This is the third (of five)Critical Thinking Postsfor the co.docx
•Download as DOCX, PDF•
0 likes•2 views
This is the third (of five) Critical Thinking Posts for the course. It must be posted on Canvas by 8pm on Friday, January 10th, 2020 . Remember, this is an opportunity for you to take a position on a media and culture issue using your informed opinion by the theory and concepts you are learning about in this course. Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity). Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded. Please write a 12 to 15 sentence response to the following multi-part question: What are your current online music listening habits? Do you use platforms like Spotify, Soundcloud, or Pandora? How often do you use these types of sites for music? Are they changing your music taste? Introducing you to new genres? New cultures? .
Report
Share
Report
Share
Recommended
This is the fourth (of five)Critical Thinking Postsfor the c.docx
This is the fourth (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Tuesday, January 14th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Have your radio listening habits changed over your life thus far? How do you think personal music players such as the iPod and music streaming apps like
iHeart Radio
changed radio formats and usage?
.
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This is the first (of five) Critical Thinking Postsfor the cou.docx
This is the first (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Monday, January 6th, 2020
.
This is an opportunity for you to take a position on a
media and culture issue
using your
informed opinion
by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 10 to 12 sentence response to the following multi-part question:
Is there really a value in
media
convergence
for society? Is yes, give some specific examples of converged media that benefits society and clearly state why? If not, give some specific examples of converged media that does NOT benefit society and clearly state why not?
.
Assignment 3 Views on Diversity FOR SOLUTIONS PRO.Pablo.docx
Assignment 3: Views on Diversity
**FOR SOLUTIONS PRO.**
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection,
you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
by
Wednesday, June 15, 2016
. Your response should be
at least two pages long
. All written assignments and responses should follow APA rules for attributing sources.
.
Assignment 3 Views on DiversityPablo believes that diversity is t.docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, December 16, 2015
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
.
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
Assignment 1: Culture and Communication
In this assignment, you will explore your own cultural and ethnic background and analyze how this background may affect your communication. A great deal of a message is communicated not through spoken words but through the nonverbal channels. Culture and personal experience can play a large role in the transmission and interpretation of nonverbal messages. You will reflect upon your personal experience from the viewpoint of your cultural and ethnic affiliation(s) and compare it with the scholarly literature relevant to your cultural and ethnic background.
Tasks:
Watch the video,
Empathy Training for Ethnic and Cultural Awareness
. Afterwards, identify your cultural and ethnic background. In your response, answer the following questions:
In what ways do you feel your culture affects the way you communicate? (For example, eye contact or the lack of eye contact has a cultural component and can be interpreted as defiance or something similar by those unaware of the cultural context.)
Provide an example of how your culture has influenced nonverbal communication.
Discuss how nonverbal communication could influence whether or not a message is perceived accurately.
How is someone from a different cultural background likely to perceive your message?
Submission Details:
By
Saturday, September 12, 2015
, post your responses in at least 3–4 paragraphs to this
Discussion Area
. Your response should rely upon at least three sources from professional literature. This may include the Argosy University online library resources, relevant textbooks, peer-reviewed journal articles, and websites created by professional organizations, agencies, or institutions (.edu, .org, or .gov). Write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources (i.e., APA format); and use accurate spelling, grammar, and punctuation.
Through
Wednesday, September 16, 2015
, respond to at least two of your classmates' posts. While responding, draw comparisons between the examples you provided and the examples submitted by your classmates, and provide a rationale for the comparisons.
ATTENTION <,The faculty said no sources later thamn 5 years back please and thank you
.
Assignment 3 Views on DiversityPablo believes that diversity is t.docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, June 15, 2016
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attributi.
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, January 18, 2017
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, displayed accu.
Recommended
This is the fourth (of five)Critical Thinking Postsfor the c.docx
This is the fourth (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Tuesday, January 14th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Have your radio listening habits changed over your life thus far? How do you think personal music players such as the iPod and music streaming apps like
iHeart Radio
changed radio formats and usage?
.
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This is the first (of five) Critical Thinking Postsfor the cou.docx
This is the first (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Monday, January 6th, 2020
.
This is an opportunity for you to take a position on a
media and culture issue
using your
informed opinion
by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 10 to 12 sentence response to the following multi-part question:
Is there really a value in
media
convergence
for society? Is yes, give some specific examples of converged media that benefits society and clearly state why? If not, give some specific examples of converged media that does NOT benefit society and clearly state why not?
.
Assignment 3 Views on Diversity FOR SOLUTIONS PRO.Pablo.docx
Assignment 3: Views on Diversity
**FOR SOLUTIONS PRO.**
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection,
you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
by
Wednesday, June 15, 2016
. Your response should be
at least two pages long
. All written assignments and responses should follow APA rules for attributing sources.
.
Assignment 3 Views on DiversityPablo believes that diversity is t.docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, December 16, 2015
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
.
Assignment 1 Culture and CommunicationIn this assignment, you wil.docx
Assignment 1: Culture and Communication
In this assignment, you will explore your own cultural and ethnic background and analyze how this background may affect your communication. A great deal of a message is communicated not through spoken words but through the nonverbal channels. Culture and personal experience can play a large role in the transmission and interpretation of nonverbal messages. You will reflect upon your personal experience from the viewpoint of your cultural and ethnic affiliation(s) and compare it with the scholarly literature relevant to your cultural and ethnic background.
