THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
•Download as DOCX, PDF•
0 likes•2 views
'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion) The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency Solution s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic. The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020). .
Report
Share
Report
Share
Recommended
1Group Term Policy Modification Paper2H.R. 6201 Families .docx
1
Group Term Policy Modification Paper
2
H.R. 6201 Families First Coronavirus Response Act
Group Term Policy Modification Paper:H.R. 6201 Families First Coronavirus Response Act
H.R. 6201 Families First Coronavirus Response Act
Introduction
The outbreak of the coronavirus disease in Wuhan, China, in December 2020 and its spread to other parts of the world has led to significant changes not only in the United States but throughout the world. Globally, the public sector and policymakers have faced the biggest test in generations. New policies have been necessitated by livelihoods and lives hanging in a delicate and terrible balance. Some of the policies put in place are meant to leverage collapsing economies, health cruses, political and social disruption (Washington State Department of Social and Health Services, 2020). The world economy has taken a nosedive. Some international bodies such as WHO and WTO have been working to mitigate the pandemic's adverse effects on a global scale. The script is not different in the national, state, and local effects of coronavirus disease. Both Federal and State Governments have been struggling to contain the spread and impact of the disease on the economy. The pandemic has scaled down economic activities. The U.S. economy has slowed down significantly. Unemployment is growing rapidly. The adverse effects have led to the enactment of several policies to mitigate the impacts (Washington State Department of Social and Health Services, 2020). One of the laws that have been enacted to mitigate the adverse effects of coronavirus disease on the Americans is The Families First Coronavirus Response Act (H.R. 6201). This paper evaluates The H.R. 6201 and how it mitigates coronavirus disease's adverse effects on the Americans. That provides funding for Americans to be able to meet their basic financial needs. It increases funding for food stamps, paid leave (14 days) for those employees experiencing effects of coronavirus disease outbreak, and provides funding for free coronavirus testing areas. Additionally, the bill provides funding to mitigate the ongoing economic consequences of the pandemic, protect front-line health workers, expand food assistance to the vulnerable families and children, and support strong unemployment benefits, among other provisions. For our term policy modification paper we have proposed the following change: Propose Change
A change in our opinion is for the second stimulus to have been passed to all Americans because as of today people are still without a job and seeking. Those workers who have stayed with their jobs have been reduced in their benefits.
Companies with employees less than 500 should be exempted from paying leave to their employees while big companies having more than 500 employees should provide pay leaf otherwise the bill is unfair to small business (Hamilton, 2020)
The Act requires that the employers should provide Emergency Pa.
CEO's Post Pandemic Playbook
The document provides an overview of the four periods characterizing the COVID-19 pandemic from beginning to end: pre-pandemic, peak-pandemic, recovery, and new normal. It describes key events and impacts during each period, including 22 million Americans filing for unemployment during the peak, and the slow and gradual recovery period expected to last months or years as restrictions are loosened. Underneath the pre-pandemic economy's rosy exterior were dormant weaknesses like income inequality that were exacerbated by the pandemic.
Pandemic covid 19
The document discusses the impact of COVID-19 on the life science and healthcare industry in the US. It notes that the pandemic has significantly strained healthcare capacity and caused spending on the sector to increase. The pharmaceutical and medical equipment segments have seen high demand for COVID-19 tests, supplies, and research into vaccines and treatments. Government relief packages have allocated billions towards healthcare services, facilities, and supporting the development of response efforts. Overall, the pandemic is driving major changes across the industry and highlighting vulnerabilities in the US healthcare system.
2020 09 03 COVID-19
COVID-19 amenaza con convertirse en una de las pruebas más difíciles que enfrenta la humanidad en la historia moderna. Como
la pandemia se ha extendido se ha cobrado vidas, ha provocado ansiedad y drama político, ha abrumado la salud
sistemas, y provocó un cambio geopolítico potencialmente duradero. El Fondo Monetario Internacional dice que
La economía mundial se enfrenta ahora a su peor recesión desde la Gran Depresión, y Oxfam Internacional ha
advirtió que 500 millones de personas podrían caer en la pobreza como resultado de la crisis en curso. Alrededor
En el mundo, se están realizando esfuerzos desesperados para contener lo que se ha convertido en un brote profundamente perturbador.
Day 5 - Critical Thinking_Answerbook Section B (new).pdf
The document discusses the roles of governments in responding to the COVID-19 pandemic. It argues that transmission of COVID-19 is largely due to failures by governments in planning, preparing for, and implementing effective pandemic responses. Key government responsibilities include regulating lockdowns and vaccines, coordinating healthcare systems, providing accurate public information, and ensuring access to testing and vaccines across communities. However, the success of government policies also depends on individuals following guidelines. While governments have broad powers to enact measures, commercial entities may prioritize profits over public health. Overall, the document maintains that governments should bear primary responsibility for curbing COVID-19 transmission given their regulatory authority and ability to coordinate responses on a large scale.
K378488
American Research Journal of Humanities & Social Science (ARJHSS) is a double blind peer reviewed, open access journal published by (ARJHSS).
Role of Audit in Economic Recovery-Post Pandemic-SAI India
The coronavirus recession also known as the Great Lockdown or the Great shutdown is a severe global recession since Great Depression 1929-30. It has resulted in shutdown of many businesses like aviation, automobile, hospitality, rail transport etc. causing massive job losses world over.
Effect of Corona Virus on the Shopping Criteria of Lebanese Consumers
Effect of Corona Virus on the Shopping Criteria of Lebanese ConsumersInternational Journal of Business Marketing and Management (IJBMM)
The negative consequences of Covid-19 pandemic from lockdowns of whole countries, travel bans,
and the closure of shops and service points have disrupted the economic and social balance of the whole world.
