This journal can be done as a stand-alone journal or in conjunction with an article.
Read an article on aligning interests with a career. For example:
“When I Grow Up: Lessons scientists would share with their younger selves”
Journal #1: What career interests you the most and why? Explain in
detail your career interest and tell why you feel that you would be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft skills will get you the job.
By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of Washington, employers said entry-level
workers in a variety of professions were lacking in several areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good follower, monitoring the progress, meeting
deadlines and working with others across the organization to achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do they fit
in with your career interest? Based on the soft skills discussed in this
article, discuss one that is a strength for you and one with which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.en/career-advice/six-soft-skills-everyone-needs-hot-jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5332344.
Own It! Take Charge of Your Career by Tuesday A. StrongTuesday Strong
Technology, globalization and the pace of change continue to be drivers for independent career management. Work environments and the way in which we work and think about work continue to change at an accelerated pace. Career management is also changing. Savvy professionals realize that they (not their employers) are responsible for their careers and professional development. Effective career management is about owning your professional development for the life of your career, not just the job you’re in. Employment trends have accelerated during the past few years. Are you ready to survive and thrive in these new times?
Five reasons why you should read OWN IT! Take Charge of Your Career:
1. You are responsible for your career, not your employer.
2. You need a rock solid professional reputation to stay employed.
3. Savvy professionals use goal setting, networking and marketing for career success.
4. You can increase your competitiveness with a minimal investment of time and money.
5. OWN IT! is filled with practical examples, templates and actionable advice.
This slide many explains about how to be ready for a job and what should be prepared before attending the interview. These might be useful for the last minute look for your interview
This eBook is a proverbial shot-in-the-arm, intended to help HR executives and recruiters understand what it takes to leverage the latest networking and online engagement tools, and get out in front of your peers. We’ll offer the “why” and “how” of employer branding in a new media environment by looking at the adaptions marketers have made in the last five years. We’ll also look at innovative recruiting strategies that use new media to attract and engage knowledge workers.
Top Ten Best Practices for Talent Acquisition ClearedJobs.Net
Kathleen Smith, CMO, ClearedJobs.Net presented at the Tidewater Techexpo Business to Government Conference on Top Ten Best Practices for Talent Acquisition. This presentation is focused on small to medium size businesses who can and should engage their business development community along with their talent acquisition community.
Own It! Take Charge of Your Career by Tuesday A. StrongTuesday Strong
Technology, globalization and the pace of change continue to be drivers for independent career management. Work environments and the way in which we work and think about work continue to change at an accelerated pace. Career management is also changing. Savvy professionals realize that they (not their employers) are responsible for their careers and professional development. Effective career management is about owning your professional development for the life of your career, not just the job you’re in. Employment trends have accelerated during the past few years. Are you ready to survive and thrive in these new times?
Five reasons why you should read OWN IT! Take Charge of Your Career:
1. You are responsible for your career, not your employer.
2. You need a rock solid professional reputation to stay employed.
3. Savvy professionals use goal setting, networking and marketing for career success.
4. You can increase your competitiveness with a minimal investment of time and money.
5. OWN IT! is filled with practical examples, templates and actionable advice.
This slide many explains about how to be ready for a job and what should be prepared before attending the interview. These might be useful for the last minute look for your interview
This eBook is a proverbial shot-in-the-arm, intended to help HR executives and recruiters understand what it takes to leverage the latest networking and online engagement tools, and get out in front of your peers. We’ll offer the “why” and “how” of employer branding in a new media environment by looking at the adaptions marketers have made in the last five years. We’ll also look at innovative recruiting strategies that use new media to attract and engage knowledge workers.
Top Ten Best Practices for Talent Acquisition ClearedJobs.Net
Kathleen Smith, CMO, ClearedJobs.Net presented at the Tidewater Techexpo Business to Government Conference on Top Ten Best Practices for Talent Acquisition. This presentation is focused on small to medium size businesses who can and should engage their business development community along with their talent acquisition community.
Access MBA Guide, the organisers of the Access MBA tours, interviewed me for the 2013 edition of their global publication for the MBA and Executive MBA students
As a nonprofit, you have a unique challenge: finding qualified candidates who care about your mission. Job postings are an essential tool for finding those professionals at scale. Check out this deck to find out how you can easily get your jobs in front of the right candidates at the right time. It covers job posting basics, as well as tips and tricks on how to get the best results.
3 things that are covered:
LinkedIn’s mission-driven talent network
Optimize your job posts to get the best candidates
Save money with nonprofit discounts
Marketing Yourself for Your Next Career Opportunity ClearedJobs.Net
Finding your next job will involved determine your brand and how to communicate this to future employers.
But there are some key steps to remembers such as what is your brand? what has your brand done over your career? How has it been communicated to past and current employers?
All of these will have an impact on your job search.
How to Hire All-Star Administrative Professionals and Maximize Their PotentialRobert Half
This hiring guide provides tips on how to find top-notch administrative professionals and help them branch out beyond their traditional job descriptions.
With the intent of bringing some creative minds, who are transforming the status quo of various sectors, into limelight, Insights Success brings to you, “Top Creative Leaders Innovating in Business 2019”
Have You Heard About "Win Win Selection" !Nicole Payne
The importance of viewing the selection and interviewing process as a basic precursor to establishing trust and positive identification with a company's objectives. Using the LIFO Method, it illustrates how shared information between a candidate and company can provide a good first step towards building a mutually rewarding relationship for future OD efforts. Contact us for more info!
At the most recent Tidewater TechExpo, we presented Top 10 Best Practices in Talent Acquisition for a large group of government contractors doing business in the Fort Belvoir area.
The LinkedIn Job Search Guide is your tactical toolkit for getting a job you love.
The LinkedIn Job Search Guide can be read one page at a time, one chapter at a time, or in entirety. The recommended tactics and tools were developed with U.S. job seekers in mind, however many of the strategies may be applied internationally.
Good luck with your job search and we hope that the following guide will put you in the driver’s seat as you develop your career.
This is the other book link.Any questions please contact via[e.docxglennf2
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docxglennf2
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
More Related Content
Similar to This journal can be done as a stand-alone journal or in .docx
Access MBA Guide, the organisers of the Access MBA tours, interviewed me for the 2013 edition of their global publication for the MBA and Executive MBA students
As a nonprofit, you have a unique challenge: finding qualified candidates who care about your mission. Job postings are an essential tool for finding those professionals at scale. Check out this deck to find out how you can easily get your jobs in front of the right candidates at the right time. It covers job posting basics, as well as tips and tricks on how to get the best results.
