character breakdown they gave me was Mystery Hero Michael.
So I was like, okay, Drameh shared, adding that the truth about the character dawned upon him
while reading the lines. So I had a bit of a read of it, and I was like: Stein this is Firestorm! But
there s already a Firestorm! How is this going to work? So I kind knew early on that s who I was
playing, he said.... Show more content on Helpwriting.net ...
Drameh also admitted that the discovery made him wonder what could happen in the show. I
was just so excited, he said. I was like, Are they going to do this? Is he going to have
transmutation powers? Are we going to see Fury? I was like I was so excited, and so, so happy
to be a part of the whole DC Universe. DC s Legends of Tomorrow also stars Brandon Routh,
Caity Lotz, Arthur Darvill, Wentworth Miller, Dominic Purcell, Ciara Renee, Falk Hentschel and
Casper Crump as the evil Vandal Savage. The show is currently airing on The CW every Thursday
nights, and already has one major
... Get more on HelpWriting.net ...
52. The Drilling Sites Will Be Located Near The Ogallala Aquifer
One of the things that the commission need to keep in mind while deciding will be that the drilling
sites will be located near the Ogallala Aquifer. This is one of the biggest aquifers in the world
which means polluting the aquifer could have a large impact on hundreds of people s drinking
water. The commission has assured the community that they have used better equipment to protect
the pipes so they do not leak. However, the members of the community have little to no faith after
seeing how filthy the water still is that s in the ground. However, with the new equipment the oil
company has promised to use the Nebraska residents might feel safer (Hayden). Along with dirty
water, community members all over the country have concerns that... Show more content on
Helpwriting.net ...
One of the key factors in solving the problem would be to put in place much stricter regulations
for companies to follow. If the government made companies work in a more responsible they
would have to pay more attention to where they are drilling, leading to less drilling sites in
neighborhoods or close to people s homes. The regulations on zoning could cause a chain
reaction of problem solvers, if the fracking wells start to be farther away from homes the water
that people are drinking will less likely be contaminated. For Oklahoma there are not yet
regulations on where to frack like other states. Drilling is taking place on what is called
basement rock, this is believed to be the cause of the tremblors. This is just one place where a
little change in law can be a big change for a community. Another easy solution would be
regulating the chemicals companies are allowed to use, the chemical cocktails used are
commonly filled with acids, detergents and poisons that are not regulated by federal laws.
Natalie Starkey, a writer for The Guardian, writes to explain that even areas that are not prone to
earthquakes may still experience them due to drilling. Companies have denied having any ties to
the rising number of quakes. The earthquakes that will appear will be very dangerous in most
cases. The lack of regulation can be tied back into this issue since there are no laws on where
companies can
... Get more on HelpWriting.net ...
53. Brazil s Global Energy Development Essay
Brazil is Latin America s largest renewable energy market notwithstanding flat economic growth as
its commitment to renewable energy is strong and has facilitated continuous investment in this
segment sighting that nearly 76 percent comes from renewable resources. (International Trade
Administration Sector Snapshot) To date, wind and hydropower have been the source of Brazil s
renewable energyexpansion. As it is projected that new solar energy development over the long
term will provide an encouraging investment framework and rivaling wind and hydropower with
growth occurring in almost every energy subsector.Even though large hydropower dams account
for Brazil s total energy capacity, other renewable energy technologies comprise of biomass, waste
to energy, and wind power. (International Trade Administration Brazil Country Commercial Guide,
2016) The best renewable energy prospects for Brazil is wind, hydropower, and solar. With wind
being, the largest installed capacity in Latin America and will continue to strengthen renewable
energy growth for the near future as Brazil s energy regulator has approved the construction
additional wind power because it has one of the world s strongest wind resource bases. According to
the Brazilian government s Energy Research Agency, the wind industry would need to install new
wind capacity over the next decade to meet the country s targeted wind generation capacity by
2024. (International Trade Administration Brazil
... Get more on HelpWriting.net ...
54. How Does Madeleine L Engle Use Symbols In A Wrinkle In Time
A Wrinkle in Time lives on to be a timeless classic suspense novel for young adults today. Although
school curriculums berate it for L Engle s afflictions with Christian theology; which are especially
prominent in this novel, her emotional family values, and ethical responsibilities stand out for a
bigger impact on the reader. Madeleine L Englewrites with a style that makes the reader ponder her
use behind objects, characters, and dialogue. Her subjective symbolism puts a more meaningful
reason to her story, and can discovered throughout the entire plot. Examples of symbolism surface
through physical objects such as Mrs. Who s spectacles, to emotional feelings of love and hate, and
even to general themes brought about of light triumphing... Show more content on Helpwriting.net
...