Consequently, consumer’s buying behavior and their shopping criteria has been negatively affected. In this
research paper we try to find out the changesRecommended
1Group Term Policy Modification Paper2H.R. 6201 Families .docx
1
Group Term Policy Modification Paper
2
H.R. 6201 Families First Coronavirus Response Act
Group Term Policy Modification Paper:H.R. 6201 Families First Coronavirus Response Act
H.R. 6201 Families First Coronavirus Response Act
Introduction
The outbreak of the coronavirus disease in Wuhan, China, in December 2020 and its spread to other parts of the world has led to significant changes not only in the United States but throughout the world. Globally, the public sector and policymakers have faced the biggest test in generations. New policies have been necessitated by livelihoods and lives hanging in a delicate and terrible balance. Some of the policies put in place are meant to leverage collapsing economies, health cruses, political and social disruption (Washington State Department of Social and Health Services, 2020). The world economy has taken a nosedive. Some international bodies such as WHO and WTO have been working to mitigate the pandemic's adverse effects on a global scale. The script is not different in the national, state, and local effects of coronavirus disease. Both Federal and State Governments have been struggling to contain the spread and impact of the disease on the economy. The pandemic has scaled down economic activities. The U.S. economy has slowed down significantly. Unemployment is growing rapidly. The adverse effects have led to the enactment of several policies to mitigate the impacts (Washington State Department of Social and Health Services, 2020). One of the laws that have been enacted to mitigate the adverse effects of coronavirus disease on the Americans is The Families First Coronavirus Response Act (H.R. 6201). This paper evaluates The H.R. 6201 and how it mitigates coronavirus disease's adverse effects on the Americans. That provides funding for Americans to be able to meet their basic financial needs. It increases funding for food stamps, paid leave (14 days) for those employees experiencing effects of coronavirus disease outbreak, and provides funding for free coronavirus testing areas. Additionally, the bill provides funding to mitigate the ongoing economic consequences of the pandemic, protect front-line health workers, expand food assistance to the vulnerable families and children, and support strong unemployment benefits, among other provisions. For our term policy modification paper we have proposed the following change: Propose Change
A change in our opinion is for the second stimulus to have been passed to all Americans because as of today people are still without a job and seeking. Those workers who have stayed with their jobs have been reduced in their benefits.
Companies with employees less than 500 should be exempted from paying leave to their employees while big companies having more than 500 employees should provide pay leaf otherwise the bill is unfair to small business (Hamilton, 2020)
The Act requires that the employers should provide Emergency Pa.
CEO's Post Pandemic Playbook
The document provides an overview of the four periods characterizing the COVID-19 pandemic from beginning to end: pre-pandemic, peak-pandemic, recovery, and new normal. It describes key events and impacts during each period, including 22 million Americans filing for unemployment during the peak, and the slow and gradual recovery period expected to last months or years as restrictions are loosened. Underneath the pre-pandemic economy's rosy exterior were dormant weaknesses like income inequality that were exacerbated by the pandemic.
Pandemic covid 19
The document discusses the impact of COVID-19 on the life science and healthcare industry in the US. It notes that the pandemic has significantly strained healthcare capacity and caused spending on the sector to increase. The pharmaceutical and medical equipment segments have seen high demand for COVID-19 tests, supplies, and research into vaccines and treatments. Government relief packages have allocated billions towards healthcare services, facilities, and supporting the development of response efforts. Overall, the pandemic is driving major changes across the industry and highlighting vulnerabilities in the US healthcare system.
2020 09 03 COVID-19
COVID-19 amenaza con convertirse en una de las pruebas más difíciles que enfrenta la humanidad en la historia moderna. Como
la pandemia se ha extendido se ha cobrado vidas, ha provocado ansiedad y drama político, ha abrumado la salud
sistemas, y provocó un cambio geopolítico potencialmente duradero. El Fondo Monetario Internacional dice que
La economía mundial se enfrenta ahora a su peor recesión desde la Gran Depresión, y Oxfam Internacional ha
advirtió que 500 millones de personas podrían caer en la pobreza como resultado de la crisis en curso. Alrededor
En el mundo, se están realizando esfuerzos desesperados para contener lo que se ha convertido en un brote profundamente perturbador.
Day 5 - Critical Thinking_Answerbook Section B (new).pdf
The document discusses the roles of governments in responding to the COVID-19 pandemic. It argues that transmission of COVID-19 is largely due to failures by governments in planning, preparing for, and implementing effective pandemic responses. Key government responsibilities include regulating lockdowns and vaccines, coordinating healthcare systems, providing accurate public information, and ensuring access to testing and vaccines across communities. However, the success of government policies also depends on individuals following guidelines. While governments have broad powers to enact measures, commercial entities may prioritize profits over public health. Overall, the document maintains that governments should bear primary responsibility for curbing COVID-19 transmission given their regulatory authority and ability to coordinate responses on a large scale.
K378488
American Research Journal of Humanities & Social Science (ARJHSS) is a double blind peer reviewed, open access journal published by (ARJHSS).
Role of Audit in Economic Recovery-Post Pandemic-SAI India
The coronavirus recession also known as the Great Lockdown or the Great shutdown is a severe global recession since Great Depression 1929-30. It has resulted in shutdown of many businesses like aviation, automobile, hospitality, rail transport etc. causing massive job losses world over.
Effect of Corona Virus on the Shopping Criteria of Lebanese Consumers
Effect of Corona Virus on the Shopping Criteria of Lebanese ConsumersInternational Journal of Business Marketing and Management (IJBMM)
The negative consequences of Covid-19 pandemic from lockdowns of whole countries, travel bans,
and the closure of shops and service points have disrupted the economic and social balance of the whole world.