3 things that are covered:
LinkedIn’s mission-driven talent network
Optimize your job posts to get the best candidates
Save money with nonprofit discounts
Marketing Yourself for Your Next Career Opportunity ClearedJobs.Net
Finding your next job will involved determine your brand and how to communicate this to future employers.
But there are some key steps to remembers such as what is your brand? what has your brand done over your career? How has it been communicated to past and current employers?
All of these will have an impact on your job search.
How to Hire All-Star Administrative Professionals and Maximize Their PotentialRobert Half
This hiring guide provides tips on how to find top-notch administrative professionals and help them branch out beyond their traditional job descriptions.
With the intent of bringing some creative minds, who are transforming the status quo of various sectors, into limelight, Insights Success brings to you, “Top Creative Leaders Innovating in Business 2019”
Have You Heard About "Win Win Selection" !Nicole Payne
The importance of viewing the selection and interviewing process as a basic precursor to establishing trust and positive identification with a company's objectives. Using the LIFO Method, it illustrates how shared information between a candidate and company can provide a good first step towards building a mutually rewarding relationship for future OD efforts. Contact us for more info!
At the most recent Tidewater TechExpo, we presented Top 10 Best Practices in Talent Acquisition for a large group of government contractors doing business in the Fort Belvoir area.
The LinkedIn Job Search Guide is your tactical toolkit for getting a job you love.
The LinkedIn Job Search Guide can be read one page at a time, one chapter at a time, or in entirety. The recommended tactics and tools were developed with U.S. job seekers in mind, however many of the strategies may be applied internationally.
Good luck with your job search and we hope that the following guide will put you in the driver’s seat as you develop your career.
Similar to This journal can be done as a stand-alone journal or in .docx (20)
This is the other book link.Any questions please contact via[e.docxglennf2
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docxglennf2
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docxglennf2
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docxglennf2
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docxglennf2
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docxglennf2
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
this is the second (of five)Critical Thinking Postsfor the c.docxglennf2
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docxglennf2
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docxglennf2
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docxglennf2
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
this journal have to talk about Movie the name of the movie is (Agur.docxglennf2
this journal have to talk about Movie the name of the movie is (Agurre, The Wrath 1972) dir. Werner Herzog
in this critical l journal u just have to talk about the Understated or subversive stylization
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This journal assignment is a formative assignment for the current .docxglennf2
This journal assignment is a formative assignment for the current module. The assignment requires that you prepare ONE 200-250-word statement in paragraph form to present a snapshot of:
· your point of view (POV) about the module topic (identify this before turning to the assigned reading)
· key evidence and themes pertaining to the module topic that stands out to you upon completing the assigned reading (include endnotes to cite the information you are extracting from the reading)
· a concluding comment and/or question that captures an aspect of your POV after reading the assigned chapter.
The module topic is Regionalism and Internationalism
!"#$%&'(")&*&+,+-"./,"01,2%"3'4"5$4&66,$("7(%,84$%&'(
!1%/'492:-";<"=$4*&(";&>>
?'[email protected],-"A$%&("!B,4&@$("C,2,[email protected]/"C,*&,DE"F'><"GHE"#'<"G"9IJJI:E"KK<"LMLN
O16>&2/,+"6P-"./,"A$%&("!B,4&@$("?%1+&,2"!22'@&$%&'(
?%$6>,"QCA-"http://www.jstor.org/stable/2503626
[email protected]@,22,+-"RSTIRTGRRJ"RS-RU
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless
you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you
may use content in the JSTOR archive only for your personal, non-commercial use.
Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at
http://www.jstor.org/action/showPublisher?publisherCode=lamer.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed
page of such transmission.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected]
The Latin American Studies Association is collaborating with JSTOR to digitize, preserve and extend access to
Latin American Research Review.
http://www.jstor.org
http://www.jstor.org/stable/2503626?origin=JSTOR-pdf
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/action/showPublisher?publisherCode=lamer
A NATION DIVIDED:
The Quest for Caribbean Integration
W. Marvin Will
University of Tulsa
Recognizing that the traditional five-state subregion of Central
America departed from European colonialism as a federated entity, Ralph
Lee Woodward subtitled his seminal history of Central America "A Nation
Divided." In his view, "the social and economic history of the isthmus
suggests that its peoples share considerably in their problems and circum-
stances, even though their political experience has been diverse. But it is
also clear that their so.
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docxglennf2
'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion)
The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency
Solution
s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic.
The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020).
.
This is to be a 500 word discussion on the following Healthy people.docxglennf2
This is to be a 500 word discussion on the following: Healthy people 2020 is a guide to promote preventative care. Review Primary, Secondary and Tertiary prevention and relate this to women and children at risk in your community. Identify those risk factors that a prevention program could impact the health of the group you identify. Include citations and use APA format. The 500 words does not include the citations.
.
This is your fourth vocabulary quiz It consists of the vocabulary .docxglennf2
This is your fourth vocabulary quiz: It consists of the vocabulary you learned from Lesson B in Unit 2.
Authorities
Initiate
Sustainable
Contrary to
Controversy
Undeniable
Neglect
Predator
Prey on
Upkeep
You will write your own sentences using each of the vocabulary words. The sentence
must be an
original sentence
created by you, AND it must use the vocabulary word correctly.
Your sentence
MUST
demonstrate that you understand the meaning of the word.
.
This is your final response essay. Sorry these last units could not .docxglennf2
This is your final response essay. Sorry these last units could not be overlapped with in-class discussion. Hopefully Fall 2021 we will be back to normal! This final response essay will be due DECEMBER 6 which is an extended deadline. How does Do the Right Thing and Daughters of the Dust balance carefully and deliberate filmmaking with delivering clear messages about social justice? Sometimes when a film tries too hard for a message, the craft of filmmaking might get overlooked. Compare and contrast how these two films do/do not do that with some clear examples of a moral message either reinforcing or compromising the scene/filmmaking.
.
This is will a summary you cant not have more than 200 words. Pleas.docxglennf2
This is will a summary you can't not have more than 200 words. Please no plagiarism. You can have one or two quotes. Make sure have a topic sentence, answer what, how, why, in what way, who, How does (he/she) know, and so what. Also use the last story, there is three and use the last one about "Don't take notes with a laptop"
.