Tasks:
Watch the video,
Empathy Training for Ethnic and Cultural Awareness
. Afterwards, identify your cultural and ethnic background. In your response, answer the following questions:
In what ways do you feel your culture affects the way you communicate? (For example, eye contact or the lack of eye contact has a cultural component and can be interpreted as defiance or something similar by those unaware of the cultural context.)
Provide an example of how your culture has influenced nonverbal communication.
Discuss how nonverbal communication could influence whether or not a message is perceived accurately.
How is someone from a different cultural background likely to perceive your message?
Submission Details:
By
Saturday, September 12, 2015
, post your responses in at least 3–4 paragraphs to this
Discussion Area
. Your response should rely upon at least three sources from professional literature. This may include the Argosy University online library resources, relevant textbooks, peer-reviewed journal articles, and websites created by professional organizations, agencies, or institutions (.edu, .org, or .gov). Write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources (i.e., APA format); and use accurate spelling, grammar, and punctuation.
Through
Wednesday, September 16, 2015
, respond to at least two of your classmates' posts. While responding, draw comparisons between the examples you provided and the examples submitted by your classmates, and provide a rationale for the comparisons.
ATTENTION <,The faculty said no sources later thamn 5 years back please and thank you
.
Assignment 3 Views on DiversityPablo believes that diversity is t.docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, June 15, 2016
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attributi.
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, January 18, 2017
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, displayed accu.
Views on DiversityPablo believes that diversity is the mos.docx
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection,
you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Response should be at least 3-5 pages long (800 Words). All written assignments and responses should follow APA rules for attributing sources.
Please do not use Wikipedia.
NEED 3 References
Must use as one of references:
Title:
The Convergence of Race, Ethnicity, and Gender
Author:
Tracy Lynn Robinson-Wood
Edition:
5
Copyright Date:
2017-01-01
Publisher:
SAGE Publications, Incorporated
Grading Criteria
Ø
Interviewed a cross-section of people and acquired the desired responses.
Ø
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
Ø
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
Ø
Provided contrasting views between the respondent's and your own views on the disc.
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, September 2, 2015
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and at.
Pablo believes that diversity is the most important issue in our c.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, displayed accurate spelling, grammar, and punctuation.
10
Total:
100
.
Views on Diversity January 13, 2016. Your response should be at.docx
Views on Diversity
January 13, 2016
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources and all WORK MUST BE COMPLETELY ORIGINAL AS ALL WORK GOES THROUGH A TURNITIN PROGRAM
.
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
I HAVE INTERVIEWED ONE PERSON ANSWERS ARE BELOW NEED 2 MORE INTERVIEWS
INTERVIEW SUBJECT 1
1.)When you hear the word diversity mentioned in the workplace, in the
media, or in casual conversation, what meaning do you assign this
term?
When I hear the word diversity mentioned in the workplace, in the media or in a casual conversation, the meaning I give the term is differences in age, gender, sexual orientation, ethnic and cultural backgrounds. I see it as a vague term used for the many different people in our country.
2.)Does a particular race, ethnic group, or other minority group come
to .
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
The topics covered relate to material from Lesson 10 Social Psy
The topics covered relate to material from Lesson 10: Social Psychology (Chapter 12). Choose from
one
of the three options below.
Option A: Thoughts on Race, Ethnicity and Culture
This page contains an assortment of springboards for you to dive into a discussion of prejudice, stereotyping, and discrimination. This is an activity in self-reflection. Consider your own personal history. Respond to at least 5 (or more) of the following questions in a 2-3 page paper:
1. Is it possible to be free of prejudice? Have you ever met anyone who was?
2. Are you prejudiced? If so, what are some recent instances in which you behaved in a prejudiced way? If not, how do you know that you're not prejudiced?
3. If you've behaved in a prejudiced way, what caused the prejudice, and what might reduce it? How did other people respond to your behavior?
4. If a close friend or family member were to make a prejudiced comment, would you protest? Why or why not? What about a stranger or acquaintance -- would you respond in that situation?
5. If you were to make a prejudiced comment at a party or among a group of friends, would your friends say something?
6. Does the categorization of people always result in prejudice? What about categorizing people in a positive way -- does that result in prejudice?
7. Are stereotypes ever a good thing? Have you ever tried to get people to stereotype you, either positively or negatively?
8. Does the very categorization of people -- for example, as female, a college student, African-American, or Texan -- necessarily rob them of individuality?
9. At a psychological level, what are the common denominators that link all forms of prejudice?
10. In general, which forms of prejudice seem to be declining over time, and which forms seem to be persisting or increasing?
11. Describe the earliest memory you have of an experience with a person or people of a racial, ethnic, or cultural group different from your own..
12. Who or what has had the most influence in the formation of your attitudes and opinions about people of different racial, ethnic, and/or cultural groups? In what way?
13. What influences in your experience have led to the development of positive feelings about your own heritage and background?
14. What influences in your experience have led to the development of negative feelings, if any, about your own heritage or background?
15. What changes, if any, would you like to make in your own attitudes or experiences in relation to people of other racial, ethnic, or cultural groups?
16. Describe an experience in your own life when you feel you were discriminated against for any reason.
17. How do you feel you should deal with (or not deal with) issues of racial, ethnic, and cultural diversity in American society?
18. Which forms of prejudice are most socially acceptable, and which are least acceptable? Why are some forms more acceptable than others?