Consequently, consumer’s buying behavior and their shopping criteria has been negatively affected. In this
research paper we try to find out the changesGlobalization and global threats and pandemic threts 21 century
Globalization and global threats and pandemic threts 21 centuryKolegji Universitar BIZNESI - Gjakovë
Globalization has increased risks from international threats like pandemics, environmental degradation, and ethnic violence. Strategies are needed to deal with these threats through improved surveillance, distribution of medicines, and understanding the causes of conflicts. Preventive actions before crises occur are important but difficult for governments. Underlying economic issues from globalization like unemployment and inequality can contribute to these threats if not addressed through education, health programs, and infrastructure investment. International cooperation through organizations like WHO and UN is vital to strengthen global efforts against diseases and support national health systems.Pmac 2
This document provides background information for the Prince Mahidol Award Conference (PMAC) 2021. PMAC 2021 will address lessons learned from the COVID-19 pandemic. It will explore how countries responded to the pandemic, the health and socioeconomic impacts, and how to better prepare for future crises. The conference will be held virtually in January 2021 with webinars beforehand. Topics will include national and international pandemic responses, health system impacts, broader social effects, and visions of a post-COVID world with a reshaped global order.
Issues Facing the economy.docx
This document discusses several economic, social, and personal issues raised by the COVID-19 pandemic according to discussions in online support groups for social workers. Key topics discussed include maintaining essential social services for at-risk populations during lockdowns, reinventing service delivery models to enable physical distancing, managing child protection cases remotely, balancing personal and professional responsibilities, and developing self-care strategies to prevent burnout. The groups provided a space for social workers to share challenges, solutions, and emotional support during an uncertain time.
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
AKMAN HÜSEYİN VEDAT,KIZIL CEVDET (2020). Unemployment Problem and Global Financing Related to COVID-19 Epidemic. International Asian Congress of Contemporary Sciences - IV (Tam Metin Bildiri/Sözlü Sunum)
B390814
American Research Journal of Humanities & Social Science (ARJHSS) is a double blind peer reviewed, open access journal published by (ARJHSS).
HCS 410(2) ACA Tittle IV-Prevention of Chronic diseases
The document summarizes key aspects of the Affordable Care Act as it relates to prevention and wellness. It describes how the ACA aims to promote prevention, fund public health initiatives, and reduce chronic disease. It discusses provisions such as banning pre-existing condition exclusions, covering preventive services with no cost sharing, and investing in community-based prevention programs. However, it also notes that Republicans questioned whether these prevention initiatives were worth funding.
8. On the likely aftermath and long term effects of the coronavi.docx
8. On the likely aftermath and long term effects of the coronavirus outbreak on business and society (Module 12)
This discussion board is devoted to the likely aftermath and long term consequences of the coronavirus for business and society. We will be posting some reading material related to this topic in Module 12.
respond 1
Effects of the Coronavirus Outbreak on Business and Society
The coronavirus outbreak has not only led to a massive loss of life globally but also altered social and economic structures in a manner that will persist for a long time. As the pandemic continues devastating communities across the globe, wealth has emerged as the best defense against catastrophes. Wealthy individuals have invested in systems that allow them to work from home to minimize interactions and avoid contracting the virus (Bonacini et al., 2021). Less wealthy individuals cannot afford to stay at home because most of them rely on daily wages to meet their basic needs. Additionally, low-income earners might not avoid interactions because most of them live in places with crowded housing. Moreover, Covid-19 has increased the health burden on low-income earners while decreasing job opportunities. Therefore, the pandemic is likely to exacerbate the economic inequality in society because the rich are amassing more wealth while the poor are suffering from high unemployment.
Besides increasing inequality, the pandemic will transform working habits in the future owing to company responses to regulations aimed at curbing the virus’s spread. At the onset of Covid-19, governments established regulations to restrict people's movement. These rules have changed business practices, promoting working from home and demonstrating the importance of technology in the corporate world. The change from working in offices to operating from home is likely to be permanent because most employers are beginning to question the purpose of a workplace. Over time, companies will establish effective policies to facilitate working from home, making it the new norm in business. Likewise, organizations will embrace technology more to serve customers who have shifted to online shopping to decrease physical interactions.
Reference
Bonacini, L., Gallo, G., & Scicchitano, S. (2021). Working from home and income inequality: Risks of a ‘new normal’ with COVID-19.
Journal of Population Economics, 34
(1), 303-360.
respond 2
ong Term Effects of COVID-19 on Business and Society
As we can and have seen, there have been and will continue to be long-term effects on how COVID-19 can and will impact business and society moving forward. Businesses will likely see a resurgence of possible re-closings. Depending on where you're located in our country, many businesses that were able to re-open may have to close again due to sparks in new COVID-19 cases. While it seems more people are no becoming vaccinated, the likelihood of this is still very evident. Many companies have learned from ini.
Ipsos 20 mar - corporate reputation and coronav - en
This document summarizes Ipsos' perspective on how corporations should respond to the coronavirus pandemic to protect public health and their reputations. It finds that while the public does not hold businesses primarily responsible for combating the virus, they still expect them to take measures to prevent spread. Ipsos recommends that businesses combat misinformation, understand their risk profile, engage in open and consistent communication, and stay informed on changing public and employee expectations as the situation evolves. The document provides data on shifting public perceptions of industry responsibilities and actions businesses should and have taken in response to the pandemic.