This is the text info pg 239 and 240 that the attached instructions .docxglennf2
This is the text info pg 239 and 240 that the attached instructions talking about.
Chin, J. L. & Trimble, J. E. (2015).
Diversity and leadership.
Los Angeles, CA: Sage.
The Three Cs of Managing Diversity: Composition-Core-Climate Managing organizational diversity starts with developing an organization’s strategic planning to be inclusive of diversity and directed toward organizational and systemic change. It presumes a commitment to goals of diversity leadership. It makes the business case for training to move leaders and members toward a goal where diversity means good business; it brings in customers, expands the customer base, promotes a climate where all voices are included, and strives toward a workforce composition that is diverse and delivers its products or services in a culturally competent manner. The senior author has defined this to mean addressing the Three Cs of Diversity: recruiting and retaining a diverse Composition of the workforce and clientele, developing the Core of business products and services to be delivered in a culturally competent manner, and promoting a welcoming and inclusive workplace Climate within the organization. Moodian (2009) views contemporary leadership and leadership success as attainable through intercultural competence and stresses the importance of moving away from ethnocentric leadership philosophies given the growing dominance of diverse workforces and greater racial/ethnic heterogeneity of populations in countries throughout the world today. He suggests a strategic planning process or business plan that is inclusive of diversity and offers seven steps toward managing diversity for organizational change. “The business case is about capturing talent, understanding markets, utilizing diverse perspectives for innovation, knowing how and how not to pitch products, and ultimately, how to generate employee commitment” (Moodian, 2009, p. 39). The seven steps include the following: Generating Executive Commitment—Nothing happens in an organization without buy-in from the top. Diversity needs to be a goal embraced by leaders within an organization and starts with a visioning process. Assessment—This process helps the organization understand its current state regarding diversity. This essentially means doing a SWOT analysis of the Three Cs; this might include assessing composition of the workforce and its clientele, assessing policies and procedures that might pose internal barriers for hiring and promotion, assessing climate of the organization for inclusion and respect for all dimensions of diversity, and marketing strategies and business goals that are inclusive of diversity. This helps identify needs, set priorities, and to define goals and objectives for a strategic plan that is inclusive of diversity and provides data to serve as benchmarks. Diversity Council—The establishment of such councils provides a formal mechanism within the organization that serves the purpose of getting feedback to and f.
This is what I need, nothing more or less-All Is removed in th.docxglennf2
This is what I need, nothing more or less:
-All I's removed in the WHOLE essay (Which I will send) --needs to be in 3rd party narrative--not 1st
- fragmented/run-on sentences, incomplete sentences, UNPROFESSIONAL sentences re-structured
-Format is CORRECT (CHICAGO STYLE). Do NOT change this.
.
This is where you start actually writing. Section 1, as we have d.docxglennf2
This is where you start actually writing. Section 1, as we have discussed is about demonstrating your knowledge of core principles, concepts and theories in your field. Key words in that statement are "demonstrate"......ok, there's only one! :) The most common mistake in this section is that you discuss but do not demonstrate.
Another key to this sentence: Notice that there is nothing in there about classes. We do not want class descriptions - we can look those up in the catalog. We do not want lists of projects you had to do in each class. Focus on the core skills, principles, concepts.....In Graphics class, for example, what is one of the theories you MUST know? Talk about - and then demonstrate that you know it. Tell the story of that concept. Be brief, be specific, then add an example to demonstrate. A chart, a graph, a picture....You may use links as long as you discuss the concept and lead people to the link.
This entire section is maybe 1 1/2 to 2 pages of writing. You will add pictures, charts, graphs, etc.
Finally one more thing to focus on: Writing. Grammar. English...this is a technical paper that might represent you and OSU in the industry. Watch your grammar!
Skeleton Outline Format
Thesis/Central Idea
I. Attention: A sentence summarizing your attention-getting strategy
Transition
II. Main Point 1 (A sentence summarizing the point. This might be the need if you’re doing Monroe’s Motivated Sequence or the problem if you’re doing problem cause solution, the standard of judgment if you’re doing value, etc.).
A. A sentence or two indicating what you want to say/do in this point. Do you want to establish how big/serious this problem is? Show the harms or negative effects? Use one type of evidence or support? Define and explain the issue?
Transition
III. Main Point 2 (A sentence summarizing the point you want to make here. It might be Satisfaction if doing MMS, Cause if doing problem cause solution, etc)
A. Sentence or two indicating what you want to say/do here. Are you going to use a different type of evidence to make your point? Show us why a problem is happening? Prove that your plan/solution can work?
Transition
IV. Main Point 3 (if needed--most speeches will do 3 main points, but it’s possible to have a speech work with just two big ones). This might be solution, visualization, etc.
A. Sentence or two indicating what you want to do here. Do you want to prove how this plan solve the problem, explain how to fix the issue? Show why one solution is better than another?
Transition
V. Conclusion: A sentence indicating what you want to do in the conclusion.
Research on Hand/Research Wanted
Here you should fill out what research/evidence (if any) you already have and what kinds of evidence/research you would still want. Do you want, for example statistics or studies showing the scope of a problem? Expert testimony to explain why something is happening? Examples to help illustrate a complex idea?
.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
The Indian economy is classified into different sectors to simplify the analysis and understanding of economic activities. For Class 10, it's essential to grasp the sectors of the Indian economy, understand their characteristics, and recognize their importance. This guide will provide detailed notes on the Sectors of the Indian Economy Class 10, using specific long-tail keywords to enhance comprehension.
For more information, visit-www.vavaclasses.com
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
We all have good and bad thoughts from time to time and situation to situation. We are bombarded daily with spiraling thoughts(both negative and positive) creating all-consuming feel , making us difficult to manage with associated suffering. Good thoughts are like our Mob Signal (Positive thought) amidst noise(negative thought) in the atmosphere. Negative thoughts like noise outweigh positive thoughts. These thoughts often create unwanted confusion, trouble, stress and frustration in our mind as well as chaos in our physical world. Negative thoughts are also known as “distorted thinking”.
This journal can be done as a stand-alone journal or in .docx
1. This journal can be done as a stand-alone journal or in
conjunction with an article.
Read an article on aligning interests with a career. For
example:
younger selves”
Journal #1: What career interests you the most and why?
Explain in
detail your career interest and tell why you feel that you would
be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft
skills will get you the job.
