this is the second (of five)Critical Thinking Postsfor the c.docx
•Download as DOCX, PDF•
0 likes•2 views
this is the second (of five) Critical Thinking Posts for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020 . Remember, this is an opportunity for you to take a position on a media and culture issue using your informed opinion by the theory and concepts you are learning about in this course. Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity). Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded. Please write a 12 to 15 sentence response to the following multi-part question: Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point. .
Report
Share
Report
Share
Recommended
This is the first (of five) Critical Thinking Postsfor the cou.docx
This is the first (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Monday, January 6th, 2020
.
This is an opportunity for you to take a position on a
media and culture issue
using your
informed opinion
by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 10 to 12 sentence response to the following multi-part question:
Is there really a value in
media
convergence
for society? Is yes, give some specific examples of converged media that benefits society and clearly state why? If not, give some specific examples of converged media that does NOT benefit society and clearly state why not?
.
This is the fourth (of five)Critical Thinking Postsfor the c.docx
This is the fourth (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Tuesday, January 14th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Have your radio listening habits changed over your life thus far? How do you think personal music players such as the iPod and music streaming apps like
iHeart Radio
changed radio formats and usage?
.
This is the third (of five)Critical Thinking Postsfor the co.docx
This is the third (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Friday, January 10th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
What are your current online music listening habits? Do you use platforms like Spotify, Soundcloud, or Pandora? How often do you use these types of sites for music? Are they changing your music taste? Introducing you to new genres? New cultures?
.
Reflection on Race.pdf
This document provides instructions for an assignment on reflecting on race in one's immediate environment. Students are asked to analyze diversity, prejudice, discrimination, and values regarding human differences in their daily lives and communities. They must discuss how their racial identity affects them, examples of positive and negative race relations witnessed, the historical and structural sources of racism observed, and the values underlying ethnic group interactions. Students are also asked to consider how social change could improve race relations and cite course readings in their responses. The document provides guidelines on formatting, citations, responses to peers, late policies, and communication with the instructor.
100ideasreadingwriting.pdf
This document provides 10 exercises to help analyze one's audience when writing a paper or persuasive piece. The first exercise discusses analyzing an opposing audience's strengths and weaknesses to devise an effective strategy. The second suggests having a "devil's advocate" discussion where group members argue counter-positions to the writer's topic to help the writer consider opposing views. The third proposes creating a graphic organizer to brainstorm points of agreement and disagreement between the writer and opposing audience.
Ethics Social Justice.docx
This document provides instructions for an assignment on human rights and public administration. Students are asked to write a 3-4 page paper in APA format reflecting on readings about human rights issues and their implications for public administrators. The paper should include: a description of human rights issues from the readings, an explanation of the issues' significance, how the readings impacted the student, implications for public administrators, and a summary of what the student learned. Guidelines are provided on formatting, citations, and communication with the instructor.
Aggressive Behavior Perception.pdf
This document provides instructions and resources for a discussion assignment on perceptions of aggressive behavior across cultures. Students are asked to discuss an example of a behavior that may be perceived as aggressive in a selected culture and why, an example of a behavior seen as aggressive across most cultures and why, and how socially sanctioned violence is acceptable in some cultures. The document provides learning resources on culture and social cognition, social justice from a cultural perspective, and several research articles. It also provides formatting guidelines, expectations for responses, and policies on late submissions and communication.
Blog AnalysisDiscussions play an integral role in monitoring y.docx
Blog Analysis
Discussions play an integral role in monitoring your course participation throughout the term. You should check back to the weekly discussions multiple times throughout the week to engage in the discussion with your professor and peers. Participation is only counted during the week in which this discussion is assigned. Be sure to appropriately cite any sources you use to support your responses with standard APA citations. Answer the prompt question(s) thoroughly using a minimum of 150-200 words
Discussion Question:
Since you have been reading about blog composition, find a blog you enjoy and analyze it. Then, post:
1. The name of the blog with a hyperlink (not a pasted URL).
2. Your analysis. Consider aspects we’ve covered in class such as content, audience, and visual appeal. What works? What doesn’t? Why?
Audience Analysis Assignment
Find a blog you enjoy online, or consider examining the blog you are working on, to perform an audience analysis. Answer the following in order to illustrate your understanding of audience when composing a blog:
What are the Audience’s Demographics?
· Age
· Gender
· Location
· Relationship status
· Sexual orientation
· Income
· Family
· Education level
· Race
· Ethnicity
· Religion
· Occupation
What are the Audience’s Expectations or Needs?
· What do they know about the topic?
· Are there any misconceptions about the topic? What can they expect to learn?
· What are their current beliefs about this issue?
· What tone or reading level does the audience expect when they read this?
· How can you encourage audience interaction with the blog?
Visual Aid Assignment
In the blog lecture, you read about the importance of visual aids in an online space. Write up a proposal about what visual aid you intend to use for your blog including:
· Include a link or paste in the visual.
· What type of visual it is (picture, infographic, graph, video, etc.)?
· How does this visual add clarity or credibility to your blog?
· How does the visual benefit the audience or add understanding to your post?
· What made you choose this visual over the other aids you looked into?
Writing for Non-Academic Audiences
Writing for General, Non-Academic Audiences: Benefits, Opportunities, Issues (Links to an external site.)
SEPTEMBER 12, 2017
AUTHOR: SCOTT MONTGOMERY (Links to an external site.)
First Things
1. Why Write for the Public?
Social scientists investigate and write about society. It therefore makes sense that they share this important work with those whom they study, including decision-makers. In truth, the public is very interested in what social science disciplines have to say—about politics, foreign policy, history, economics, area studies, studies of society, culture, and language. People are more aware of how relevant and important knowledge is in these fields than ever before.
A key reason is that they know or sense the world has entered a period of major uncertainty. Major challenges to liberal democracy.
Recommended
This is the first (of five) Critical Thinking Postsfor the cou.docx
This is the first (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Monday, January 6th, 2020
.
This is an opportunity for you to take a position on a
media and culture issue
using your
informed opinion
by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 10 to 12 sentence response to the following multi-part question:
Is there really a value in
media
convergence
for society? Is yes, give some specific examples of converged media that benefits society and clearly state why? If not, give some specific examples of converged media that does NOT benefit society and clearly state why not?
.
This is the fourth (of five)Critical Thinking Postsfor the c.docx
This is the fourth (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Tuesday, January 14th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Have your radio listening habits changed over your life thus far? How do you think personal music players such as the iPod and music streaming apps like
iHeart Radio
changed radio formats and usage?
.
This is the third (of five)Critical Thinking Postsfor the co.docx
This is the third (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Friday, January 10th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
What are your current online music listening habits? Do you use platforms like Spotify, Soundcloud, or Pandora? How often do you use these types of sites for music? Are they changing your music taste? Introducing you to new genres? New cultures?
.