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
International Asian Congress of Contemporary Sciences - IV
Haziran 26-28, 2020
Baku, Azerbaijan/ Khazar University
https://www.asyakongresi.org/
“Unemployment Problem and Global Financing Related to COVID-19 Epidemic”
Dr. Öğr. Üyesi H. Vedat AKMAN / Beykent Üniversitesi, İİBF, Finans ve Bankacılık Bölümü
İstanbul, Türkiye
vedatakman@beykent.edu.tr
https://orcid.org/0000-0001-9950-8223
Health Care Reform Essay
Essay about Health Care Reform
Healthcare reform Essay
Health Care Reform Essay
Health Care Reform Essay
Health Care Reform Essay
Essay On Health Care Reform
The On Health Care Reform
Health Care Reform
Healthcare in the United States Essay
Essay Health Care Reform
Essay About Health Care Reform
This document discusses health care reform in the United States. It provides background on universal health care systems originating in Germany and Britain in the late 19th/early 20th centuries. It then discusses the Patient Protection and Affordable Care Act passed in 2010 in the US, which aimed to expand health insurance coverage. The document notes criticisms of both the German and US healthcare systems. It argues the German system distributes care fairly through government involvement, unlike the US approach of developing mass assistance programs and stating government should not control them.
Economic and Social Impact of Covid
Detailed write up on the impact of COVID on various aspects of life. This was published in the Mumbai university Research Journal in the month of June 2020.
Fact and opinion about covid 19 outbreak
This document discusses the Covid-19 outbreak in Indonesia. It provides background on the origins and spread of the virus globally and in Indonesia. Key points discussed include the economic and social impacts of the outbreak in Indonesia, including lockdown policies implemented by the government and their effects. The document also examines the pressure the outbreak has put on healthcare systems and risks to medical workers. It concludes by emphasizing the importance of following government regulations and maintaining calm during the pandemic.
The On Health Care Reform
The document discusses health care reform in the United States and Canada. It explains that the development of health insurance in the two countries started to diverge, with Canada adopting a universal health care system while the US maintained a private system. The US has struggled to pass significant reform due to political obstacles, while Canada implemented a system of public administration and universal access. The document analyzes the different societal and political factors that influenced the diverging paths each country took with health care reform and policy.
The Things You Should Known About Covid-19 Exam / project English 2 or II Eng...
COVID-19 first emerged in Wuhan, China in December 2019 and was declared a pandemic by the WHO in March 2020. It has caused over 16,600 deaths worldwide and infected over 380,000 people. The document discusses Indonesia's response to the outbreak, including an initial 14-day lockdown to limit transmission. It also explains the importance of compliance with government policies like social distancing to avoid panic and reduce spread. Spreading misinformation about COVID-19 can result in legal penalties under Indonesian law.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
As of 1st October 2020, over 2,000 incarcerated individuals and over.docx
As of 1st October 2020, over 2,000 incarcerated individuals and over 700 employees in the US correctional facilities had been infected with COVID-19. As a result, the Federal Correctional Facilities COVID-19 response Act was introduced on 2nd February 2021 to the senate (“Federal Correctional Facilities COVID–19 Response Act,” 2021). The bill was introduced to curb inefficiencies noted in correctional facilities regarding testing and timely reporting of COVID-19 cases. Due to the desperate situation witnessed on a worldwide level, the Act will require correctional facilities to assess and conduct weekly COVID-19 testing and prior reporting to the relevant authorities. Centers for CDC will also be required in various correctional facilities with qualified officials to aid in managing and controlling further outbreaks on the same. Additionally, the CDC officials will be required to perform basic education on maintaining safety guidelines and ensure the Attorney General has submitted reports regularly to Congress on the developing and current efforts of combating COVID-19 in the correctional facilities.
The proposed bill is satisfactory enough to guarantee its relevancy in the community due to the worrying numbers witnessed in the state daily. The policy effectiveness feasibility loop (PEFL) amalgamates epidemiological modeling, local situation formulation, and policy option appraisal in fully involving policymakers (O’Donnell et al., 2017). The COVID-19 pandemic presents more than enough prevalence and rising death tolls that calls for immediate countermeasures for prevention that would reduce costs and associated overpopulation in hospitals that consequently, puts the patients at more risk. Evidence-based research led to the health policy that advocated for vaccination of children under the age of two years. This was due to the prevalence of attacks such as measles and tuberculosis as early as six-month-old babies (Miller et al., 2020). The case of the proposed Act has been documented by literature that affects public safety and wellbeing. The evidence presented is not just hearsay, but rather derived from trending and documented data that is analyzed and determined accordingly by relevant professionals in the field. Additionally, the Federal Correctional Facilities COVID-19 response Act could be a stepping stone for collective intervention measures in terms of budget and personnel allocation along with the development of a long-lasting solution, such as the case with developed vaccines on the same (Williams et al., 2020).
.
COVID-19 and its Impact on the Biopharma Financing and Deal Environment
The document provides an overview of the impact of the COVID-19 pandemic on the biopharmaceutical sector. It discusses the direct impact on the pharmaceutical industry, including decreased healthcare utilization, clinical trial delays, supply chain issues, and decreased drug usage and revenue. It also covers the indirect effects, such as potential government budget constraints, drug price pressures, increased social division, and response from regulators to encourage testing and device approvals during the pandemic.
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
More Related Content
Similar to THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
Globalization and global threats and pandemic threts 21 century
Globalization and global threats and pandemic threts 21 centuryKolegji Universitar BIZNESI - Gjakovë
Globalization has increased risks from international threats like pandemics, environmental degradation, and ethnic violence. Strategies are needed to deal with these threats through improved surveillance, distribution of medicines, and understanding the causes of conflicts. Preventive actions before crises occur are important but difficult for governments. Underlying economic issues from globalization like unemployment and inequality can contribute to these threats if not addressed through education, health programs, and infrastructure investment. International cooperation through organizations like WHO and UN is vital to strengthen global efforts against diseases and support national health systems.Pmac 2
This document provides background information for the Prince Mahidol Award Conference (PMAC) 2021. PMAC 2021 will address lessons learned from the COVID-19 pandemic. It will explore how countries responded to the pandemic, the health and socioeconomic impacts, and how to better prepare for future crises. The conference will be held virtually in January 2021 with webinars beforehand. Topics will include national and international pandemic responses, health system impacts, broader social effects, and visions of a post-COVID world with a reshaped global order.