2. By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of
Washington, employers said entry-level
workers in a variety of professions were lacking in several
areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job
descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an
interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It
does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a
presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can
effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good
3. follower, monitoring the progress, meeting
deadlines and working with others across the organization to
achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to
demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To
succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and
stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover
letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview
question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of
specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do
they fit
in with your career interest? Based on the soft skills discussed
in this
4. article, discuss one that is a strength for you and one with
which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.e
n/career-advice/six-soft-skills-everyone-needs-hot-
jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5
33234414478542f?x
business problem or participated in the solution. Be able to
explain what you did, how you approached the
problem, how you involved others and what the outcome was—
in real, measurable results."
Critical observation
It's not enough to be able to collect data and manipulate it. You
must also be able to analyze and interpret it.
What story does the data tell? What questions are raised? Are
there different ways to interpret the data?
"Instead of handing your boss a spreadsheet, give them a
business summary and highlight the key areas for
attention, and suggest possible next steps," Sarikas advises.
Conflict resolution
The ability to persuade, negotiate and resolve conflicts is
crucial if you plan to move up. "You need to have the
5. skill to develop mutually beneficial relationships in the
organization so you can influence and persuade
people," Sarikas says. "You need to be able to negotiate win-
win solutions to serve the best interests of the
company and the individuals involved."
When it comes to soft skills, show—don't tell
How do you prove you're proficient at, say, critical
observation? Demonstrating these soft skills may be more
difficult than listing concrete accomplishments like $2 million
in sales or a professional certification. But it is
possible to persuade hiring managers that you have what they
need.
To demonstrate communication skills, for example, start with
the obvious. Make sure there are no typos in your
resume or cover letter. Beyond that, enhance your
communication credibility by writing an accomplishment
statement on your resume or cover letter, says Cheryl E. Palmer,
president of Call to Career. "Instead of
stating, 'great oral and written communication skills,' say,
'conducted presentation for C-level executives that
persuaded them to open a new line of business that became
profitable within eight months.'"
Learn soft skills
6. The good news is that, like any skill, soft skills can be learned.
The better news? Boosting your soft skills not
only gives you a leg up on a new job or a promotion, but these
skills also have obvious applications in all areas
of a person's life, both professional and personal.
areas such as effective written and
verbal communication, teamwork, cultural understanding and
psychology. Take a writing or
public speaking course to boost your communication skills.
Look for a conflict-resolution
course or "leadership skills" class at your local community
college.
r target
skill, and when you're approaching
a potential mentor, compliment that person with a specific
example in which you've seen him
practice that skill, advises Ed Muzio, the author of Make Work
Great. "Then ask whether that
person would be willing to share ideas with you about how you
might achieve the same level
of capability," he says. "Maybe it will grow into a long
mentoring relationship, or maybe you'll
just pick the person's brain for a few minutes."
7. fit organizations gives you
the opportunity to build soft skills.
And listing high-profile volunteer work on your resume gives
you an excuse to point out what
you gained there. For example, "As chair of the environmental
committee, planned and
carried out a citywide park cleanup campaign. Utilized team-
building, decision-making and
cooperative skills. Extensive report writing and public speaking.
Retrieved 25 January 2016 from http://career-
advice.monster.com/career-development/getting-promoted/six-
soft-skills-everyone-needs-
hot-jobs/article.aspx
http://career-advice.monster.com/career-development/getting-
promoted/six-soft-skills-everyone-needs-hot-jobs/article.aspx
http://career-advice.monster.com/career-development/getting-
promoted/six-soft-skills-everyone-needs-hot-jobs/article.aspx
8. APR 16, 2013
How Social Media Can Help (Or Hurt) You In Your Job Search
Social media is a key player in the job search process today.
Sites like Facebook, Twitter, LinkedIn, and Google+ allow
employers to get a glimpse of who you are outside
the confines of a résumé, cover letter, or interview—while they
offer job seekers the opportunity to learn about
companies they’re interested in; connect with current and
former employees; and hear about job openings
instantaneously, among other things.
That’s probably why half of all job seekers are active on social
networking sites on a daily basis, and more than
a third of all employers utilize these sites in their hiring
process.
Career transition and talent development consulting firm Lee
Hecht Harrison asked hundreds of job seekers
via an online poll, “How active are you on social networking
sites?” Forty-eight percent said they’re very active
on a daily basis, while 19% said they log on about two or three
times per week. Another 22% said they use
social networking sites one to three times per month, or less.
Only 11% of job seekers said they never use
social networking websites.
9. “I was really excited to see how many job seekers are active on
social media,” says Helene Cavalli, vice
president of marketing at Lee Hecht Harrison. “As strong
advocates, we spend a lot of time coaching job
seekers on how to develop a solid social media strategy. While
it isn’t the only strategy for finding a job, it’s
becoming increasingly important.”
Greg Simpson, a senior vice president at Lee Hecht Harrison,
said in a press statement that job seekers must
understand how hiring managers and recruiters are using social
media in all phases of the selection process.
To help job seekers better understand the role of social media in
their job search, CareerBuilder.comconducted
a survey last year that asked 2,303 hiring managers and human
resource professionals if, how, and why they
incorporate social media into their hiring process.
First they found that 37% of employers use social networks to
screen potential job candidates. That means
about two in five companies browse your social media profiles
to evaluate your character and personality–and
some even base their hiring decision on what they find.
“Social media is a primary vehicle of communication today, and
because much of that communication is public,
10. it’s no surprise some recruiters and hiring managers are tuning
in,” says Rosemary Haefner, vice president of
human resources at CareerBuilder.
Journal #3: What is the most interesting thing I have learned
through
my career research? How does the information in this article
relate to
my future career?
http://www.careerbuilder.com/?cbRecursionCnt=1
CareerBuilder also asked employers why they use social
networks to research candidates, and 65% said they
do it to see if the job seeker presents himself or herself
professionally. About half (51%) want to know if the
candidate is a good fit for the company culture, and another
45% want to learn more about his or her
qualifications. Some cited “to see if the candidate is well-
rounded” and “to look for reasons not to hire the
candidate,” as their motives.
So, if you’re among the 89% of job seekers that use social
networking sites (daily, sometimes, or rarely), you’ll
want to be careful.
11. A third (34%) of employers who scan social media profiles said
they have found content that has caused them
not to hire the candidate. About half of those employers said
they didn’t offer a job candidate the position
because of provocative or inappropriate photos and information
posted on his or her profile; while 45% said
they chose not to hire someone because of evidence of drinking
and/or drug use on his or her social profiles.