Reflection on Race.pdf
This document provides instructions for an assignment on reflecting on race in one's immediate environment. Students are asked to analyze diversity, prejudice, discrimination, and values regarding human differences in their daily lives and communities. They must discuss how their racial identity affects them, examples of positive and negative race relations witnessed, the historical and structural sources of racism observed, and the values underlying ethnic group interactions. Students are also asked to consider how social change could improve race relations and cite course readings in their responses. The document provides guidelines on formatting, citations, responses to peers, late policies, and communication with the instructor.
100ideasreadingwriting.pdf
This document provides 10 exercises to help analyze one's audience when writing a paper or persuasive piece. The first exercise discusses analyzing an opposing audience's strengths and weaknesses to devise an effective strategy. The second suggests having a "devil's advocate" discussion where group members argue counter-positions to the writer's topic to help the writer consider opposing views. The third proposes creating a graphic organizer to brainstorm points of agreement and disagreement between the writer and opposing audience.
Ethics Social Justice.docx
This document provides instructions for an assignment on human rights and public administration. Students are asked to write a 3-4 page paper in APA format reflecting on readings about human rights issues and their implications for public administrators. The paper should include: a description of human rights issues from the readings, an explanation of the issues' significance, how the readings impacted the student, implications for public administrators, and a summary of what the student learned. Guidelines are provided on formatting, citations, and communication with the instructor.
Aggressive Behavior Perception.pdf
This document provides instructions and resources for a discussion assignment on perceptions of aggressive behavior across cultures. Students are asked to discuss an example of a behavior that may be perceived as aggressive in a selected culture and why, an example of a behavior seen as aggressive across most cultures and why, and how socially sanctioned violence is acceptable in some cultures. The document provides learning resources on culture and social cognition, social justice from a cultural perspective, and several research articles. It also provides formatting guidelines, expectations for responses, and policies on late submissions and communication.
Blog AnalysisDiscussions play an integral role in monitoring y.docx
Blog Analysis
Discussions play an integral role in monitoring your course participation throughout the term. You should check back to the weekly discussions multiple times throughout the week to engage in the discussion with your professor and peers. Participation is only counted during the week in which this discussion is assigned. Be sure to appropriately cite any sources you use to support your responses with standard APA citations. Answer the prompt question(s) thoroughly using a minimum of 150-200 words
Discussion Question:
Since you have been reading about blog composition, find a blog you enjoy and analyze it. Then, post:
1. The name of the blog with a hyperlink (not a pasted URL).
2. Your analysis. Consider aspects we’ve covered in class such as content, audience, and visual appeal. What works? What doesn’t? Why?
Audience Analysis Assignment
Find a blog you enjoy online, or consider examining the blog you are working on, to perform an audience analysis. Answer the following in order to illustrate your understanding of audience when composing a blog:
What are the Audience’s Demographics?
· Age
· Gender
· Location
· Relationship status
· Sexual orientation
· Income
· Family
· Education level
· Race
· Ethnicity
· Religion
· Occupation
What are the Audience’s Expectations or Needs?
· What do they know about the topic?
· Are there any misconceptions about the topic? What can they expect to learn?
· What are their current beliefs about this issue?
· What tone or reading level does the audience expect when they read this?
· How can you encourage audience interaction with the blog?
Visual Aid Assignment
In the blog lecture, you read about the importance of visual aids in an online space. Write up a proposal about what visual aid you intend to use for your blog including:
· Include a link or paste in the visual.
· What type of visual it is (picture, infographic, graph, video, etc.)?
· How does this visual add clarity or credibility to your blog?
· How does the visual benefit the audience or add understanding to your post?
· What made you choose this visual over the other aids you looked into?
Writing for Non-Academic Audiences
Writing for General, Non-Academic Audiences: Benefits, Opportunities, Issues (Links to an external site.)
SEPTEMBER 12, 2017
AUTHOR: SCOTT MONTGOMERY (Links to an external site.)
First Things
1. Why Write for the Public?
Social scientists investigate and write about society. It therefore makes sense that they share this important work with those whom they study, including decision-makers. In truth, the public is very interested in what social science disciplines have to say—about politics, foreign policy, history, economics, area studies, studies of society, culture, and language. People are more aware of how relevant and important knowledge is in these fields than ever before.
A key reason is that they know or sense the world has entered a period of major uncertainty. Major challenges to liberal democracy.
Elements of Critical Thinking [WLOs 2, 3, 4] [CLOs 2, 3, 4]P.docx
This document provides resources for students to develop their critical thinking skills. It includes readings on common misconceptions of critical thinking, combating fake news, and teaching critical thinking. Videos define critical thinking and discuss recognizing fake news. Students are prompted to explain elements of critical thinking, analyze examples demonstrating strong and weak critical thinking, and reflect on applying their education to their career and community.
Task Your task is to follow a conversation in society right now .docx
Task:
Your task is to follow a conversation in society right now
to which social movements and influential organizations are responding
. "Following a conversation" means examining how different writers define and respond to similar issues, and listening/reading closely for moments where different writers connect, where they overlap, and where they conflict. It also means that you examine
how
different writers enter the conversation (which will require rhetorical analysis) and how those differences impact what they are trying to say.
In order to make sure that your exploration considers differing points of view, we are going to ground your exploration in this unit by focusing on a social movement or an influential organization and an issue that is central to their cause. For example, you could look into conversations related to
social movements
like #MeToo, #BlackLivesMatter, March for Our Lives, or #MMIW. You could look at conversations in the news that involve
influential organizations
, like Planned Parenthood, the Red Cross, the ACLU, and RAICES. The project will ask you to read several sources about a topic that that group cares very much about, think about how different writers take different approaches to the topic, and then look at how the major organization or social movement you chose is responding to that same topic.
The project will ask you to do four things:
Summarize
the specifics of the conversations that you are following, including the main topics/ideas being discussed, the modes being used throughout the conversation, and the context in which the conversation is taking place.
Discuss
the ethos/credibility and varying levels of expertise of groups/people taking part in the conversation,
Analyze
the ways in which your chosen social movement or organization uses writing and rhetoric to facilitate change
Reflect
on what you learned, including how this activity informs your understanding of research in a digital society.
Importantly, this assignment is not a paper: you will complete this project as a series of 4 posts, culminating in a final project reflection. All
5
of these assignments will be collected into one project grade.
Note: while each of these assignments might seem "small" on their own, and will appear separately in the modules, together they make up a paper/project grade and will significantly impact your grade. Therefore it is important that for each post you work to find the best sources you can find, and that you answer the questions on each assignment thoroughly. Also, please edit and revise your posts to the best of your ability, as the quality of your writing will also be graded.
Each post will ask you to look for a different kind of text, each one centered around a social movement, and then the post instructions will give you specific questions to answer. All of the posts ask you to make specific references to the text you are analyzing. Please do not talk in broad terms abou.