Issues Facing the economy.docx
This document discusses several economic, social, and personal issues raised by the COVID-19 pandemic according to discussions in online support groups for social workers. Key topics discussed include maintaining essential social services for at-risk populations during lockdowns, reinventing service delivery models to enable physical distancing, managing child protection cases remotely, balancing personal and professional responsibilities, and developing self-care strategies to prevent burnout. The groups provided a space for social workers to share challenges, solutions, and emotional support during an uncertain time.
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
AKMAN HÜSEYİN VEDAT,KIZIL CEVDET (2020). Unemployment Problem and Global Financing Related to COVID-19 Epidemic. International Asian Congress of Contemporary Sciences - IV (Tam Metin Bildiri/Sözlü Sunum)
B390814
American Research Journal of Humanities & Social Science (ARJHSS) is a double blind peer reviewed, open access journal published by (ARJHSS).
HCS 410(2) ACA Tittle IV-Prevention of Chronic diseases
The document summarizes key aspects of the Affordable Care Act as it relates to prevention and wellness. It describes how the ACA aims to promote prevention, fund public health initiatives, and reduce chronic disease. It discusses provisions such as banning pre-existing condition exclusions, covering preventive services with no cost sharing, and investing in community-based prevention programs. However, it also notes that Republicans questioned whether these prevention initiatives were worth funding.
8. On the likely aftermath and long term effects of the coronavi.docx
8. On the likely aftermath and long term effects of the coronavirus outbreak on business and society (Module 12)
This discussion board is devoted to the likely aftermath and long term consequences of the coronavirus for business and society. We will be posting some reading material related to this topic in Module 12.
respond 1
Effects of the Coronavirus Outbreak on Business and Society
The coronavirus outbreak has not only led to a massive loss of life globally but also altered social and economic structures in a manner that will persist for a long time. As the pandemic continues devastating communities across the globe, wealth has emerged as the best defense against catastrophes. Wealthy individuals have invested in systems that allow them to work from home to minimize interactions and avoid contracting the virus (Bonacini et al., 2021). Less wealthy individuals cannot afford to stay at home because most of them rely on daily wages to meet their basic needs. Additionally, low-income earners might not avoid interactions because most of them live in places with crowded housing. Moreover, Covid-19 has increased the health burden on low-income earners while decreasing job opportunities. Therefore, the pandemic is likely to exacerbate the economic inequality in society because the rich are amassing more wealth while the poor are suffering from high unemployment.
Besides increasing inequality, the pandemic will transform working habits in the future owing to company responses to regulations aimed at curbing the virus’s spread. At the onset of Covid-19, governments established regulations to restrict people's movement. These rules have changed business practices, promoting working from home and demonstrating the importance of technology in the corporate world. The change from working in offices to operating from home is likely to be permanent because most employers are beginning to question the purpose of a workplace. Over time, companies will establish effective policies to facilitate working from home, making it the new norm in business. Likewise, organizations will embrace technology more to serve customers who have shifted to online shopping to decrease physical interactions.
Reference
Bonacini, L., Gallo, G., & Scicchitano, S. (2021). Working from home and income inequality: Risks of a ‘new normal’ with COVID-19.
Journal of Population Economics, 34
(1), 303-360.
respond 2
ong Term Effects of COVID-19 on Business and Society
As we can and have seen, there have been and will continue to be long-term effects on how COVID-19 can and will impact business and society moving forward. Businesses will likely see a resurgence of possible re-closings. Depending on where you're located in our country, many businesses that were able to re-open may have to close again due to sparks in new COVID-19 cases. While it seems more people are no becoming vaccinated, the likelihood of this is still very evident. Many companies have learned from ini.
Ipsos 20 mar - corporate reputation and coronav - en
This document summarizes Ipsos' perspective on how corporations should respond to the coronavirus pandemic to protect public health and their reputations. It finds that while the public does not hold businesses primarily responsible for combating the virus, they still expect them to take measures to prevent spread. Ipsos recommends that businesses combat misinformation, understand their risk profile, engage in open and consistent communication, and stay informed on changing public and employee expectations as the situation evolves. The document provides data on shifting public perceptions of industry responsibilities and actions businesses should and have taken in response to the pandemic.
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
International Asian Congress of Contemporary Sciences - IV
Haziran 26-28, 2020
Baku, Azerbaijan/ Khazar University
https://www.asyakongresi.org/
“Unemployment Problem and Global Financing Related to COVID-19 Epidemic”
Dr. Öğr. Üyesi H. Vedat AKMAN / Beykent Üniversitesi, İİBF, Finans ve Bankacılık Bölümü
İstanbul, Türkiye
vedatakman@beykent.edu.tr
https://orcid.org/0000-0001-9950-8223
Health Care Reform Essay
Essay about Health Care Reform
Healthcare reform Essay
Health Care Reform Essay
Health Care Reform Essay
Health Care Reform Essay
Essay On Health Care Reform
The On Health Care Reform
Health Care Reform
Healthcare in the United States Essay
Essay Health Care Reform
Essay About Health Care Reform
This document discusses health care reform in the United States. It provides background on universal health care systems originating in Germany and Britain in the late 19th/early 20th centuries. It then discusses the Patient Protection and Affordable Care Act passed in 2010 in the US, which aimed to expand health insurance coverage. The document notes criticisms of both the German and US healthcare systems. It argues the German system distributes care fairly through government involvement, unlike the US approach of developing mass assistance programs and stating government should not control them.