Other reasons they decided not to offer the job: the candidate’s
profile displayed poor communication skills, he
or she bad mouthed previous employers, made discriminatory
comments related to race, gender, or religion, or
lied about qualifications.
(Haefner says no matter what information is found on a
candidate, and regardless of where it’s found, the
process has to abide by fair and equal hiring practices.)
“If you choose to share content publicly on social media, make
sure it’s working to your advantage,” Haefner
says. “Take down or secure anything that could potentially be
viewed by an employer as unprofessional and
share content that highlights your accomplishments and
qualifications in a positive way.”
Brad Schepp, co-author of How To Find A Job On LinkedIn,
Facebook, Twitter and Google+, adds:“Make sure
12. any profiles you write are free of typos, the information is
coherent and applicable to your industry [or job
you’re trying to land], and your photos present you in a
favorable light. You can verify the applicability of the
information by checking profiles of others in the same field.”
The information you provide online about your job background
and accomplishments should also be
consistent, he says. “Don’t assume an employer will only be
checking you out on LinkedIn. They may also
check Facebook, or even Twitter and Google+. The story you
tell on each site should be pretty much the
same, although it’s fine to adapt the material for the site.”
The good news is that hiring managers aren’t just screening
your social media profiles to dig up dirt; they’re
also looking for information that could possibly give you an
advantage. The CareerBuilder survey revealed that
29% of surveyed hiring managers found something positive on a
profile that drove them to offer the candidate
a job.
In some cases it was that the employer got a good feel for the
candidate’s personality. Others chose to hire
because the profile conveyed a professional image. In some
instances it was because background information
13. supported professional qualifications, other people posted great
references about the candidate, or because
the profile showed that the job seeker is creative, well-rounded,
or has great communication skills.
This means the job seekers shouldn’t just focus on hiding or
removing inappropriate content; they should work
on building strong social networks and creating online profiles
that do a really good job of representing their
skills and experience in the workplace, Simpson said in a press
statement. “Job seekers who are silent or
invisible online may be at a disadvantage. They need to engage
on social networking sites to increase their
visibility and searchability with prospective employers,” he
said.
Cavalli agrees. “It’s not enough to only post a profile and check
your news feed. There are a lot of lurkers–
people who have an online profile but don’t do anything or
engage in any meaningful way. You need to give to
the social networking communities, participate in group
discussions, share expertise, point someone to an
article. You have to work it. While it can feel uncomfortable
putting yourself out there, if you’re looking for a job,
14. it’s not the time to be timid.”
Retrieved 25 January2016 from
http://www.forbes.com/sites/jacquelynsmith/2013/04/16/how-
social-media-can-help-or-hurt-your-job-
search/#252b305a24fd
http://www.forbes.com/sites/jacquelynsmith/2013/04/16/how-
social-media-can-help-or-hurt-your-job-search/#252b305a24fd
http://www.forbes.com/sites/jacquelynsmith/2013/04/16/how-
social-media-can-help-or-hurt-your-job-search/#252b305a24fd
Article #1
Two-Year vs. Four-Year Colleges: Which One is Right for You?
Congratulations! You’ve made it (almost) through high school.
Now all you’ve got to do is plan out the next few
years of your life. When it comes to choosing your next
educational step, you’ll need to think about how much
of a time and money investment you’re prepared to make as
well as what kinds of jobs you can see yourself
holding in the future. To help you figure out where your next
move should be, here’s a short breakdown of the
15. pros and cons of two- and four-year colleges.
TWO-YEAR COLLEGES
About
Although four-year schools get all the media hype, many high
school graduates head right to a two-year
institution. Looking at the facts, it’s no surprise why. Cheaper,
quicker, and highly vocational, two-year schools
offer students the chance to start their careers sooner and with
less (or no) debt. You can also use a two-year
school as a launching point to start earning your bachelor’s
degree.
Who Goes There
Students looking to go directly into a trade or technical
vocation, those with blemished high school transcripts
looking to work their way into a four-year school, and students
who simply want to save money on their general
education courses before transferring to a more expensive four-
year institution.
What You’ll Take
Depending on your degree program, two-year students typically
either focus on taking general pre-requisite
courses that can transfer to a four-year institution or courses in
16. their specific trade. Since community colleges
are closely linked to area industries, students will find a wide
array of courses that cater directly to the local job
market.
Other Learning Opportunities
In addition to in-class learning, two-year college students
frequently take on apprenticeships and internships
within their local community. Beyond getting an insider’s look
at their future job, interns and apprentices also
gain valuable industry connections they can use to land a job
upon graduation.
The Cost Factor
Here is where two-year institutions shine. Since most two-year
colleges are designed for commuters, students
are responsible for finding their own housing and get to avoid
the high costs of room and board. Two-year
students get a huge break on tuition as well.
According to the College Board, the average cost of tuition and
fees at a two-year school is only $3,131, just
over one-third of the cost for a year at a four-year public
institution.
FOUR-YEAR COLLEGES
17. About
Get ready to make an investment. Students who put the time and
money into a four-year education will reap
the benefits throughout their lives. Though four-year schools
require at least twice the amount of time as two-
year schools AND three times the tuition, they offer students
on- and off-campus learning opportunities you
simply can’t find anywhere else.
Journal #4: What are your educational goals? What is your
plan for
achieving those goals? Based on what you have researched
about
your chosen career and the information in the following articles,
discuss your plans for future intellectual and academic
development.
Who Goes There
Those who want a well-rounded education and a flexible degree.
While four-year students are required to take
a much broader range of courses than two-year vocational
students, four-year students graduate with degrees
that can be used for a wide spectrum of jobs in the real world.
18. What You’ll Take
Everything—math, biology, English, history, even music
therapy. Although four-year students typically spend
the first two years taking generalized courses then the last two
years taking courses in their major, students
are free to take electives in any field of study.
Other Learning Opportunities
This is where four-year institutions shine. In addition to in-class
learning, four-year institutions offer an
enormous spectrum of on- and off-campus learning
opportunities. On campus you can attend performances,
cultural events, and guest lecture series, as well as participate in
student-run clubs and honor societies.
Students also go off campus for service-learning projects, study
abroad trips, internships, cooperative
education programs, and field trips.