Reflection Essay #2Explore your own efforts at achieving int.docx
This document provides instructions for Reflection Essay #2. Students are asked to read the news section of a national newspaper like The Washington Post or The New York Times for three consecutive days. They must then discuss how individuals and groups are depicted in the news in terms of representations of race, gender, class, sexuality, age, ability, and international communities. Students are also prompted to reflect on the experiences of the people shown in the news and how their interests are publicly represented. The essay should be 6-7 pages following APA style guidelines and include copies of the news articles. It will be graded based on incorporation of course concepts, clarity of ideas, formatting, proofreading, and inclusion of newspaper articles.
Essay #2 Source Integration Paper Rhetorical Situati.docx
Essay #2: Source Integration Paper
Rhetorical Situation:
You are a member of an academic community and you want to publish an article in a prestigious
newspaper to discuss a specific and compelling issue your academic group faces. You have
spoken to the chief editor of the newspaper, and he has asked you to further educate him and his
team on what exactly is the issue, and what is the current state of research and discussion on the
issue?
Assignment Overview
Your task is to write a well-developed essay to uncover the issue that exists in your chosen
academic community. Use minimum five sources to support your claim. At least three of these
sources should be academic, peer-reviewed sources from the University databases. The other
two can be credible web sources.
Don’t just create an imaginary issue. Do your research and try to understand the actual problem
being faced by an academic group of your interest. Once you understand the issue, your task is to
explain that issue to your audience. Try to avoid an argumentative tone. Be more informative.
Use your sources to educate your audience about what research shows to be the current state of
the issue.
Put the five sources into conversation. In putting the sources into conversation with each other,
the paper might explore five types of relationships:
1. Agreement/Similarity (do most of your sources agree on what is being said about the
issue? If so, what is the factor that most sources agree upon?
2. Disagreement/Contrast (Is there any discrepancy of thoughts? If so, what is it that the
sources disagree about?)
3. Corroboration (a source provides evidence that supports the argument of another source)
4. Contradiction (a source provides evidence that undermines the argument of another
source)
5. Cause/Effect (a source explores the causes or effects of something that is observed or
identified in another source)
Understanding and locating these relationships in your sources will help you develop your paper.
In simple words recognizing and showing these relationships in your paper is what the
assignment is asking for.
Assignment Outcomes
Identify and effectively describe a specific and compelling issue for a particular
academic community.
Identify academic and non-academic sources and reference them appropriately. You are
required to use three peer-reviewed, academic sources and two credible and reputable web
sources.
Effectively summarize, paraphrase, and quote material from academic and non-academic
source material using APA guidelines
Accurately identify and analyze relationships between sources
Organize an effective review of the literature on a specific issue
Compile a proper references page using APA guidelines. Your paper should have title page;
but, the essay summary page is not required.
What is an academic community?
Academic means, related to education. An ac ...
Module 7 Discussion Board Algebra1. What does it mean when s.docx
This document provides instructions for students to write a classical argument paper on an approved topic. It outlines the key elements of a classical argument, including: introducing the issue and opposing positions, presenting reasons and evidence to support the student's position, anticipating and refuting counterarguments, and concluding by emphasizing the importance of the issue. Students must write a minimum 1,200-1,500 word paper using at least 5 credible sources to both support their argument and refute opposing positions. The paper should follow standard argumentative structure and formatting guidelines provided.
Project Media Essay Spring 2015 Professor BattyProject Med.docx
This document outlines the requirements and assignments for a project media essay course. Students will write an essay arguing that a public figure has been misrepresented by the media, either portraying a "good" person negatively or a "bad" person positively. They must choose 3 contemporary media sources to support their argument. The assignments include a proposal, annotated bibliography, outline, and final draft essay. The final draft must be 4-6 pages long making a clear thesis and using evidence and MLA style citations. Discussion board requirements and samples are also provided.
Discourse Communities Essay.docx
This document provides instructions for an essay assignment on discourse communities. Students are asked to identify the discourse communities they belong to, and analyze how these communities use language and share knowledge. They should also discuss whether they had to change their language to participate, and if the communities produce written documents. The document outlines expectations for formatting, citations, references, and participation in weekly discussion questions.
Re-Evaluating Media NeedsDiscussion TitlePrepare This week, y.docx
Re-Evaluating Media Needs
Discussion Title
Prepare: This week, you will focus on re-evaluating your digital and social media uses and needs. Review Exercise 12.2 in the textbook. For this task, you will not answer each question individually but rather, you will use the questions to gauge your thinking about your digital and social media experiences throughout the week. This week, you will need to fully reconnect and resume your normal activities on digital and social media to complete this exercise.
Reflect: After a week of being disconnected from digital and social media, it must be awesome to re-engage! Or is it? Perhaps you found some serenity in being left to your own thoughts without attending to social media, or that your relationships with others flourished because you met face-to-face or heard their voices over the phone instead of trying to figure out what they really meant by the text messages and the emoticons that accompanied them.
Critically evaluate your use of digital and social media in terms of how much time you spend engaged as well as the benefit that comes to you from that engagement. Consider whether you can “live without” some of the interaction, as well as the positive and negative impact that lessening your dependence on digital and social media may have.
Write: After reviewing how much time you have spent engaged in digital and social media across the week, write a 250- to 300-word blog about your evaluation. Share with your peers how reconnecting after a week of being disconnected made you critically examine your use of digital and social media. Include a byline at the beginning of your blog post. At the end of your blog, include a full reference for all sources cited in the body of your blog. All citations and references must adhere to APA style guidelines as outlined in theAshford Writing Center. View theFormatting Stories and Blogs document for assistance with formatting your blog.
Check It! Your blog must be submitted throughGrammarly prior to submission.
Respond to Peers: After you have written your blog, read the blogs of your peers, and post a comment to at least three other bloggers about their evaluations of their digital and social media uses. Your comments should address them by name, be between 100 and 150 words in length, and you must include your name at the end of each comment.
Persuasive Media
Discussion Title
Prepare: This week, you will need to engulf yourself in persuasive messages. It takes no real effort to do this. All you have to do is actually watch the commercials around your news and entertainment programs, pay attention to your surroundings, and really look at all of the pop-up ads on the websites that you visit throughout the week. You will also need to read Chapter 11 in the textbook. Then, choose one of the articles to read:
· High Culture/Low Culture: Advertising in Literature, Art, Film, and Popular Culture
· Representations of Masculinity and Femininity in Advertising
· Ethi ...
Discourse communities -authorityanddata-1
This document provides guidance for observing and analyzing discourse communities based on John Swales' framework. It instructs students to look at issues of power, authority, and assimilation when newcomers join a discourse community. Students are told to observe a discourse community, collect texts, and interview members to understand how expertise, communication practices, genres, and specialized language contribute to enculturation and the distribution of authority.