Economic and Social Impact of Covid
Detailed write up on the impact of COVID on various aspects of life. This was published in the Mumbai university Research Journal in the month of June 2020.
Fact and opinion about covid 19 outbreak
This document discusses the Covid-19 outbreak in Indonesia. It provides background on the origins and spread of the virus globally and in Indonesia. Key points discussed include the economic and social impacts of the outbreak in Indonesia, including lockdown policies implemented by the government and their effects. The document also examines the pressure the outbreak has put on healthcare systems and risks to medical workers. It concludes by emphasizing the importance of following government regulations and maintaining calm during the pandemic.
The On Health Care Reform
The document discusses health care reform in the United States and Canada. It explains that the development of health insurance in the two countries started to diverge, with Canada adopting a universal health care system while the US maintained a private system. The US has struggled to pass significant reform due to political obstacles, while Canada implemented a system of public administration and universal access. The document analyzes the different societal and political factors that influenced the diverging paths each country took with health care reform and policy.
The Things You Should Known About Covid-19 Exam / project English 2 or II Eng...
COVID-19 first emerged in Wuhan, China in December 2019 and was declared a pandemic by the WHO in March 2020. It has caused over 16,600 deaths worldwide and infected over 380,000 people. The document discusses Indonesia's response to the outbreak, including an initial 14-day lockdown to limit transmission. It also explains the importance of compliance with government policies like social distancing to avoid panic and reduce spread. Spreading misinformation about COVID-19 can result in legal penalties under Indonesian law.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
Discussions Response please treat each Discussions Response separately Dalt.docx
The COVID-19 pandemic has profoundly impacted healthcare systems globally. In the US, the financial strain of the pandemic has increased medical debt by over 25% according to one report. This large financial burden can negatively impact individuals' long-term health and lead to exhausted hospital resources. Governments and organizations must work to ensure equitable access to healthcare during and after the pandemic, such as through public funding and expanding telehealth. The Bradley/Piekoff COVID-19 Forum is a unique initiative that organizes regional healthcare providers to discuss issues related to COVID-19, allowing sector experts to address topics essential for those seeking medical support such as vaccine distribution. The forum also keeps communities informed of new virus developments and treatments through online resources.
As of 1st October 2020, over 2,000 incarcerated individuals and over.docx
As of 1st October 2020, over 2,000 incarcerated individuals and over 700 employees in the US correctional facilities had been infected with COVID-19. As a result, the Federal Correctional Facilities COVID-19 response Act was introduced on 2nd February 2021 to the senate (“Federal Correctional Facilities COVID–19 Response Act,” 2021). The bill was introduced to curb inefficiencies noted in correctional facilities regarding testing and timely reporting of COVID-19 cases. Due to the desperate situation witnessed on a worldwide level, the Act will require correctional facilities to assess and conduct weekly COVID-19 testing and prior reporting to the relevant authorities. Centers for CDC will also be required in various correctional facilities with qualified officials to aid in managing and controlling further outbreaks on the same. Additionally, the CDC officials will be required to perform basic education on maintaining safety guidelines and ensure the Attorney General has submitted reports regularly to Congress on the developing and current efforts of combating COVID-19 in the correctional facilities.
The proposed bill is satisfactory enough to guarantee its relevancy in the community due to the worrying numbers witnessed in the state daily. The policy effectiveness feasibility loop (PEFL) amalgamates epidemiological modeling, local situation formulation, and policy option appraisal in fully involving policymakers (O’Donnell et al., 2017). The COVID-19 pandemic presents more than enough prevalence and rising death tolls that calls for immediate countermeasures for prevention that would reduce costs and associated overpopulation in hospitals that consequently, puts the patients at more risk. Evidence-based research led to the health policy that advocated for vaccination of children under the age of two years. This was due to the prevalence of attacks such as measles and tuberculosis as early as six-month-old babies (Miller et al., 2020). The case of the proposed Act has been documented by literature that affects public safety and wellbeing. The evidence presented is not just hearsay, but rather derived from trending and documented data that is analyzed and determined accordingly by relevant professionals in the field. Additionally, the Federal Correctional Facilities COVID-19 response Act could be a stepping stone for collective intervention measures in terms of budget and personnel allocation along with the development of a long-lasting solution, such as the case with developed vaccines on the same (Williams et al., 2020).
.
COVID-19 and its Impact on the Biopharma Financing and Deal Environment
The document provides an overview of the impact of the COVID-19 pandemic on the biopharmaceutical sector. It discusses the direct impact on the pharmaceutical industry, including decreased healthcare utilization, clinical trial delays, supply chain issues, and decreased drug usage and revenue. It also covers the indirect effects, such as potential government budget constraints, drug price pressures, increased social division, and response from regulators to encourage testing and device approvals during the pandemic.
Similar to THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx (20)
Globalization and global threats and pandemic threts 21 century
Globalization and global threats and pandemic threts 21 century
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
HCS 410(2) ACA Tittle IV-Prevention of Chronic diseases
HCS 410(2) ACA Tittle IV-Prevention of Chronic diseases
8. On the likely aftermath and long term effects of the coronavi.docx
8. On the likely aftermath and long term effects of the coronavi.docx
Ipsos 20 mar - corporate reputation and coronav - en
Ipsos 20 mar - corporate reputation and coronav - en
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
Unemployment Problem and Global Financing Related to COVID-19 Epidemic
The Things You Should Known About Covid-19 Exam / project English 2 or II Eng...