The Cost Factor
Get ready to cough it up. The College Board reports that the
average cost of one year of in-state tuition and
fees at a public four-year school is $8,655. Tack on another
$9,205 in room and board costs and you’re looking
at an average yearly bill of $17,860. For private school
students, the situation is even worse. The average
19. private school student pays $29,056 in tuition and fees per year
and $10,462 in room and board for a grand
total of $39,518. While four-year college students are forced to
fork over the dough now, they’ll reap the
financial benefits later with higher salaries in the future.
Christina Couch is a freelance writer based in Richmond,
Virginia, and Chicago, Illinois. She is the author
of Virginia Colleges 101: The Ultimate Guide for Students of
All Ages (Palari Publishing, 2008). Her byline can
also be found on AOL.com, MSN.com, Yahoo.com and Wired
Magazine.
Retrieved 25 January 2016 from
http://www.collegeview.com/articles/article/two-year-vs-four-
year-colleges-which-one-is-right-for-you
Article #2
What Are the Benefits of College Vs. Technical School?
by Neil Kokemuller, Demand Media
For students who decide they don't want to dedicate four years
to a degree program, a technical or
trade school often makes sense as a way to advance a career
ambition. However, students who
possess more academic discipline and a desire for increasing
income and employment options, a
four-year bachelor's program might prove beneficial.
20. Social Experience
For students who want the more traditional college experience,
a four-year college or university is a
better fit. Trade or technical schools often have less on-campus
housing than four-year schools. At a
traditional college, you can live in a dorm or on-campus
apartment, become more active in social
clubs and Greek life, participate in intramural sports and hang
out with friends at school and in the
college community. This offers a better chance to social
involvement and the development of strong
friendship bonds. Technical schools are more commonly
commuter-based, with students driving in for
classes and leaving shortly after.
http://www.collegeview.com/articles/article/two-year-vs-four-
year-colleges-which-one-is-right-for-you
Employment Potential
College degrees generally included a broader range of content
that qualifies graduates for entry-level
careers in a variety of businesses and industries. Technical
schools are much more degree and
industry-specific. While they might offer more immediate
employment in the field, they lead to less
overall career flexibility. In some cases, students with a four-
year college degree can land jobs
requiring degrees in areas outside of their college major. This is
the benefit of taking classes in math,
sciences, language, humanities and communication, along with
major-specific classes.
21. Income Potential
Technical school graduates in certain careers can actually find
jobs that pay higher than entry-level
jobs attained by four-year graduates. However, on the whole,
four-year grads make more over the
duration of their working lives and have access to more high-
paying jobs. The U.S. Bureau of Labor
Statistics studied median income across all education levels in
2012. The results showed that
bachelor's degree earners made more than 26 percent more,
typically, than workers with an
associate degree.
Broader Knowledge Base
Along with the tangible career and income advantages, a
primary purpose of a four-year college
experience is a broader knowledge base and skill set. The
combination of general education courses,
program courses, electives and hands-on college experiences
typically provide this. Along with
greater career flexibility, a more well-rounded education
enhances a graduates ability to converse,
interact with community and business leaders and participate
more fully in the entire operation of an
organization.
Retrieved 25 January from
http://everydaylife.globalpost.com/benefits-college-vs-
technical-school-9505.html
Article #3
Updated on 12.07.15
22. Why You Should Consider Trade School Instead of College
by: Trent Hamm
For a lot of people, going to a four-year college seems like an
automatic choice when they graduate from high
school. The reason is obvious – higher income. According to the
National Center for Educational Statistics, a
bachelor’s degree accounted for an average of $16,900 in
additional income per year compared to a high
school diploma ($30,000 versus $46,900).
Over a 30-year career in the workforce, that’s more than a
$500,000 difference in earnings. These numbers
may not paint the whole picture, however. Due to the
increasingly high costs associated with a college
education, as well as other drawbacks, more and more people
have been considering trade school as an
education alternative. If you’re one of them, you can actually
search for a great trade school right here using
the tool below:
Trade School vs. College: Drawbacks to College Education
Length: Four (or More) Years vs. Two Years
For starters, a bachelor’s degree typically takes four years of
study, which means that people who enter the
23. workforce after receiving their bachelor’s degree aren’t doing
so until age 22. That shaves some years off of a
person’s career and can be considered an opportunity cost for
experiencing the ‘real world’ hands on instead
http://everydaylife.globalpost.com/benefits-college-vs-
technical-school-9505.html
of being in a classroom. Plus, a four-year program usually
makes you take classes outside of your major to
fulfill credit requirements. Unless you enjoy spending time in a
classroom, it may seem unnecessary to pay for
extraneous credits and courses. Sure, that improv theater class
was fun, but was it helpful for your chemistry
major?
High Cost of a Bachelor’s Degree
Another drawback is the cost. Research conducted by the Idaho
Department of Labor Idaho Department of
Labor found that the average bachelor’s degree in the United
States costs $127,000! Not only that, but nearly
70% of students take out loans to help pay for school.
According to the study, over 20% of students with loans
owe more than $50,000, and 5.6% owe more than $100,000 at
the end. Although some student loans are
24. certainly better than others, the added cost of accruing interest
makes the overall expense of receiving an
education in the U.S. significantly higher for the average
student than the already steep price tag suggests.
The college lifestyle isn’t cheap either — dorming, paying for
food, going out, and even doing your own laundry
adds up!
Dropout Rate + Late Grads
A third drawback: Some people simply aren’t prepared for the
rigors of a four-year college. For many students,
college is their first experience away from home and, without an
adequate plan, it’s easy to stray off course. In
fact, the Institute of Education Statistics estimates that 40% of
attendees at a four-year college drop out before
completing their degree. If you find yourself as a part of that
40%, not only have you incurred some of the
expense of college, you left without receiving a degree. For the
60% that do complete their degree, a whopping
64% take longer than four years to graduate, costing themselves
nearly $70,000 in lost wages and educational
expenses per year, according to U.S. News. Most colleges don’t
even require students to pick a major until the
end of their sophomore year, creating a class of undecided
students who may have wasted their time and
25. credits on courses that they chose not to pursue.
Poor Economic Conditions
Finally: Job prospects for new graduates may not be as bright as
they had expected. Although some college
majors are faring better than others when it comes to labor
market outcomes, a recent report released by
the Economic Policy Institute states that overall, the
unemployment (8.5%) and underemployment (16.8%)
rates for college graduates under the age of 25 are nearly double
what they were in 2007. Over the past five
years, graduates have faced sluggish labor markets Young
graduates are faced with limited job opportunities
and difficulty paying off their student loans. College degrees
are a career investment that require a
considerable amount of both time and money, and the portion of
grads who are unable to find desirable
employment (or employment at all!) are seeing negative returns.