Paper InstructionsYou are to research and write a 5-8 page paper.docx
Paper Instructions
You are to research and write a 5-8 page paper (excluding title page and reference pages) on one of the topics listed below. The paper should incorporate references to the course material and a minimum of 6 scholarly sources. The paper should be typed, double spaced using APA formatting, and attached as a file. Your writing should display knowledge, analysis, evaluation, and application of the material you have studied in the course. See the document called “Final Paper Expectations” for a breakdown of the structure and expectations.
As you consider the topic you want to write about, ask yourself what supporting materials from the course, from your personal experiences, and from your researched resources you could bring together to bring the topic to life.
Topics to select from are:
Consider how Martin Buber’s theory of communication plays out in the world. Take into consideration each of the three types of relationships (I-It, I-You, I-Thou).
Abraham Maslow developed his theory of the “Hierarchy of Needs.” How do people use social media to meet their needs?
Discuss your thoughts and the thoughts of the experts about the four types of attachment styles.
Discuss the impact of the media on the development of gender identity.
What are the impacts of long-distance relationships on interpersonal communication?
Martin Luther King, Jr.
(Quotable Quote)
is quoted as saying, “It really boils down to this: that all life is interrelated. We are caught in an inescapable network of mutuality.” What aspects of interpersonal communication apply to this sentiment?
According to Anthony Robbins
(Quotable Quote),
“The quality of your life is the quality of your communication.” How so?
Module 2 told us that “the self arises in communication with others.” Discuss.
Before writing this paper, observe yourself for several days, and whenever you use “you” language, try to rephrase what you said or thought into “I” language. How does that change how you think and feel about what’s happening? How does it affect your interactions with others? Does it make a positive or negative impact? Describe your experiences and then relate your personal findings to what you find in your research.
What labels that you dislike have been applied to you or to groups to which you belong? Explain how the labels affect you. Describe how your experiences relate to what you find in your research.
Who is your prototype, or model, of a listener? Describe what the person does that makes her or him effective? Relate your description to research on listening.
Discuss the differences between differential, assertive, and aggressive communication.
Define and describe what makes a good friend. Describe the investments that are made, how trust, acceptance, and closeness are communicated. How does that compare to what experts say about friends and friendship?
What makes for a successful romantic relationship? Compare your pers.
Enhancing the 21st century critical thinking skills of ESL/EFL learners
The what, why, and how of critical thinking in an ESL/EFL classroom in the new normal and post-pandemic time.
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
Assignment 1: Culture and Communication
In this assignment, you will explore your own cultural and ethnic background and analyze how this background may affect your communication. A great deal of a message is communicated not through spoken words but through the nonverbal channels. Culture and personal experience can play a large role in the transmission and interpretation of nonverbal messages. You will reflect upon your personal experience from the viewpoint of your cultural and ethnic affiliation(s) and compare it with the scholarly literature relevant to your cultural and ethnic background.
Tasks:
Watch the video,
Empathy Training for Ethnic and Cultural Awareness
. Afterwards, identify your cultural and ethnic background. In your response, answer the following questions:
In what ways do you feel your culture affects the way you communicate? (For example, eye contact or the lack of eye contact has a cultural component and can be interpreted as defiance or something similar by those unaware of the cultural context.)
Provide an example of how your culture has influenced nonverbal communication.
Discuss how nonverbal communication could influence whether or not a message is perceived accurately.
How is someone from a different cultural background likely to perceive your message?
Submission Details:
By
Saturday, September 12, 2015
, post your responses in at least 3–4 paragraphs to this
Discussion Area
. Your response should rely upon at least three sources from professional literature. This may include the Argosy University online library resources, relevant textbooks, peer-reviewed journal articles, and websites created by professional organizations, agencies, or institutions (.edu, .org, or .gov). Write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources (i.e., APA format); and use accurate spelling, grammar, and punctuation.
Through
Wednesday, September 16, 2015
, respond to at least two of your classmates' posts. While responding, draw comparisons between the examples you provided and the examples submitted by your classmates, and provide a rationale for the comparisons.
ATTENTION <,The faculty said no sources later thamn 5 years back please and thank you
.
STEP 1 Next, find a text in conversation with your first two that.docx
STEP 1: Next, find a
text in conversation with your first two that that allows for reader/viewer interaction via feedback, online comments, etc.
You can be creative here. For example, you could look at a blog, a series of tweets, a podcast, Instagram posts, online videos, interviews, artwork, ads, etc. as long as the text provides space for interaction from readers/viewers
(like comments, sharing, or liking).
Importantly, again, try to pick a source (or series of sources--if you use something like tweets) that isn't just broadly about the same general topic as the one you used for the last discussion, but one that debates the same question or concern that your previous sources debated/discussed.
NOTE: Try to find a source with information that surprises you or enhances your understanding of the conversation in some way. This will help you write a better analysis.
STEP 2: Once you’ve identified a source to work with, read the text(s) and then write a rhetorical summary. To help you write a rhetorical summary, see
Guiding Questions for Rhetorical Summaries
below. Because your source is so different from the previous sources you used, your answers will probably be very different.
Note: there's a new question below: don't forget to answer it!
Guiding Questions For Researching Rhetorically:
Please use specific examples from the text to support your analysis. Here are some questions to consider.
First, identify the
author
(first name and last name) and title of the piece and where/when it was published. Then identify the core idea of the author’s argument, along with information on
what
they’re arguing and
how
they’re making their argument. (If it's an informative piece, identify what the main goal of the document is and what they are using to support that goal. For example, what are they trying to explain? Why? How?) Your summary should remain an objective report of the article/text, without your commentary or opinion of the author’s argument/information.
Who is the
audience
for the text and what was the author’s purpose? Remember that the audience cannot be "everyone". (For example, does the audience belong to a particular age group? To a specific geographical location? A political affiliation? A specific career or degree of knowledge? Look for clues in the text as to whom the writer thinks is reading.) What is the writer responding to? What do you know about the author/place of publication?
How does the writer use evidence/information? Is the evidence/information reliable? Why or why not?
What is the level of
bias
or degree of advocacy in the medium where this article was published? For example, a newspaper or website might believe something very strongly, to the point that they are very selective in the information they share, or they might be trying to be "neutral". If you look into the newspaper/website/etc, you might get clues. What might you say are the medium’s values? For example, for an article, you mi.
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
More Related Content
Similar to this is the second (of five)Critical Thinking Postsfor the c.docx
Elements of Critical Thinking [WLOs 2, 3, 4] [CLOs 2, 3, 4]P.docx
This document provides resources for students to develop their critical thinking skills. It includes readings on common misconceptions of critical thinking, combating fake news, and teaching critical thinking. Videos define critical thinking and discuss recognizing fake news. Students are prompted to explain elements of critical thinking, analyze examples demonstrating strong and weak critical thinking, and reflect on applying their education to their career and community.