The Things You Should Known About Covid-19 Exam / project English 2 or II Eng...
Discussions Response please treat each Discussions Response separately Dalt.docx
Discussions Response please treat each Discussions Response separately Dalt.docx
Discussions Response please treat each Discussions Response separately Dalt.docx
Discussions Response please treat each Discussions Response separately Dalt.docx
Discussions Response please treat each Discussions Response separately Dalt.docx
Discussions Response please treat each Discussions Response separately Dalt.docx
As of 1st October 2020, over 2,000 incarcerated individuals and over.docx
As of 1st October 2020, over 2,000 incarcerated individuals and over.docx
COVID-19 and its Impact on the Biopharma Financing and Deal Environment
COVID-19 and its Impact on the Biopharma Financing and Deal Environment
More from glennf2
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agurre, The Wrath 1972) dir. Werner Herzog
in this critical l journal u just have to talk about the Understated or subversive stylization
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in conjunction with an article.
Read an article on aligning interests with a career. For example:
“When I Grow Up: Lessons scientists would share with their younger selves”
Journal #1: What career interests you the most and why? Explain in
detail your career interest and tell why you feel that you would be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft skills will get you the job.
By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of Washington, employers said entry-level
workers in a variety of professions were lacking in several areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good follower, monitoring the progress, meeting
deadlines and working with others across the organization to achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do they fit
in with your career interest? Based on the soft skills discussed in this
article, discuss one that is a strength for you and one with which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.en/career-advice/six-soft-skills-everyone-needs-hot-jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5332344.
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current module. The assignment requires that you prepare ONE 200-250-word statement in paragraph form to present a snapshot of:
· your point of view (POV) about the module topic (identify this before turning to the assigned reading)
· key evidence and themes pertaining to the module topic that stands out to you upon completing the assigned reading (include endnotes to cite the information you are extracting from the reading)
· a concluding comment and/or question that captures an aspect of your POV after reading the assigned chapter.
The module topic is Regionalism and Internationalism
!"#$%&'(")&*&+,+-"./,"01,2%"3'4"5$4&66,$("7(%,84$%&'(
!1%/'492:-";<"=$4*&(";&>>
?'[email protected],-"A$%&("!B,4&@$("C,2,[email protected]/"C,*&,DE"F'><"GHE"#'<"G"9IJJI:E"KK<"LMLN
O16>&2/,+"6P-"./,"A$%&("!B,4&@$("?%1+&,2"!22'@&$%&'(
?%$6>,"QCA-"http://www.jstor.org/stable/2503626
[email protected]@,22,+-"RSTIRTGRRJ"RS-RU
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless
you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you
may use content in the JSTOR archive only for your personal, non-commercial use.
Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at
http://www.jstor.org/action/showPublisher?publisherCode=lamer.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed
page of such transmission.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected]
The Latin American Studies Association is collaborating with JSTOR to digitize, preserve and extend access to
Latin American Research Review.
http://www.jstor.org
http://www.jstor.org/stable/2503626?origin=JSTOR-pdf
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/action/showPublisher?publisherCode=lamer
A NATION DIVIDED:
The Quest for Caribbean Integration
W. Marvin Will
University of Tulsa
Recognizing that the traditional five-state subregion of Central
America departed from European colonialism as a federated entity, Ralph
Lee Woodward subtitled his seminal history of Central America "A Nation
Divided." In his view, "the social and economic history of the isthmus
suggests that its peoples share considerably in their problems and circum-
stances, even though their political experience has been diverse. But it is
also clear that their so.
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following: Healthy people 2020 is a guide to promote preventative care. Review Primary, Secondary and Tertiary prevention and relate this to women and children at risk in your community. Identify those risk factors that a prevention program could impact the health of the group you identify. Include citations and use APA format. The 500 words does not include the citations.
.
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz: It consists of the vocabulary you learned from Lesson B in Unit 2.
Authorities
Initiate
Sustainable
Contrary to
Controversy
Undeniable
Neglect
Predator
Prey on
Upkeep
You will write your own sentences using each of the vocabulary words. The sentence
must be an
original sentence
created by you, AND it must use the vocabulary word correctly.
Your sentence
MUST
demonstrate that you understand the meaning of the word.
.
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not be overlapped with in-class discussion. Hopefully Fall 2021 we will be back to normal! This final response essay will be due DECEMBER 6 which is an extended deadline. How does Do the Right Thing and Daughters of the Dust balance carefully and deliberate filmmaking with delivering clear messages about social justice? Sometimes when a film tries too hard for a message, the craft of filmmaking might get overlooked. Compare and contrast how these two films do/do not do that with some clear examples of a moral message either reinforcing or compromising the scene/filmmaking.
.
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you can't not have more than 200 words. Please no plagiarism. You can have one or two quotes. Make sure have a topic sentence, answer what, how, why, in what way, who, How does (he/she) know, and so what. Also use the last story, there is three and use the last one about "Don't take notes with a laptop"
.
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions talking about.
Chin, J. L. & Trimble, J. E. (2015).
Diversity and leadership.
Los Angeles, CA: Sage.