19. When, if ever, is it best to remain colorblind to race and ethni ...
Best way of Public Speaking by Rohit Dubey (Treejee)
Its the ppt that teaches us the best way to give speech in public.“The biggest weapon human-being is blessed with is his voice which can make him win all the battles of life” ………….…….. Rohit Dubey
Our voice is like electric current Our mouth is like a Speaker Our face is like a Computer Screen Our Brain acts like a Hard-disk
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading .docx
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading Criteria.
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Your response should be at least two pages long. All written assignments and responses should
follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, disp.
Aggressive Behavior Perception.pdf
This document provides instructions and resources for a discussion assignment on perceptions of aggressive behavior across cultures. Students are asked to discuss an example of a behavior that may be perceived as aggressive in a selected culture and why, an example of a behavior seen as aggressive across most cultures and why, and how socially sanctioned violence is acceptable in some cultures. The document provides learning resources on culture and social cognition, social justice from a cultural perspective, and several research articles. It also provides formatting guidelines, expectations for responses, and policies on late submissions and communication.
Discourse communities -authorityanddata-1
This document provides guidance for observing and analyzing discourse communities based on John Swales' framework. It instructs students to look at issues of power, authority, and assimilation when newcomers join a discourse community. Students are told to observe a discourse community, collect texts, and interview members to understand how expertise, communication practices, genres, and specialized language contribute to enculturation and the distribution of authority.
Week 9 145
This document provides an agenda for a literature review discussion on homophobia. It includes discussing why sexual orientations should be discussed and what it means to normalize heterosexual activities. It addresses individual blogging assignments on assigned readings and developing interview questions for data collection. The document outlines developing informed consent forms and planning for soliciting research participants. It assigns reading a discussion on educational equality and resumes/cover letters to analyze strengths and weaknesses.
Intro to oral presentation and issues
This document provides guidance for students on completing an assessment task involving persuasive speaking and writing. It discusses key concepts like what constitutes an issue, examples of current issues, and tips for delivering an effective persuasive oral presentation. Students are instructed to choose a contentious issue, research different perspectives on it, and present a 4-6 minute oral arguing their point of view, while addressing opposing arguments. They are encouraged to use emotive language and appeal to listeners' emotions to persuade their audience.
Edwards Sinners P P T
The document provides background information on Jonathan Edwards, an influential 18th century American theologian. It discusses Edwards' sermon "Sinners in the Hands of an Angry God" and how he used vivid language and metaphors to depict sinners dangling over the fiery pit of hell to motivate religious conversion during the Great Awakening religious revival. The document also provides definitions and examples of rhetorical devices like simile, metaphor, and imagery used in persuasive arguments.
Peer review for essay Students may either bring a hard.docx
The document provides instructions for an essay assignment that is due on February 23. Students must write a 4-5 page research paper analyzing the representation of a youth-oriented social issue in a work of popular culture such as a music video, video game, or film. The essay must include a thesis supported by close reading/analysis of signs in the primary source text as well as 3-5 secondary sources, one of which must be a class reading and another must be the primary text. Sample topics analyzing representations of issues like monsterous children, empowered young females, or controversial toys/games are provided.
Writing Great College Application Essays That Pop!!!
I gave this presentation at the Orange County School of the Arts 2013 College Night. It is essential that students and families see the importance of college application essays and the ways students can use these powerful essays to communicate unique stories and qualities.
Introduction to Oral Presentations
This document provides guidance on an assessment task requiring students to identify and analyze persuasive language and present a reasoned point of view orally or in writing. Students must complete a 5-8 minute persuasive oral presentation on a self-selected issue and a 600-700 word written analysis of a text selected by the teacher. The document defines what constitutes an issue, provides examples of current issues, and offers tips on choosing a topic and crafting an effective persuasive oral presentation.
Views on DiversityPablo believes that diversity is the most import.docx
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would
.
Individual Cultural Communication Written Assignment (Worth 20 of .docx
Individual Cultural Communication Written Assignment (Worth 20% of Final Grade)
Complete a written paper (on a word document) about your culture. This paper requires correct grammar, punctuation, and APA format.
Requirements:
Use the following questions below as a template and address all questions within your written assignment.
The paper is worth 100 points (20%) of your course grade. A minimum of
Three (3)
references are required. References can come from a refereed journal article, course textbook, and or an Internet source.
You are expected to report on your cultural topic in a Four -Five pages (
Excluding Title and Reference Page
) typed word document. The assignment should be typed out on a Word Document with no larger than size 12 font, font names that should be used, times new roman or
Calabria
(not both), normal margins (no more than 1 inch), double spaced.
The following should be included in your assignment.
Assignment Layout:
1. Title Page:
Student Name (First and Last), Student Panther ID Number and Title
2. Introduction:
Describe what is Cultural Competency
Identify and describe your cultural ancestry. If you have more than one cultural ancestry, chose the one with which you most closely associate.
3. Assignment Content (Body of Paper):
Explore and describe the willingness of individuals in your culture to share thoughts, feelings, and ideas. Can you identify any area of discussion that would be considered taboo?
Explore and describe the practice and meaning of touch in your culture. Include information regarding touch between family members, friends, members of the opposite sex, and health-care providers.
Identify and describe personal spatial and distancing strategies used when communicating with others in your culture. Discuss differences between friends and families versus strangers.