Task Your task is to follow a conversation in society right now .docx
Task:
Your task is to follow a conversation in society right now
to which social movements and influential organizations are responding
. "Following a conversation" means examining how different writers define and respond to similar issues, and listening/reading closely for moments where different writers connect, where they overlap, and where they conflict. It also means that you examine
how
different writers enter the conversation (which will require rhetorical analysis) and how those differences impact what they are trying to say.
In order to make sure that your exploration considers differing points of view, we are going to ground your exploration in this unit by focusing on a social movement or an influential organization and an issue that is central to their cause. For example, you could look into conversations related to
social movements
like #MeToo, #BlackLivesMatter, March for Our Lives, or #MMIW. You could look at conversations in the news that involve
influential organizations
, like Planned Parenthood, the Red Cross, the ACLU, and RAICES. The project will ask you to read several sources about a topic that that group cares very much about, think about how different writers take different approaches to the topic, and then look at how the major organization or social movement you chose is responding to that same topic.
The project will ask you to do four things:
Summarize
the specifics of the conversations that you are following, including the main topics/ideas being discussed, the modes being used throughout the conversation, and the context in which the conversation is taking place.
Discuss
the ethos/credibility and varying levels of expertise of groups/people taking part in the conversation,
Analyze
the ways in which your chosen social movement or organization uses writing and rhetoric to facilitate change
Reflect
on what you learned, including how this activity informs your understanding of research in a digital society.
Importantly, this assignment is not a paper: you will complete this project as a series of 4 posts, culminating in a final project reflection. All
5
of these assignments will be collected into one project grade.
Note: while each of these assignments might seem "small" on their own, and will appear separately in the modules, together they make up a paper/project grade and will significantly impact your grade. Therefore it is important that for each post you work to find the best sources you can find, and that you answer the questions on each assignment thoroughly. Also, please edit and revise your posts to the best of your ability, as the quality of your writing will also be graded.
Each post will ask you to look for a different kind of text, each one centered around a social movement, and then the post instructions will give you specific questions to answer. All of the posts ask you to make specific references to the text you are analyzing. Please do not talk in broad terms abou.
Reflection Essay #2Explore your own efforts at achieving int.docx
This document provides instructions for Reflection Essay #2. Students are asked to read the news section of a national newspaper like The Washington Post or The New York Times for three consecutive days. They must then discuss how individuals and groups are depicted in the news in terms of representations of race, gender, class, sexuality, age, ability, and international communities. Students are also prompted to reflect on the experiences of the people shown in the news and how their interests are publicly represented. The essay should be 6-7 pages following APA style guidelines and include copies of the news articles. It will be graded based on incorporation of course concepts, clarity of ideas, formatting, proofreading, and inclusion of newspaper articles.
Essay #2 Source Integration Paper Rhetorical Situati.docx
Essay #2: Source Integration Paper
Rhetorical Situation:
You are a member of an academic community and you want to publish an article in a prestigious
newspaper to discuss a specific and compelling issue your academic group faces. You have
spoken to the chief editor of the newspaper, and he has asked you to further educate him and his
team on what exactly is the issue, and what is the current state of research and discussion on the
issue?
Assignment Overview
Your task is to write a well-developed essay to uncover the issue that exists in your chosen
academic community. Use minimum five sources to support your claim. At least three of these
sources should be academic, peer-reviewed sources from the University databases. The other
two can be credible web sources.
Don’t just create an imaginary issue. Do your research and try to understand the actual problem
being faced by an academic group of your interest. Once you understand the issue, your task is to
explain that issue to your audience. Try to avoid an argumentative tone. Be more informative.
Use your sources to educate your audience about what research shows to be the current state of
the issue.
Put the five sources into conversation. In putting the sources into conversation with each other,
the paper might explore five types of relationships:
1. Agreement/Similarity (do most of your sources agree on what is being said about the
issue? If so, what is the factor that most sources agree upon?
2. Disagreement/Contrast (Is there any discrepancy of thoughts? If so, what is it that the
sources disagree about?)
3. Corroboration (a source provides evidence that supports the argument of another source)
4. Contradiction (a source provides evidence that undermines the argument of another
source)
5. Cause/Effect (a source explores the causes or effects of something that is observed or
identified in another source)
Understanding and locating these relationships in your sources will help you develop your paper.
In simple words recognizing and showing these relationships in your paper is what the
assignment is asking for.
Assignment Outcomes
Identify and effectively describe a specific and compelling issue for a particular
academic community.
Identify academic and non-academic sources and reference them appropriately. You are
required to use three peer-reviewed, academic sources and two credible and reputable web
sources.
Effectively summarize, paraphrase, and quote material from academic and non-academic
source material using APA guidelines
Accurately identify and analyze relationships between sources
Organize an effective review of the literature on a specific issue
Compile a proper references page using APA guidelines. Your paper should have title page;
but, the essay summary page is not required.
What is an academic community?
Academic means, related to education. An ac ...
Module 7 Discussion Board Algebra1. What does it mean when s.docx
This document provides instructions for students to write a classical argument paper on an approved topic. It outlines the key elements of a classical argument, including: introducing the issue and opposing positions, presenting reasons and evidence to support the student's position, anticipating and refuting counterarguments, and concluding by emphasizing the importance of the issue. Students must write a minimum 1,200-1,500 word paper using at least 5 credible sources to both support their argument and refute opposing positions. The paper should follow standard argumentative structure and formatting guidelines provided.
Project Media Essay Spring 2015 Professor BattyProject Med.docx
This document outlines the requirements and assignments for a project media essay course. Students will write an essay arguing that a public figure has been misrepresented by the media, either portraying a "good" person negatively or a "bad" person positively. They must choose 3 contemporary media sources to support their argument. The assignments include a proposal, annotated bibliography, outline, and final draft essay. The final draft must be 4-6 pages long making a clear thesis and using evidence and MLA style citations. Discussion board requirements and samples are also provided.
Discourse Communities Essay.docx
This document provides instructions for an essay assignment on discourse communities. Students are asked to identify the discourse communities they belong to, and analyze how these communities use language and share knowledge. They should also discuss whether they had to change their language to participate, and if the communities produce written documents. The document outlines expectations for formatting, citations, references, and participation in weekly discussion questions.
Re-Evaluating Media NeedsDiscussion TitlePrepare This week, y.docx
Re-Evaluating Media Needs
Discussion Title
Prepare: This week, you will focus on re-evaluating your digital and social media uses and needs. Review Exercise 12.2 in the textbook. For this task, you will not answer each question individually but rather, you will use the questions to gauge your thinking about your digital and social media experiences throughout the week. This week, you will need to fully reconnect and resume your normal activities on digital and social media to complete this exercise.