The spectacles symbolize a way of understanding and perceiving the world without instinctual
judgment. There is another part physical objects show symbolism behind them. Charles Wallace
is taken over by the control of IT, but Meg can still read the decency behind his evil behavior.
Although his actions are not at all like his normality, his blue eyes, which retained normality,
symbolize goodness and hope and let her know he is still there. L Engle uses emotional feelings
throughout the characters, not only to portray compassion for the them, but also to symbolize
deeper meaning. Meg s love to save her family has more meaning to it than her willingness. Her
love differs immensely with the emotion of IT s hate. Every time she feels hate towards IT or
others such as her father, she becomes weaker. It is her hatred that allows IT to take over her
mind. She finds out the ability to love against the forces of hate, allows her to succeed and
defeat IT. When the family reunites in the end, it is a reminder of the strong forces love has on
us that L Engle believes can strengthen and congregate society. Meg also is disturbed by the
way people are controlled on the planet of Comazotz. She notices the normality of everyone,
...there was also a sameness to them. Like the sameness of people riding in a subway, (L Engle
110) and is upset with their exactness. She later is even talking to Calvin about how he masks how
he really feels in school, in
... Get more on HelpWriting.net ...
55. Compare And Contrast Military Leadership Vs Garrison...
Combat Leadership versus Garrison Leadership
The United States of America has been in combat for over 16 years. A decade of that time spent
in a year on, year off rotation to Afghanistan or Iraq. The Soldiers would come home from the
combat deployment only to train and get ready to go again. Garrison Army life did not exist. Army
Doctrine Publication (ADP) 6 22 defines leadership as the process of influencing people by
providing purpose, direction, and motivation to accomplish the mission and improve organization.
(Department of the Army, 2012) The definition is not specific to combat or garrison leadership.
The difference in combat and garrison leadership is in the art of leadership. One is not better than
the other, they are just different. ... Show more content on Helpwriting.net ...
Noncommissioned Officers (NCOs) learned that their leadership abilities relied on getting
Soldiers across enemy roadways alive. There were Family issues and problems, complicated by
being overseas. Soldiers had a ready purpose. Soldiers knew the enemy. Soldiers and leaders
accepted and thrived because of the danger. They relished the comfort of daily routines.
Leadership includes working with civilians and enemies that look identical. It involves providing
direction to Soldiers to ensure that they are safe and do not harm innocents. Ethical challenges
occur daily during combat operations and support operations. LTC Knight writes about the
ethical challenge raised during Operation Desert Storm. The Army had access to a nearly
unlimited budget. This is like the Overseas Contingency Operations (OCO) Budget for operations
in Afghanistan and Iraq. LTC Knight advised that many ethically weak leaders were relieved for
failing to utilize that money properly. Senior leaders gave them no room to grow. (LTC Knight,
1992) The threshold of failure is nonexistent when life and death is on the line. Combat leadership
can make or break weak leaders in a short amount of
... Get more on HelpWriting.net ...
56. Of Captain Misson And His Crew By Daniel Defoe Summary
Daniel Defoe has been acknowledged as the author of A General History Of The Pyrates ,
published in 1728, throughout the centuries of the early modern period. Being pursued as Captain
Charles Johnson, the author seemingly imitates a false characterization in order to portray a
different perspective to the commentary on the life of Of Captain Misson and His Crew . Defoe
introduced this volume of fiction, among many chapters, seeking the inequality and insincerity of
the english society attributing to the commission of piracy throughout the population. He
familiarizes his passages in mostly, different narratives as he describes a quite peculiar and
distinctive acknowledgement implied to the proper intentions of a well known captain pirate. On
the contrary, most argued that piracy had different intentions on the issue of political disturbance
created within the... Show more content on Helpwriting.net ...
Rediker agues that piracy lured certain economical crimes that brought the english civilization to a
disadvantage through the violation of respected authority. Over social relations and apprehensions,
he describes the act of piracy as a distress to the community since the piratical act appointed their
crimes as terrorizing which seemingly opposed to a utopian nature. This essay will discuss both
point of views according to these specific authors while assessing the commentary of governmental
and custom issues during the act of piracy in the Early Modern Period.
Defoe introduces a particularly new statement according to the law of piracy during the 18th
century. Through the illustrations of Captain Charles Johnson, Captain Misson was emphasized
throughout the book regarding the idealization of the colony known as Libertalia. The government
on Misson s ship followed with Libertalia s territory, was mostly known to the crew as the pirate
code . This indicated that pirates would assemble their own set of rules regarding booty and also
contribute to the
... Get more on HelpWriting.net ...