The Three Cs of Managing Diversity: Composition-Core-Climate Managing organizational diversity starts with developing an organization’s strategic planning to be inclusive of diversity and directed toward organizational and systemic change. It presumes a commitment to goals of diversity leadership. It makes the business case for training to move leaders and members toward a goal where diversity means good business; it brings in customers, expands the customer base, promotes a climate where all voices are included, and strives toward a workforce composition that is diverse and delivers its products or services in a culturally competent manner. The senior author has defined this to mean addressing the Three Cs of Diversity: recruiting and retaining a diverse Composition of the workforce and clientele, developing the Core of business products and services to be delivered in a culturally competent manner, and promoting a welcoming and inclusive workplace Climate within the organization. Moodian (2009) views contemporary leadership and leadership success as attainable through intercultural competence and stresses the importance of moving away from ethnocentric leadership philosophies given the growing dominance of diverse workforces and greater racial/ethnic heterogeneity of populations in countries throughout the world today. He suggests a strategic planning process or business plan that is inclusive of diversity and offers seven steps toward managing diversity for organizational change. “The business case is about capturing talent, understanding markets, utilizing diverse perspectives for innovation, knowing how and how not to pitch products, and ultimately, how to generate employee commitment” (Moodian, 2009, p. 39). The seven steps include the following: Generating Executive Commitment—Nothing happens in an organization without buy-in from the top. Diversity needs to be a goal embraced by leaders within an organization and starts with a visioning process. Assessment—This process helps the organization understand its current state regarding diversity. This essentially means doing a SWOT analysis of the Three Cs; this might include assessing composition of the workforce and its clientele, assessing policies and procedures that might pose internal barriers for hiring and promotion, assessing climate of the organization for inclusion and respect for all dimensions of diversity, and marketing strategies and business goals that are inclusive of diversity. This helps identify needs, set priorities, and to define goals and objectives for a strategic plan that is inclusive of diversity and provides data to serve as benchmarks. Diversity Council—The establishment of such councils provides a formal mechanism within the organization that serves the purpose of getting feedback to and f.
This is what I need, nothing more or less-All Is removed in th.docx
The document requests editing services to remove all first-person pronouns from an essay, restructure sentences that are fragmented, run-on, or unprofessional, and ensure the formatting is correct according to Chicago style without any changes.
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have discussed is about demonstrating your knowledge of core principles, concepts and theories in your field. Key words in that statement are "demonstrate"......ok, there's only one! :) The most common mistake in this section is that you discuss but do not demonstrate.
Another key to this sentence: Notice that there is nothing in there about classes. We do not want class descriptions - we can look those up in the catalog. We do not want lists of projects you had to do in each class. Focus on the core skills, principles, concepts.....In Graphics class, for example, what is one of the theories you MUST know? Talk about - and then demonstrate that you know it. Tell the story of that concept. Be brief, be specific, then add an example to demonstrate. A chart, a graph, a picture....You may use links as long as you discuss the concept and lead people to the link.
This entire section is maybe 1 1/2 to 2 pages of writing. You will add pictures, charts, graphs, etc.
Finally one more thing to focus on: Writing. Grammar. English...this is a technical paper that might represent you and OSU in the industry. Watch your grammar!
Skeleton Outline Format
Thesis/Central Idea
I. Attention: A sentence summarizing your attention-getting strategy
Transition
II. Main Point 1 (A sentence summarizing the point. This might be the need if you’re doing Monroe’s Motivated Sequence or the problem if you’re doing problem cause solution, the standard of judgment if you’re doing value, etc.).
A. A sentence or two indicating what you want to say/do in this point. Do you want to establish how big/serious this problem is? Show the harms or negative effects? Use one type of evidence or support? Define and explain the issue?
Transition
III. Main Point 2 (A sentence summarizing the point you want to make here. It might be Satisfaction if doing MMS, Cause if doing problem cause solution, etc)
A. Sentence or two indicating what you want to say/do here. Are you going to use a different type of evidence to make your point? Show us why a problem is happening? Prove that your plan/solution can work?
Transition
IV. Main Point 3 (if needed--most speeches will do 3 main points, but it’s possible to have a speech work with just two big ones). This might be solution, visualization, etc.
A. Sentence or two indicating what you want to do here. Do you want to prove how this plan solve the problem, explain how to fix the issue? Show why one solution is better than another?
Transition
V. Conclusion: A sentence indicating what you want to do in the conclusion.
Research on Hand/Research Wanted
Here you should fill out what research/evidence (if any) you already have and what kinds of evidence/research you would still want. Do you want, for example statistics or studies showing the scope of a problem? Expert testimony to explain why something is happening? Examples to help illustrate a complex idea?
.
More from glennf2 (20)
This is the other book link.Any questions please contact via[e.docx
This is the other book link.Any questions please contact via[e.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt Explain the role of reason within theology as it.docx
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another..docx
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.The file is attached.Due date is .docx
This is the worlds most famous operatic soprano at the moment, An.docx
This is the worlds most famous operatic soprano at the moment, An.docx
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)Critical Thinking Postsfor the c.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in .docx
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current .docx
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not .docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is what I need, nothing more or less-All Is removed in th.docx
This is what I need, nothing more or less-All Is removed in th.docx
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have d.docx
Recently uploaded
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS Template 2023-2024 by: Irene S. Rueco
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.CACJapan - GROUP Presentation 1- Wk 4.pdf
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...Nguyen Thanh Tu Collection
https://app.box.com/s/y977uz6bpd3af4qsebv7r9b7s21935vdTop five deadliest dog breeds in America
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
Your Skill Boost Masterclass: Strategies for Effective Upskilling
Your Skill Boost Masterclass: Strategies for Effective UpskillingExcellence Foundation for South Sudan
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
PCOS corelations and management through Ayurveda.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar KanvariaThe simplified electron and muon model, Oscillating Spacetime: The Foundation...
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
Recently uploaded (20)
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
Your Skill Boost Masterclass: Strategies for Effective Upskilling
Your Skill Boost Masterclass: Strategies for Effective Upskilling
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
- 1. 'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion) The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency Solution s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for
- 2. Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic. The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses.
- 3. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020).