Reflect: After a week of being disconnected from digital and social media, it must be awesome to re-engage! Or is it? Perhaps you found some serenity in being left to your own thoughts without attending to social media, or that your relationships with others flourished because you met face-to-face or heard their voices over the phone instead of trying to figure out what they really meant by the text messages and the emoticons that accompanied them.
Critically evaluate your use of digital and social media in terms of how much time you spend engaged as well as the benefit that comes to you from that engagement. Consider whether you can “live without” some of the interaction, as well as the positive and negative impact that lessening your dependence on digital and social media may have.
Write: After reviewing how much time you have spent engaged in digital and social media across the week, write a 250- to 300-word blog about your evaluation. Share with your peers how reconnecting after a week of being disconnected made you critically examine your use of digital and social media. Include a byline at the beginning of your blog post. At the end of your blog, include a full reference for all sources cited in the body of your blog. All citations and references must adhere to APA style guidelines as outlined in theAshford Writing Center. View theFormatting Stories and Blogs document for assistance with formatting your blog.
Check It! Your blog must be submitted throughGrammarly prior to submission.
Respond to Peers: After you have written your blog, read the blogs of your peers, and post a comment to at least three other bloggers about their evaluations of their digital and social media uses. Your comments should address them by name, be between 100 and 150 words in length, and you must include your name at the end of each comment.
Persuasive Media
Discussion Title
Prepare: This week, you will need to engulf yourself in persuasive messages. It takes no real effort to do this. All you have to do is actually watch the commercials around your news and entertainment programs, pay attention to your surroundings, and really look at all of the pop-up ads on the websites that you visit throughout the week. You will also need to read Chapter 11 in the textbook. Then, choose one of the articles to read:
· High Culture/Low Culture: Advertising in Literature, Art, Film, and Popular Culture
· Representations of Masculinity and Femininity in Advertising
· Ethi ...
Discourse communities -authorityanddata-1
This document provides guidance for observing and analyzing discourse communities based on John Swales' framework. It instructs students to look at issues of power, authority, and assimilation when newcomers join a discourse community. Students are told to observe a discourse community, collect texts, and interview members to understand how expertise, communication practices, genres, and specialized language contribute to enculturation and the distribution of authority.
Paper InstructionsYou are to research and write a 5-8 page paper.docx
Paper Instructions
You are to research and write a 5-8 page paper (excluding title page and reference pages) on one of the topics listed below. The paper should incorporate references to the course material and a minimum of 6 scholarly sources. The paper should be typed, double spaced using APA formatting, and attached as a file. Your writing should display knowledge, analysis, evaluation, and application of the material you have studied in the course. See the document called “Final Paper Expectations” for a breakdown of the structure and expectations.
As you consider the topic you want to write about, ask yourself what supporting materials from the course, from your personal experiences, and from your researched resources you could bring together to bring the topic to life.
Topics to select from are:
Consider how Martin Buber’s theory of communication plays out in the world. Take into consideration each of the three types of relationships (I-It, I-You, I-Thou).
Abraham Maslow developed his theory of the “Hierarchy of Needs.” How do people use social media to meet their needs?
Discuss your thoughts and the thoughts of the experts about the four types of attachment styles.
Discuss the impact of the media on the development of gender identity.
What are the impacts of long-distance relationships on interpersonal communication?
Martin Luther King, Jr.
(Quotable Quote)
is quoted as saying, “It really boils down to this: that all life is interrelated. We are caught in an inescapable network of mutuality.” What aspects of interpersonal communication apply to this sentiment?
According to Anthony Robbins
(Quotable Quote),
“The quality of your life is the quality of your communication.” How so?
Module 2 told us that “the self arises in communication with others.” Discuss.
Before writing this paper, observe yourself for several days, and whenever you use “you” language, try to rephrase what you said or thought into “I” language. How does that change how you think and feel about what’s happening? How does it affect your interactions with others? Does it make a positive or negative impact? Describe your experiences and then relate your personal findings to what you find in your research.
What labels that you dislike have been applied to you or to groups to which you belong? Explain how the labels affect you. Describe how your experiences relate to what you find in your research.
Who is your prototype, or model, of a listener? Describe what the person does that makes her or him effective? Relate your description to research on listening.
Discuss the differences between differential, assertive, and aggressive communication.
Define and describe what makes a good friend. Describe the investments that are made, how trust, acceptance, and closeness are communicated. How does that compare to what experts say about friends and friendship?
What makes for a successful romantic relationship? Compare your pers.
Enhancing the 21st century critical thinking skills of ESL/EFL learners
The what, why, and how of critical thinking in an ESL/EFL classroom in the new normal and post-pandemic time.
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
Assignment 1: Culture and Communication
In this assignment, you will explore your own cultural and ethnic background and analyze how this background may affect your communication. A great deal of a message is communicated not through spoken words but through the nonverbal channels. Culture and personal experience can play a large role in the transmission and interpretation of nonverbal messages. You will reflect upon your personal experience from the viewpoint of your cultural and ethnic affiliation(s) and compare it with the scholarly literature relevant to your cultural and ethnic background.
Tasks:
Watch the video,
Empathy Training for Ethnic and Cultural Awareness
. Afterwards, identify your cultural and ethnic background. In your response, answer the following questions:
In what ways do you feel your culture affects the way you communicate? (For example, eye contact or the lack of eye contact has a cultural component and can be interpreted as defiance or something similar by those unaware of the cultural context.)
Provide an example of how your culture has influenced nonverbal communication.
Discuss how nonverbal communication could influence whether or not a message is perceived accurately.
How is someone from a different cultural background likely to perceive your message?
Submission Details:
By
Saturday, September 12, 2015
, post your responses in at least 3–4 paragraphs to this
Discussion Area
. Your response should rely upon at least three sources from professional literature. This may include the Argosy University online library resources, relevant textbooks, peer-reviewed journal articles, and websites created by professional organizations, agencies, or institutions (.edu, .org, or .gov). Write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources (i.e., APA format); and use accurate spelling, grammar, and punctuation.
Through
Wednesday, September 16, 2015
, respond to at least two of your classmates' posts. While responding, draw comparisons between the examples you provided and the examples submitted by your classmates, and provide a rationale for the comparisons.
ATTENTION <,The faculty said no sources later thamn 5 years back please and thank you
.
STEP 1 Next, find a text in conversation with your first two that.docx
STEP 1: Next, find a
text in conversation with your first two that that allows for reader/viewer interaction via feedback, online comments, etc.
You can be creative here. For example, you could look at a blog, a series of tweets, a podcast, Instagram posts, online videos, interviews, artwork, ads, etc. as long as the text provides space for interaction from readers/viewers
(like comments, sharing, or liking).
Importantly, again, try to pick a source (or series of sources--if you use something like tweets) that isn't just broadly about the same general topic as the one you used for the last discussion, but one that debates the same question or concern that your previous sources debated/discussed.