Trade School as an Alternative
My response to these statistics is that people approaching high
school graduation should seriously consider
trade school, particularly if they are not at the top of their class.
A traditional four-year degree is not for
26. everyone, and trade school offers a pretty compelling career
path, especially when considering the factors
associated with a college education outlined above. I’ll provide
an overview of what a trade school education
is, who it would be best for, and some of the advantages of
trade school versus college.
What is a Trade School or Vocational School?
A trade school, also known as a technical or vocational school,
is an educational institution that exists to teach
skills related to a specific job. Trade schools are a more
streamlined approach to education, with curricula
focusing on developing a particular skillset and knowledge base
for a career rather than receiving a general
http://www.usnews.com/news/blogs/data-
mine/2014/12/01/report-too-much-freedom-hurts-college-
graduation-rates
education. Trade schools typically take a lot less time to
complete, have smaller class sizes, and the majority
of the training is hands-on, which is an ideal environment for
many types of learners. Vocational degrees can
lead to well-paying jobs like electrician, mechanic, machinist,
pharmacy technician, nuclear technician, and
dental hygienist, with room for growth and managerial potential
in each field.
27. Advantages to Trade Schools
Salaries for Trade School Jobs
For starters, salaries for trade school graduates aren’t that much
of a drop-off compared to a four-year degree.
According to the National Center for Educational Statistics,
technical and trade school jobs have a median
annual salary of $35,720, though this figure varies heavily
based on the particular industry and the experience
level of the worker. The BLS predicted earnings for bachelor’s
degree holders to be roughly $46,900,
amounting to an annual difference of $11,180. This stat, of
course, doesn’t factor in long term earnings growth.
However, because trade school only takes an average of two
years to complete versus four, that amounts to
an additional two years of income for the trade school graduate,
or $71,440. Factor in another $70,000 in costs
for the many students who take an extra year to graduate from
college, and trade school grads can be over
$140,000 ahead at the get-go, making up for over 12 years of
difference in income.
Price of Education
The average trade school degree costs $33,000, which,
compared to a $127,000 bachelor’s degree, means a
28. savings of $94,000. But that’s not all! If you assume that
students are fully financing their education with loans
at 4% over 10 years, the bachelor’s degree will cost $154,000,
while the trade school degree will cost only
$40,000. That’s a savings of $114,000 just on the degree.
Of course, most students in both cases won’t fully finance their
education. They’ll work and find other sources
of income to help with the process, meaning the gap will be
smaller in the average case. Research gathered in
2012 suggests that the average college student debt load is
$29,900, and that number rises to $36,327 when
factoring in interest. Conversely, the average debt load for
students graduating from a two-year technical
school is $10,000, roughly 70% less than the four-year
graduate.
Job Security
Yet another advantage of technical trade school is that most of
the jobs you’ll get are extremely difficult to
export to another country. More and more jobs are being
outsourced to places where labor is cheaper, making
domestic employment in certain sectors difficult to get. It is
much easier to export, say, computer programming
work or other information economy work than it is to export
29. carpentry or electrical work, as that requires a
physical presence.
Not only that, but there’s a growing domestic demand for high-
precision skills. According to Forbes, skilled
trade workers are a disproportionately older population, and
will only continue to get older, creating increased
opportunities for young workers to fill their shoes.
Final Thoughts on Trade School vs. College
It should be noted that I’m not opposed to a four-year degree;
instead, I’m simply making a strong case for an
option that many people overlook when deciding what to do
after high school. In lifetime earnings, a bachelor’s
degree still pays off – don’t get me wrong. According to
statistics, a person with a bachelor’s degree is
projected to earn around $1.1 million, compared to the $393,000
projected earnings of an associate’s degree
or trade school program graduate.
The advantages of a four-year degree are many: You’re going to
earn much more later on in life and you also
have the door wide open to continue your studies and earn
substantially more with a masters degree or
30. doctorate, however the cost/benefit equation to even higher
education is changing every day.
Trade school graduates are very limited in opportunities to
continue to bolster their education. That being said,
a four-year degree is expensive, and not suited to everyone’s
learning style and skill set. If you’re a hands-on
learner, excited by the prospects of getting out of the classroom
and starting to work immediately after high
school, trade school is a relatively inexpensive alternative
education that may work well for you. Take
advantage of the search tool above to learn more about trade
schools near you and what they offer.
I’ll leave you with an anecdote. My wife’s cousin graduated
from high school at roughly the same time my wife
graduated. Her cousin went to electrician’s school, while my
wife went to four-year university. Her cousin
started working three years before my wife and incurred much
less student loan debt. Today, though he makes
a little bit less money than she does, the difference isn’t very
significant, plus he had hardly any debt to pay off
after school.
This past May, my nephew graduated from high school. He is
now attending electrician’s school as well. I think
it’s the wisest move he could have made in his situation.
31. If you are graduating from high school soon, or have a loved
one who is approaching graduation, I recommend
seriously considering trade school as an alternative option. If
you’re still unsure about your academic future or
you’re looking for more information and options, check out our
education series.
Retrieved 25 January 2016 from
http://www.thesimpledollar.com/why-you-should-consider-
trade-school-instead-of-college/
http://www.thesimpledollar.com/why-you-should-consider-
trade-school-instead-of-college/
JAN 30, 2013
The Often Overlooked but Invaluable Benefits of Mentorship
My colleague Ken Perlman is a strong proponent of mentorship.
He gets as much out of being a
32. mentor as he does from his own mentors. Here he shares the
often overlooked benefits that make
mentorship invaluable. Read more about the “Serious business”
of mentoring in his interview in
the Financial Times.
I get to work with many different clients as they lead their
organizations through significant change.
When I ask them, to whom or what they attribute their strong
leadership skills, their answers are
rather consistent. More often than not, they attribute their
leadership skill-building to one or more
influential individuals – strong mentors – who helped show
them how to lead.
The value of a mentor can be doubly undervalued by many
people – especially younger professionals
and junior executives. We learn a great deal about management
principles and practices in school.
Leadership, though more popularly discussed in school now, is
still more often learned outside of
school. The value of a mentor who can help cultivate leadership
skills one-on-one in real-time, reduce
the anxiety in taking big steps, and focus leaders on achieving
their goals – is huge. Many times it’s
33. the first few years out of school that can shape the career path
of an MBA, and that is determined by
whether they create or are given an opportunity to demonstrate
their leadership skill.