Discuss your culture’s use of eye contact. Include information regarding practices between family members, friends, strangers, and persons of different age groups.
Explore and describe the meaning of gestures and facial expressions in your culture. Do specific gestures or facial expressions have special meanings? How are emotions displayed?
Discuss if there are acceptable ways of standing and greeting people in your culture?
Discuss the prevailing temporal relation of your culture. Is the culture’s
worldview
past, present, or future oriented? Prevailing temporal relations meaning, how do your culture perceive
healthcare
in general. Does your culture utilize certain remedies? Are they more relax about receiving proper
healthcare
? Do they seek a
healthcare
provider if their health is failing? How often they try to seek medical attention?
Discuss the impact of your culture in
healthcare
or within a
healthcare
setting.
4. Conclusion (Closing thoughts):
Discuss your closing thoughts (hypnotically), on how will your culture perceive
healthcare
in the future.
Discuss how being culturally competent will have an effect on you as a f.
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
More Related Content
Similar to This is the third (of five)Critical Thinking Postsfor the co.docx
Views on DiversityPablo believes that diversity is the mos.docx
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection,
you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Response should be at least 3-5 pages long (800 Words). All written assignments and responses should follow APA rules for attributing sources.
Please do not use Wikipedia.
NEED 3 References
Must use as one of references:
Title:
The Convergence of Race, Ethnicity, and Gender
Author:
Tracy Lynn Robinson-Wood
Edition:
5
Copyright Date:
2017-01-01
Publisher:
SAGE Publications, Incorporated
Grading Criteria
Ø
Interviewed a cross-section of people and acquired the desired responses.
Ø
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
Ø
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
Ø
Provided contrasting views between the respondent's and your own views on the disc.
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Submit your response to the
M1: Assignment 3 Dropbox
by
Wednesday, September 2, 2015
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and at.
Pablo believes that diversity is the most important issue in our c.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, displayed accurate spelling, grammar, and punctuation.
10
Total:
100
.
Views on Diversity January 13, 2016. Your response should be at.docx
Views on Diversity
January 13, 2016
. Your response should be at least two pages long. All written assignments and responses should follow APA rules for attributing sources and all WORK MUST BE COMPLETELY ORIGINAL AS ALL WORK GOES THROUGH A TURNITIN PROGRAM
.
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
I HAVE INTERVIEWED ONE PERSON ANSWERS ARE BELOW NEED 2 MORE INTERVIEWS
INTERVIEW SUBJECT 1
1.)When you hear the word diversity mentioned in the workplace, in the
media, or in casual conversation, what meaning do you assign this
term?
When I hear the word diversity mentioned in the workplace, in the media or in a casual conversation, the meaning I give the term is differences in age, gender, sexual orientation, ethnic and cultural backgrounds. I see it as a vague term used for the many different people in our country.
2.)Does a particular race, ethnic group, or other minority group come
to .
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
The topics covered relate to material from Lesson 10 Social Psy
The topics covered relate to material from Lesson 10: Social Psychology (Chapter 12). Choose from
one
of the three options below.
Option A: Thoughts on Race, Ethnicity and Culture
This page contains an assortment of springboards for you to dive into a discussion of prejudice, stereotyping, and discrimination. This is an activity in self-reflection. Consider your own personal history. Respond to at least 5 (or more) of the following questions in a 2-3 page paper:
1. Is it possible to be free of prejudice? Have you ever met anyone who was?
2. Are you prejudiced? If so, what are some recent instances in which you behaved in a prejudiced way? If not, how do you know that you're not prejudiced?
3. If you've behaved in a prejudiced way, what caused the prejudice, and what might reduce it? How did other people respond to your behavior?
4. If a close friend or family member were to make a prejudiced comment, would you protest? Why or why not? What about a stranger or acquaintance -- would you respond in that situation?
5. If you were to make a prejudiced comment at a party or among a group of friends, would your friends say something?
6. Does the categorization of people always result in prejudice? What about categorizing people in a positive way -- does that result in prejudice?
7. Are stereotypes ever a good thing? Have you ever tried to get people to stereotype you, either positively or negatively?
8. Does the very categorization of people -- for example, as female, a college student, African-American, or Texan -- necessarily rob them of individuality?
9. At a psychological level, what are the common denominators that link all forms of prejudice?
10. In general, which forms of prejudice seem to be declining over time, and which forms seem to be persisting or increasing?
11. Describe the earliest memory you have of an experience with a person or people of a racial, ethnic, or cultural group different from your own..
12. Who or what has had the most influence in the formation of your attitudes and opinions about people of different racial, ethnic, and/or cultural groups? In what way?
13. What influences in your experience have led to the development of positive feelings about your own heritage and background?
14. What influences in your experience have led to the development of negative feelings, if any, about your own heritage or background?
15. What changes, if any, would you like to make in your own attitudes or experiences in relation to people of other racial, ethnic, or cultural groups?
16. Describe an experience in your own life when you feel you were discriminated against for any reason.
17. How do you feel you should deal with (or not deal with) issues of racial, ethnic, and cultural diversity in American society?
18. Which forms of prejudice are most socially acceptable, and which are least acceptable? Why are some forms more acceptable than others?