NOTE: Try to find a source with information that surprises you or enhances your understanding of the conversation in some way. This will help you write a better analysis.
STEP 2: Once you’ve identified a source to work with, read the text(s) and then write a rhetorical summary. To help you write a rhetorical summary, see
Guiding Questions for Rhetorical Summaries
below. Because your source is so different from the previous sources you used, your answers will probably be very different.
Note: there's a new question below: don't forget to answer it!
Guiding Questions For Researching Rhetorically:
Please use specific examples from the text to support your analysis. Here are some questions to consider.
First, identify the
author
(first name and last name) and title of the piece and where/when it was published. Then identify the core idea of the author’s argument, along with information on
what
they’re arguing and
how
they’re making their argument. (If it's an informative piece, identify what the main goal of the document is and what they are using to support that goal. For example, what are they trying to explain? Why? How?) Your summary should remain an objective report of the article/text, without your commentary or opinion of the author’s argument/information.
Who is the
audience
for the text and what was the author’s purpose? Remember that the audience cannot be "everyone". (For example, does the audience belong to a particular age group? To a specific geographical location? A political affiliation? A specific career or degree of knowledge? Look for clues in the text as to whom the writer thinks is reading.) What is the writer responding to? What do you know about the author/place of publication?
How does the writer use evidence/information? Is the evidence/information reliable? Why or why not?
What is the level of
bias
or degree of advocacy in the medium where this article was published? For example, a newspaper or website might believe something very strongly, to the point that they are very selective in the information they share, or they might be trying to be "neutral". If you look into the newspaper/website/etc, you might get clues. What might you say are the medium’s values? For example, for an article, you mi.
Similar to this is the second (of five)Critical Thinking Postsfor the c.docx (13)
Elements of Critical Thinking [WLOs 2, 3, 4] [CLOs 2, 3, 4]P.docx
Elements of Critical Thinking [WLOs 2, 3, 4] [CLOs 2, 3, 4]P.docx
Task Your task is to follow a conversation in society right now .docx
Task Your task is to follow a conversation in society right now .docx
Reflection Essay #2Explore your own efforts at achieving int.docx
Reflection Essay #2Explore your own efforts at achieving int.docx
Essay #2 Source Integration Paper Rhetorical Situati.docx
Essay #2 Source Integration Paper Rhetorical Situati.docx
Module 7 Discussion Board Algebra1. What does it mean when s.docx
Module 7 Discussion Board Algebra1. What does it mean when s.docx
Project Media Essay Spring 2015 Professor BattyProject Med.docx
Project Media Essay Spring 2015 Professor BattyProject Med.docx
Re-Evaluating Media NeedsDiscussion TitlePrepare This week, y.docx
Re-Evaluating Media NeedsDiscussion TitlePrepare This week, y.docx
Paper InstructionsYou are to research and write a 5-8 page paper.docx
Paper InstructionsYou are to research and write a 5-8 page paper.docx
Enhancing the 21st century critical thinking skills of ESL/EFL learners
Enhancing the 21st century critical thinking skills of ESL/EFL learners
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
STEP 1 Next, find a text in conversation with your first two that.docx
STEP 1 Next, find a text in conversation with your first two that.docx
More from glennf2
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agurre, The Wrath 1972) dir. Werner Herzog
in this critical l journal u just have to talk about the Understated or subversive stylization
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in conjunction with an article.
Read an article on aligning interests with a career. For example:
“When I Grow Up: Lessons scientists would share with their younger selves”
Journal #1: What career interests you the most and why? Explain in
detail your career interest and tell why you feel that you would be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft skills will get you the job.
By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of Washington, employers said entry-level
workers in a variety of professions were lacking in several areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good follower, monitoring the progress, meeting
deadlines and working with others across the organization to achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do they fit
in with your career interest? Based on the soft skills discussed in this
article, discuss one that is a strength for you and one with which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.en/career-advice/six-soft-skills-everyone-needs-hot-jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5332344.
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current module. The assignment requires that you prepare ONE 200-250-word statement in paragraph form to present a snapshot of:
· your point of view (POV) about the module topic (identify this before turning to the assigned reading)
· key evidence and themes pertaining to the module topic that stands out to you upon completing the assigned reading (include endnotes to cite the information you are extracting from the reading)
· a concluding comment and/or question that captures an aspect of your POV after reading the assigned chapter.
The module topic is Regionalism and Internationalism
!"#$%&'(")&*&+,+-"./,"01,2%"3'4"5$4&66,$("7(%,84$%&'(
!1%/'492:-";<"=$4*&(";&>>
?'[email protected],-"A$%&("!B,4&@$("C,2,[email protected]/"C,*&,DE"F'><"GHE"#'<"G"9IJJI:E"KK<"LMLN
O16>&2/,+"6P-"./,"A$%&("!B,4&@$("?%1+&,2"!22'@&$%&'(
?%$6>,"QCA-"http://www.jstor.org/stable/2503626
[email protected]@,22,+-"RSTIRTGRRJ"RS-RU
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless
you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you
may use content in the JSTOR archive only for your personal, non-commercial use.
Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at
http://www.jstor.org/action/showPublisher?publisherCode=lamer.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed
page of such transmission.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected]
The Latin American Studies Association is collaborating with JSTOR to digitize, preserve and extend access to
Latin American Research Review.
http://www.jstor.org
http://www.jstor.org/stable/2503626?origin=JSTOR-pdf
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/action/showPublisher?publisherCode=lamer
A NATION DIVIDED:
The Quest for Caribbean Integration
W. Marvin Will
University of Tulsa
Recognizing that the traditional five-state subregion of Central
America departed from European colonialism as a federated entity, Ralph
Lee Woodward subtitled his seminal history of Central America "A Nation
Divided." In his view, "the social and economic history of the isthmus
suggests that its peoples share considerably in their problems and circum-
stances, even though their political experience has been diverse. But it is
also clear that their so.
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion)
The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency
Solution
s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic.
The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020).
.
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following: Healthy people 2020 is a guide to promote preventative care. Review Primary, Secondary and Tertiary prevention and relate this to women and children at risk in your community. Identify those risk factors that a prevention program could impact the health of the group you identify. Include citations and use APA format. The 500 words does not include the citations.
.
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz: It consists of the vocabulary you learned from Lesson B in Unit 2.
Authorities
Initiate
Sustainable
Contrary to
Controversy
Undeniable
Neglect
Predator
Prey on
Upkeep
You will write your own sentences using each of the vocabulary words. The sentence
must be an
original sentence
created by you, AND it must use the vocabulary word correctly.
Your sentence
MUST
demonstrate that you understand the meaning of the word.
.