Also, as a mentor myself, the lessons I’ve learned about myself
and my own leadership style are
huge.
Finally, I see many recent graduates looking to their friends and
peers for advice. While this is a good
perspective to have, the power of a mentor who can provide a
different perspective, relate different
leadership experiences, and ask a different set of questions is
critically important. Part of this “we
know better” thinking may come from the expectation that new
will disrupt old, simply based on its
‘awesomeness’. The danger is that people can far too easily
filter out views and opinions different
than their own simply by changing the channel or subscribing to
a different RSS or Twitter feed.
Leadership is about taking it all in, looking at what we really
want to achieve, and determining a
compelling path forward so that others will help you make it
happen. Mentors and peers, colleagues
and friends, customers and competitors are all part of that
34. ecosystem that helps give a platform to
leaders who know how to make it work for them.
Retrieved 25 January 2016 from
http://www.forbes.com/sites/johnkotter/2013/01/30/the-often-
overlooked-but-invaluable-
benefits-of-mentorship/#5f9f4b9563e8
Journal #5: Describe your mentoring experience. Explain 3
new pieces
of information you learned by participating in this experience.
How
does the information about mentorship in the article relate to
your
experience?
http://www.forbes.com/sites/johnkotter/2013/01/30/the-often-
overlooked-but-invaluable-benefits-of-
mentorship/#5f9f4b9563e8
http://www.forbes.com/sites/johnkotter/2013/01/30/the-often-
overlooked-but-invaluable-benefits-of-
mentorship/#5f9f4b9563e8
Other topics:
35. OCT 5, 2012 @ 11:47 AM 11,241 VIEWS
The Career Tip To Follow Your Passion: Is It Bunk?
Richard Eisenberg, CONTRIBUTOR
Career coaches often say that if you’re looking for a job or want
to change careers you should “follow your
passion.” In fact, Next Avenue’s work and volunteering blogger
Nancy Collamer recently wrote a piece telling
you how to do it. But could the whole notion of following your
passion be bunk?
Yup, according to Cal Newport, the author of the new, buzzy
book, So Good They Can’t Ignore You. (The title
comes from advice Steve Martin gives to aspiring entertainers.)
Become a Craftsman at Work
He maintains that pre-existing passions are rare. Trying to
determine your passion and follow it, Newport says,
can be dangerous and lead to chronic job-hopping. You’d be
much better off, he believes, improving and
stretching your “rare and valuable” skills to become a
“craftsman.” That will make you a stronger job candidate
and help you have a successful career.
36. I have to admit I was a little disturbed to see Newport throwing
cold water on the “follow your passion” idea.
After all, many people in their 50s or 60s are working in fields
they never loved, maybe even never liked, and
are eager to make a switch for personal satisfaction. Others
have lost jobs that didn’t enthuse them and now
hope to find work aligned with a particular interest or passion.
Since Newport’s book is aimed primarily at young people
starting out in their careers, I called him to hear his
argument for midlifers. And I confess I reluctantly came away a
believer.
Career Advice for Midlifers
“If you’re 50 or 60, you have built up very valuable skills,” said
Newport, who is in his early ‘30s and an
assistant professor of computer science at Georgetown
University in Washington, D.C. “Don’t discount them.”
When you’re plotting your next career move, “work backwards
from your skills,” Newport said. “Ask yourself:
What skills do I have and how rare and valuable are they? The
intersection of your rare skills and what
interests you is what should start your job hunt, not
introspection about what you’re ‘meant to do.’”
37. http://www.forbes.com/sites/nextavenue/people/reisenberg/
http://www.calnewport.com/books/sogood.html
Introspection Is Overrated
Introspection is highly overrated, Newport maintains. “There’s
no one, true calling that you’re meant to follow,
one passion entwined in your DNA that you’ll discover if you’re
introspective enough,” he said. (If you’re
interested in other job-seeking goofs, I recommend the new
Forbes article by Jacquelyn Smith, “13 Big
Mistakes Job Seekers Make and How to Avoid Them.”)
Newport says it’s important to “deliberately stretch yourself
past your comfort zone” at your job, since this will
make you more valuable. “I’m an academic and my advisers in
their 50s and 60s are constantly tackling
complicated fields like abstract mathematics and systematically
stretching themselves. They’re able to do
things way better than I am.”
Hobby vs. Career
If you’ve made a hobby of, say, photography, it’s not wise to
expect success turning that into a second career,
Newport says. Unless, that is, you’re really good at it — back to
the craftsman idea.
38. “Yes, if you’re excellent at photography and that’s a valuable
skill, it can be a foundation for a career you’ll
love,” he said. “But for most people, it’s ‘Yeah, I’m pretty good
at it, but my deep skills rely on the career I’ve
had for the past few decades.”
Avoiding a Layoff
I noted that being a craftsman won’t matter if your employer
needs to lay off workers and decides that
shedding your high 50-something salary will translate into tidy
savings for the company.
“Yes, in general, people who are more senior cost more and are
in more danger of being laid off,” Newport
says. “But if you’re indispensable, you’ll be unlikely to get laid
off or you’ll have a clear value to the marketplace
when you start looking for a job.”
And what about launching an encore career to follow your
passion to serve others?
“An encore career is a great idea,” Newport says. “But you’re
much more likely to be successful if you
approach it from the skillset mindset. The more rare, valuable
and relevant your skill is, the more impact you’ll
have in your encore career and the more satisfying it’s going to
be.”
39. In other words, don’t randomly pick a nonprofit so you can do
the type of work it happens to need at the
moment. Instead, find a place that can truly benefit from the
skills you’re best at.
Finding Your ‘One True Love’
I asked Collamer what she makes of Newport’s view and
learned that she actually thought it had merit, to a
point.
“I agree that few people have one driving passion, so finding
your ‘one true love’ can create needless anxiety
and frustration,” she says. “That’s also true for the myth that we
only have one soul mate.”
But, Collamer adds, “that does not mean introspection is time
wasted.” She favors a kind of passion-meets-
craftsman strategy, which makes sense to me. “Think about
what you enjoy, do well, and find meaningful —
and then look for work that lines up with those interests and
skills.”
Skillfully said.
Retrieved 17 February 2016 from
http://www.forbes.com/sites/nextavenue/2012/10/05/the-career-
tip-to-follow-your-