19. When, if ever, is it best to remain colorblind to race and ethni ...
Best way of Public Speaking by Rohit Dubey (Treejee)
Its the ppt that teaches us the best way to give speech in public.“The biggest weapon human-being is blessed with is his voice which can make him win all the battles of life” ………….…….. Rohit Dubey
Our voice is like electric current Our mouth is like a Speaker Our face is like a Computer Screen Our Brain acts like a Hard-disk
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3: Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
.
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading .docx
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading Criteria.
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would you answer the same questions?
Your response should be at least two pages long. All written assignments and responses should
follow APA rules for attributing sources.
Assignment 3 Grading Criteria
Maximum Points
Interviewed a cross-section of people and acquired the desired responses.
15
Summarized the respondent's attitude toward diversity in modern culture using appropriate terms and concepts.
25
Commented on whether the respondent believed diversity was associated with one particular race or ethnic group more so than others.
25
Provided contrasting views between the respondent's and your own views on the discussed subjects along with an explanation.
25
Wrote in a clear, concise, and organized manner; demonstrated ethical scholarship in accurate representation and attribution of sources, disp.
Aggressive Behavior Perception.pdf
This document provides instructions and resources for a discussion assignment on perceptions of aggressive behavior across cultures. Students are asked to discuss an example of a behavior that may be perceived as aggressive in a selected culture and why, an example of a behavior seen as aggressive across most cultures and why, and how socially sanctioned violence is acceptable in some cultures. The document provides learning resources on culture and social cognition, social justice from a cultural perspective, and several research articles. It also provides formatting guidelines, expectations for responses, and policies on late submissions and communication.
Discourse communities -authorityanddata-1
This document provides guidance for observing and analyzing discourse communities based on John Swales' framework. It instructs students to look at issues of power, authority, and assimilation when newcomers join a discourse community. Students are told to observe a discourse community, collect texts, and interview members to understand how expertise, communication practices, genres, and specialized language contribute to enculturation and the distribution of authority.
Week 9 145
This document provides an agenda for a literature review discussion on homophobia. It includes discussing why sexual orientations should be discussed and what it means to normalize heterosexual activities. It addresses individual blogging assignments on assigned readings and developing interview questions for data collection. The document outlines developing informed consent forms and planning for soliciting research participants. It assigns reading a discussion on educational equality and resumes/cover letters to analyze strengths and weaknesses.
Intro to oral presentation and issues
This document provides guidance for students on completing an assessment task involving persuasive speaking and writing. It discusses key concepts like what constitutes an issue, examples of current issues, and tips for delivering an effective persuasive oral presentation. Students are instructed to choose a contentious issue, research different perspectives on it, and present a 4-6 minute oral arguing their point of view, while addressing opposing arguments. They are encouraged to use emotive language and appeal to listeners' emotions to persuade their audience.
Edwards Sinners P P T
The document provides background information on Jonathan Edwards, an influential 18th century American theologian. It discusses Edwards' sermon "Sinners in the Hands of an Angry God" and how he used vivid language and metaphors to depict sinners dangling over the fiery pit of hell to motivate religious conversion during the Great Awakening religious revival. The document also provides definitions and examples of rhetorical devices like simile, metaphor, and imagery used in persuasive arguments.
Peer review for essay Students may either bring a hard.docx
The document provides instructions for an essay assignment that is due on February 23. Students must write a 4-5 page research paper analyzing the representation of a youth-oriented social issue in a work of popular culture such as a music video, video game, or film. The essay must include a thesis supported by close reading/analysis of signs in the primary source text as well as 3-5 secondary sources, one of which must be a class reading and another must be the primary text. Sample topics analyzing representations of issues like monsterous children, empowered young females, or controversial toys/games are provided.
Writing Great College Application Essays That Pop!!!
I gave this presentation at the Orange County School of the Arts 2013 College Night. It is essential that students and families see the importance of college application essays and the ways students can use these powerful essays to communicate unique stories and qualities.
Introduction to Oral Presentations
This document provides guidance on an assessment task requiring students to identify and analyze persuasive language and present a reasoned point of view orally or in writing. Students must complete a 5-8 minute persuasive oral presentation on a self-selected issue and a 600-700 word written analysis of a text selected by the teacher. The document defines what constitutes an issue, provides examples of current issues, and offers tips on choosing a topic and crafting an effective persuasive oral presentation.
Views on DiversityPablo believes that diversity is the most import.docx
Views on Diversity
Pablo believes that diversity is the most important issue in our culture, and that it is greatly underemphasized. On the other hand, Ralph rarely thinks of diversity, except when it is mentioned in the workplace. Monica is sensitized to multicultural issues because her parents are immigrants who still struggle with discrimination after being here for 20 years.
To obtain a cross-section of what people think about diversity, conduct five-minute interviews with three individuals you don't know well, and assess their views on diversity. You have been provided an
Informed Consent
document for the respondents to sign along with verbally consenting to participate in this assignment. This is to enable that the respondents demonstrate a clear understanding of the meaning and purpose of this assignment. While you are expected to use the informed consent form in keeping with ethical practices for data collection, you do not need to submit it to the instructor as part of the assignment.
Ask the respondents the following questions and record their answers:
When you hear the word diversity mentioned in the workplace, in the media, or in casual conversation, what meaning do you assign this term?
Does a particular race, ethnic group, or other minority group come to mind when you think of diversity? Does one of these groups pertain to you?
Do you think the majority of people in our culture:
Respect cultural differences among groups of people.
Show indifference to cultural differences.
Lack respect for cultural differences. Explain each choice.