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not be overlapped with in-class discussion. Hopefully Fall 2021 we will be back to normal! This final response essay will be due DECEMBER 6 which is an extended deadline. How does Do the Right Thing and Daughters of the Dust balance carefully and deliberate filmmaking with delivering clear messages about social justice? Sometimes when a film tries too hard for a message, the craft of filmmaking might get overlooked. Compare and contrast how these two films do/do not do that with some clear examples of a moral message either reinforcing or compromising the scene/filmmaking.
.
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you can't not have more than 200 words. Please no plagiarism. You can have one or two quotes. Make sure have a topic sentence, answer what, how, why, in what way, who, How does (he/she) know, and so what. Also use the last story, there is three and use the last one about "Don't take notes with a laptop"
.
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions talking about.
Chin, J. L. & Trimble, J. E. (2015).
Diversity and leadership.
Los Angeles, CA: Sage.
The Three Cs of Managing Diversity: Composition-Core-Climate Managing organizational diversity starts with developing an organization’s strategic planning to be inclusive of diversity and directed toward organizational and systemic change. It presumes a commitment to goals of diversity leadership. It makes the business case for training to move leaders and members toward a goal where diversity means good business; it brings in customers, expands the customer base, promotes a climate where all voices are included, and strives toward a workforce composition that is diverse and delivers its products or services in a culturally competent manner. The senior author has defined this to mean addressing the Three Cs of Diversity: recruiting and retaining a diverse Composition of the workforce and clientele, developing the Core of business products and services to be delivered in a culturally competent manner, and promoting a welcoming and inclusive workplace Climate within the organization. Moodian (2009) views contemporary leadership and leadership success as attainable through intercultural competence and stresses the importance of moving away from ethnocentric leadership philosophies given the growing dominance of diverse workforces and greater racial/ethnic heterogeneity of populations in countries throughout the world today. He suggests a strategic planning process or business plan that is inclusive of diversity and offers seven steps toward managing diversity for organizational change. “The business case is about capturing talent, understanding markets, utilizing diverse perspectives for innovation, knowing how and how not to pitch products, and ultimately, how to generate employee commitment” (Moodian, 2009, p. 39). The seven steps include the following: Generating Executive Commitment—Nothing happens in an organization without buy-in from the top. Diversity needs to be a goal embraced by leaders within an organization and starts with a visioning process. Assessment—This process helps the organization understand its current state regarding diversity. This essentially means doing a SWOT analysis of the Three Cs; this might include assessing composition of the workforce and its clientele, assessing policies and procedures that might pose internal barriers for hiring and promotion, assessing climate of the organization for inclusion and respect for all dimensions of diversity, and marketing strategies and business goals that are inclusive of diversity. This helps identify needs, set priorities, and to define goals and objectives for a strategic plan that is inclusive of diversity and provides data to serve as benchmarks. Diversity Council—The establishment of such councils provides a formal mechanism within the organization that serves the purpose of getting feedback to and f.
This is what I need, nothing more or less-All Is removed in th.docx
The document requests editing services to remove all first-person pronouns from an essay, restructure sentences that are fragmented, run-on, or unprofessional, and ensure the formatting is correct according to Chicago style without any changes.
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have discussed is about demonstrating your knowledge of core principles, concepts and theories in your field. Key words in that statement are "demonstrate"......ok, there's only one! :) The most common mistake in this section is that you discuss but do not demonstrate.
Another key to this sentence: Notice that there is nothing in there about classes. We do not want class descriptions - we can look those up in the catalog. We do not want lists of projects you had to do in each class. Focus on the core skills, principles, concepts.....In Graphics class, for example, what is one of the theories you MUST know? Talk about - and then demonstrate that you know it. Tell the story of that concept. Be brief, be specific, then add an example to demonstrate. A chart, a graph, a picture....You may use links as long as you discuss the concept and lead people to the link.
This entire section is maybe 1 1/2 to 2 pages of writing. You will add pictures, charts, graphs, etc.
Finally one more thing to focus on: Writing. Grammar. English...this is a technical paper that might represent you and OSU in the industry. Watch your grammar!
Skeleton Outline Format
Thesis/Central Idea
I. Attention: A sentence summarizing your attention-getting strategy
Transition
II. Main Point 1 (A sentence summarizing the point. This might be the need if you’re doing Monroe’s Motivated Sequence or the problem if you’re doing problem cause solution, the standard of judgment if you’re doing value, etc.).
A. A sentence or two indicating what you want to say/do in this point. Do you want to establish how big/serious this problem is? Show the harms or negative effects? Use one type of evidence or support? Define and explain the issue?
Transition
III. Main Point 2 (A sentence summarizing the point you want to make here. It might be Satisfaction if doing MMS, Cause if doing problem cause solution, etc)
A. Sentence or two indicating what you want to say/do here. Are you going to use a different type of evidence to make your point? Show us why a problem is happening? Prove that your plan/solution can work?
Transition
IV. Main Point 3 (if needed--most speeches will do 3 main points, but it’s possible to have a speech work with just two big ones). This might be solution, visualization, etc.
A. Sentence or two indicating what you want to do here. Do you want to prove how this plan solve the problem, explain how to fix the issue? Show why one solution is better than another?
Transition
V. Conclusion: A sentence indicating what you want to do in the conclusion.
Research on Hand/Research Wanted
Here you should fill out what research/evidence (if any) you already have and what kinds of evidence/research you would still want. Do you want, for example statistics or studies showing the scope of a problem? Expert testimony to explain why something is happening? Examples to help illustrate a complex idea?
.
More from glennf2 (20)
This is the other book link.Any questions please contact via[e.docx
This is the other book link.Any questions please contact via[e.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt Explain the role of reason within theology as it.docx
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another..docx
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.The file is attached.Due date is .docx
This is the worlds most famous operatic soprano at the moment, An.docx
This is the worlds most famous operatic soprano at the moment, An.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in .docx
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current .docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not .docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is what I need, nothing more or less-All Is removed in th.docx
This is what I need, nothing more or less-All Is removed in th.docx
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have d.docx
Recently uploaded
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
Top five deadliest dog breeds in America
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.How to Add Chatter in the odoo 17 ERP Module
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
How to Fix the Import Error in the Odoo 17
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar KanvariaDigital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments Unit - NGV Pavilion Concept Design
CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
DRUGS AND ITS classification slide share
Any substance (other than food) that is used to prevent, diagnose, treat, or relieve symptoms of a
disease or abnormal condition
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...National Information Standards Organization (NISO)
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Recently uploaded (20)
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Pride Month Slides 2024 David Douglas School District
Pride Month Slides 2024 David Douglas School District
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
this is the second (of five)Critical Thinking Postsfor the c.docx
- 1. this is the second (of five) Critical Thinking Posts for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020 . Remember, this is an opportunity for you to take a position on a media and culture issue using your informed opinion by the theory and concepts you are learning about in this course. Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity). Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded. Please write a 12 to 15 sentence response to the following multi-part question: Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what
- 2. you think the differences are in terms of impact on readers. Be specific and to the point.