If you were to make a suggestion about how our culture should handle diversity over the next decade, what would it be?
Compile your responses and write a brief reflection paper (two pages) on your findings. Specifically address the following issues:
What did you discover was the general attitude toward diversity in our culture?
Is diversity more associated with one race, ethnic, or other minority group than with others? If so, explain why this might be the case.
Compare and contrast the respondent's views with your own. How would
.
Individual Cultural Communication Written Assignment (Worth 20 of .docx
Individual Cultural Communication Written Assignment (Worth 20% of Final Grade)
Complete a written paper (on a word document) about your culture. This paper requires correct grammar, punctuation, and APA format.
Requirements:
Use the following questions below as a template and address all questions within your written assignment.
The paper is worth 100 points (20%) of your course grade. A minimum of
Three (3)
references are required. References can come from a refereed journal article, course textbook, and or an Internet source.
You are expected to report on your cultural topic in a Four -Five pages (
Excluding Title and Reference Page
) typed word document. The assignment should be typed out on a Word Document with no larger than size 12 font, font names that should be used, times new roman or
Calabria
(not both), normal margins (no more than 1 inch), double spaced.
The following should be included in your assignment.
Assignment Layout:
1. Title Page:
Student Name (First and Last), Student Panther ID Number and Title
2. Introduction:
Describe what is Cultural Competency
Identify and describe your cultural ancestry. If you have more than one cultural ancestry, chose the one with which you most closely associate.
3. Assignment Content (Body of Paper):
Explore and describe the willingness of individuals in your culture to share thoughts, feelings, and ideas. Can you identify any area of discussion that would be considered taboo?
Explore and describe the practice and meaning of touch in your culture. Include information regarding touch between family members, friends, members of the opposite sex, and health-care providers.
Identify and describe personal spatial and distancing strategies used when communicating with others in your culture. Discuss differences between friends and families versus strangers.
Discuss your culture’s use of eye contact. Include information regarding practices between family members, friends, strangers, and persons of different age groups.
Explore and describe the meaning of gestures and facial expressions in your culture. Do specific gestures or facial expressions have special meanings? How are emotions displayed?
Discuss if there are acceptable ways of standing and greeting people in your culture?
Discuss the prevailing temporal relation of your culture. Is the culture’s
worldview
past, present, or future oriented? Prevailing temporal relations meaning, how do your culture perceive
healthcare
in general. Does your culture utilize certain remedies? Are they more relax about receiving proper
healthcare
? Do they seek a
healthcare
provider if their health is failing? How often they try to seek medical attention?
Discuss the impact of your culture in
healthcare
or within a
healthcare
setting.
4. Conclusion (Closing thoughts):
Discuss your closing thoughts (hypnotically), on how will your culture perceive
healthcare
in the future.
Discuss how being culturally competent will have an effect on you as a f.
Similar to This is the third (of five)Critical Thinking Postsfor the co.docx (20)
Views on DiversityPablo believes that diversity is the mos.docx
Views on DiversityPablo believes that diversity is the mos.docx
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Pablo believes that diversity is the most important issue in our c.docx
Pablo believes that diversity is the most important issue in our c.docx
Views on Diversity January 13, 2016. Your response should be at.docx
Views on Diversity January 13, 2016. Your response should be at.docx
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our cul.docx
Pablo believes that diversity is the most important issue in our cul.docx
The topics covered relate to material from Lesson 10 Social Psy
The topics covered relate to material from Lesson 10 Social Psy
Best way of Public Speaking by Rohit Dubey (Treejee)
Best way of Public Speaking by Rohit Dubey (Treejee)
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Assignment 3 Views on Diversity Pablo believes that diversity is .docx
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading .docx
Please due with in 24 hours. NO PLAGIARIZE!!!!!! Follow the grading .docx
Peer review for essay Students may either bring a hard.docx
Peer review for essay Students may either bring a hard.docx
Writing Great College Application Essays That Pop!!!
Writing Great College Application Essays That Pop!!!
Views on DiversityPablo believes that diversity is the most import.docx
Views on DiversityPablo believes that diversity is the most import.docx
Individual Cultural Communication Written Assignment (Worth 20 of .docx
Individual Cultural Communication Written Assignment (Worth 20 of .docx
More from glennf2
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agurre, The Wrath 1972) dir. Werner Herzog
in this critical l journal u just have to talk about the Understated or subversive stylization
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in conjunction with an article.
Read an article on aligning interests with a career. For example:
“When I Grow Up: Lessons scientists would share with their younger selves”
Journal #1: What career interests you the most and why? Explain in
detail your career interest and tell why you feel that you would be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft skills will get you the job.
By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of Washington, employers said entry-level
workers in a variety of professions were lacking in several areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good follower, monitoring the progress, meeting
deadlines and working with others across the organization to achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do they fit
in with your career interest? Based on the soft skills discussed in this
article, discuss one that is a strength for you and one with which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.en/career-advice/six-soft-skills-everyone-needs-hot-jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5332344.
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current module. The assignment requires that you prepare ONE 200-250-word statement in paragraph form to present a snapshot of:
· your point of view (POV) about the module topic (identify this before turning to the assigned reading)
· key evidence and themes pertaining to the module topic that stands out to you upon completing the assigned reading (include endnotes to cite the information you are extracting from the reading)
· a concluding comment and/or question that captures an aspect of your POV after reading the assigned chapter.
The module topic is Regionalism and Internationalism
!"#$%&'(")&*&+,+-"./,"01,2%"3'4"5$4&66,$("7(%,84$%&'(
!1%/'492:-";<"=$4*&(";&>>
?'[email protected],-"A$%&("!B,4&@$("C,2,[email protected]/"C,*&,DE"F'><"GHE"#'<"G"9IJJI:E"KK<"LMLN
O16>&2/,+"6P-"./,"A$%&("!B,4&@$("?%1+&,2"!22'@&$%&'(
?%$6>,"QCA-"http://www.jstor.org/stable/2503626
[email protected]@,22,+-"RSTIRTGRRJ"RS-RU
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless
you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you
may use content in the JSTOR archive only for your personal, non-commercial use.
Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at
http://www.jstor.org/action/showPublisher?publisherCode=lamer.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed
page of such transmission.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected]
The Latin American Studies Association is collaborating with JSTOR to digitize, preserve and extend access to
Latin American Research Review.
http://www.jstor.org
http://www.jstor.org/stable/2503626?origin=JSTOR-pdf
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/action/showPublisher?publisherCode=lamer
A NATION DIVIDED:
The Quest for Caribbean Integration
W. Marvin Will
University of Tulsa
Recognizing that the traditional five-state subregion of Central
America departed from European colonialism as a federated entity, Ralph
Lee Woodward subtitled his seminal history of Central America "A Nation
Divided." In his view, "the social and economic history of the isthmus
suggests that its peoples share considerably in their problems and circum-
stances, even though their political experience has been diverse. But it is
also clear that their so.
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion)
The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency
Solution
s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic.
The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020).
.
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following: Healthy people 2020 is a guide to promote preventative care. Review Primary, Secondary and Tertiary prevention and relate this to women and children at risk in your community. Identify those risk factors that a prevention program could impact the health of the group you identify. Include citations and use APA format. The 500 words does not include the citations.
.
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz: It consists of the vocabulary you learned from Lesson B in Unit 2.
Authorities
Initiate
Sustainable
Contrary to
Controversy
Undeniable
Neglect
Predator
Prey on
Upkeep
You will write your own sentences using each of the vocabulary words. The sentence
must be an
original sentence
created by you, AND it must use the vocabulary word correctly.
Your sentence
MUST
demonstrate that you understand the meaning of the word.
.
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not be overlapped with in-class discussion. Hopefully Fall 2021 we will be back to normal! This final response essay will be due DECEMBER 6 which is an extended deadline. How does Do the Right Thing and Daughters of the Dust balance carefully and deliberate filmmaking with delivering clear messages about social justice? Sometimes when a film tries too hard for a message, the craft of filmmaking might get overlooked. Compare and contrast how these two films do/do not do that with some clear examples of a moral message either reinforcing or compromising the scene/filmmaking.
.
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you can't not have more than 200 words. Please no plagiarism. You can have one or two quotes. Make sure have a topic sentence, answer what, how, why, in what way, who, How does (he/she) know, and so what. Also use the last story, there is three and use the last one about "Don't take notes with a laptop"
.
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions talking about.
Chin, J. L. & Trimble, J. E. (2015).
Diversity and leadership.
Los Angeles, CA: Sage.
The Three Cs of Managing Diversity: Composition-Core-Climate Managing organizational diversity starts with developing an organization’s strategic planning to be inclusive of diversity and directed toward organizational and systemic change. It presumes a commitment to goals of diversity leadership. It makes the business case for training to move leaders and members toward a goal where diversity means good business; it brings in customers, expands the customer base, promotes a climate where all voices are included, and strives toward a workforce composition that is diverse and delivers its products or services in a culturally competent manner. The senior author has defined this to mean addressing the Three Cs of Diversity: recruiting and retaining a diverse Composition of the workforce and clientele, developing the Core of business products and services to be delivered in a culturally competent manner, and promoting a welcoming and inclusive workplace Climate within the organization. Moodian (2009) views contemporary leadership and leadership success as attainable through intercultural competence and stresses the importance of moving away from ethnocentric leadership philosophies given the growing dominance of diverse workforces and greater racial/ethnic heterogeneity of populations in countries throughout the world today. He suggests a strategic planning process or business plan that is inclusive of diversity and offers seven steps toward managing diversity for organizational change. “The business case is about capturing talent, understanding markets, utilizing diverse perspectives for innovation, knowing how and how not to pitch products, and ultimately, how to generate employee commitment” (Moodian, 2009, p. 39). The seven steps include the following: Generating Executive Commitment—Nothing happens in an organization without buy-in from the top. Diversity needs to be a goal embraced by leaders within an organization and starts with a visioning process. Assessment—This process helps the organization understand its current state regarding diversity. This essentially means doing a SWOT analysis of the Three Cs; this might include assessing composition of the workforce and its clientele, assessing policies and procedures that might pose internal barriers for hiring and promotion, assessing climate of the organization for inclusion and respect for all dimensions of diversity, and marketing strategies and business goals that are inclusive of diversity. This helps identify needs, set priorities, and to define goals and objectives for a strategic plan that is inclusive of diversity and provides data to serve as benchmarks. Diversity Council—The establishment of such councils provides a formal mechanism within the organization that serves the purpose of getting feedback to and f.
This is what I need, nothing more or less-All Is removed in th.docx
The document requests editing services to remove all first-person pronouns from an essay, restructure sentences that are fragmented, run-on, or unprofessional, and ensure the formatting is correct according to Chicago style without any changes.
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have discussed is about demonstrating your knowledge of core principles, concepts and theories in your field. Key words in that statement are "demonstrate"......ok, there's only one! :) The most common mistake in this section is that you discuss but do not demonstrate.
Another key to this sentence: Notice that there is nothing in there about classes. We do not want class descriptions - we can look those up in the catalog. We do not want lists of projects you had to do in each class. Focus on the core skills, principles, concepts.....In Graphics class, for example, what is one of the theories you MUST know? Talk about - and then demonstrate that you know it. Tell the story of that concept. Be brief, be specific, then add an example to demonstrate. A chart, a graph, a picture....You may use links as long as you discuss the concept and lead people to the link.
This entire section is maybe 1 1/2 to 2 pages of writing. You will add pictures, charts, graphs, etc.
Finally one more thing to focus on: Writing. Grammar. English...this is a technical paper that might represent you and OSU in the industry. Watch your grammar!
Skeleton Outline Format
Thesis/Central Idea
I. Attention: A sentence summarizing your attention-getting strategy
Transition
II. Main Point 1 (A sentence summarizing the point. This might be the need if you’re doing Monroe’s Motivated Sequence or the problem if you’re doing problem cause solution, the standard of judgment if you’re doing value, etc.).
A. A sentence or two indicating what you want to say/do in this point. Do you want to establish how big/serious this problem is? Show the harms or negative effects? Use one type of evidence or support? Define and explain the issue?
Transition
III. Main Point 2 (A sentence summarizing the point you want to make here. It might be Satisfaction if doing MMS, Cause if doing problem cause solution, etc)
A. Sentence or two indicating what you want to say/do here. Are you going to use a different type of evidence to make your point? Show us why a problem is happening? Prove that your plan/solution can work?
Transition
IV. Main Point 3 (if needed--most speeches will do 3 main points, but it’s possible to have a speech work with just two big ones). This might be solution, visualization, etc.
A. Sentence or two indicating what you want to do here. Do you want to prove how this plan solve the problem, explain how to fix the issue? Show why one solution is better than another?
Transition
V. Conclusion: A sentence indicating what you want to do in the conclusion.
Research on Hand/Research Wanted
Here you should fill out what research/evidence (if any) you already have and what kinds of evidence/research you would still want. Do you want, for example statistics or studies showing the scope of a problem? Expert testimony to explain why something is happening? Examples to help illustrate a complex idea?
.
More from glennf2 (20)
This is the other book link.Any questions please contact via[e.docx
This is the other book link.Any questions please contact via[e.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt Explain the role of reason within theology as it.docx
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another..docx
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.The file is attached.Due date is .docx
This is the worlds most famous operatic soprano at the moment, An.docx
This is the worlds most famous operatic soprano at the moment, An.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in .docx
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current .docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not .docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is what I need, nothing more or less-All Is removed in th.docx
This is what I need, nothing more or less-All Is removed in th.docx
This is where you start actually writing. Section 1, as we have d.docx
This is where you start actually writing. Section 1, as we have d.docx
Recently uploaded
Top five deadliest dog breeds in America
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
How to Build a Module in Odoo 17 Using the Scaffold Method
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
Chapter 4 - Islamic Financial Institutions in Malaysia.pptxMohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...National Information Standards Organization (NISO)
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...Nguyen Thanh Tu Collection
https://app.box.com/s/y977uz6bpd3af4qsebv7r9b7s21935vdHow to Fix the Import Error in the Odoo 17
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
The History of Stoke Newington Street Names
Presented at the Stoke Newington Literary Festival on 9th June 2024
www.StokeNewingtonHistory.com
Assessment and Planning in Educational technology.pptx
In an education system, it is understood that assessment is only for the students, but on the other hand, the Assessment of teachers is also an important aspect of the education system that ensures teachers are providing high-quality instruction to students. The assessment process can be used to provide feedback and support for professional development, to inform decisions about teacher retention or promotion, or to evaluate teacher effectiveness for accountability purposes.
Advanced Java[Extra Concepts, Not Difficult].docx
This is part 2 of my Java Learning Journey. This contains Hashing, ArrayList, LinkedList, Date and Time Classes, Calendar Class and more.
Recently uploaded (20)
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
How to Build a Module in Odoo 17 Using the Scaffold Method
How to Build a Module in Odoo 17 Using the Scaffold Method
Film vocab for eal 3 students: Australia the movie
Film vocab for eal 3 students: Australia the movie
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
Chapter 4 - Islamic Financial Institutions in Malaysia.pptx
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
Assessment and Planning in Educational technology.pptx
Assessment and Planning in Educational technology.pptx
This is the third (of five)Critical Thinking Postsfor the co.docx
- 1. This is the third (of five) Critical Thinking Posts for the course. It must be posted on Canvas by 8pm on Friday, January 10th, 2020 . Remember, this is an opportunity for you to take a position on a media and culture issue using your informed opinion by the theory and concepts you are learning about in this course. Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity). Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded. Please write a 12 to 15 sentence response to the following multi-part question: What are your current online music listening habits? Do you use
- 2. platforms like Spotify, Soundcloud, or Pandora? How often do you use these types of sites for music? Are they changing your music taste? Introducing you to new genres? New cultures?