Organic Name Reactions for the students and aspirants of Chemistry12th.pptx
The Half Husky Essay. Online assignment writing service.
1. The Half Husky Essay
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
The Half Husky Essay The Half Husky Essay
2. Compare And Contrast Classical Conditioning And Operant...
Classical conditioning and operant conditioning are both psychological ways of learning.
Classical conditioning is learning by taking something neutral and associating it with something
that already creates a certain response. For example, if you take something that is not scary like
a baby doll and combine it with scary make up and eerie music, you have changed the response of
the once neutral doll, to have the same response as you would get with scary make up and eerie
music. It can take something you once loved, such as a baby doll, and turn it into something
completely different, like a fear of the baby doll. Could you imagine having your favorite toy turn
into your worst nightmare? Operant conditioningis learning from what outcomes came from
certain behaviors in the past and how that affects future behavior. For example, if you behave
badly in school and are suspended you will learn from the end results of those actions and it will
affect if you behave badly again. Taking into consideration that the last time you behaved badly
in school you were suspended for the rest of the year and were made to retake the entire school
year over again, it may deter you from behaving badly again because you do not wish to go
through that punishment again. Reinforcer is the term used to explain how an incentive after a
reaction increases the probability of someone reacting the same way again. Things that are required
for survival are called primary reinforcers. For example,
... Get more on HelpWriting.net ...
3. Definition Essay On Self Respect
Respect can be defined as an action or a feeling that is shown to others, oneself or something.
Some may that you can get a feeling out of any virtue, for example anger or disrespect, but respect
is usually connected between two individuals; an action of showing how much love, pride and
honor you have for them and having your words and actions speak for you indicating that respectis
being shown. There is a chain reaction when it comes to expressing respect, you must give respect
to gain respect and it can go the other way around also, where in order to receive respect you must
give respect. When it comes to the virtuerespect it is a give and take type of situation. As Fyodor
Dostoyevsky, Russian novelist and short story writer, once said, If you want to be respected by
others, the great thing is to respect yourself. Only by self respect you will compel others to
respect you. Having self respect has a lot to do with one s self esteem, knowing their own worth
and confidence plays an important role. Having an open mind to being wrong is a gateway to self
respect, it shows acknowledgment and acceptance of the truth or existence of a fact or opinion. It
shows that a person knows their rights from wrongs and having self respect opens new doors of
opportunities, this means that a person is willing to understand their mistakes and learn from them;
learn from those mistakes, wrongs and anything that can be found to not being worthy of putting it
out there in the world and public
... Get more on HelpWriting.net ...
4. Stereotypes In The Movie World War Z
What differs the movie World War Z from other zombie movies is the acting; it isn t typical zombie
acting. Frequently through the movie, the creatures aren t COMPLETELY insane. Little, nearly
unnoticeable movements the actors and actresses made created a more realistic type of crazy
cannibal effect, making the individual have more of a horrifying zombieovertake experience, while
the real them is silently trapped inside.
Each actors role they played in the movie was hit at its fullest potential. The main character, Brad
Pitt, had realistic facial expressions, along with a strong personality that intensified the movie. He
particularly had more close up shots than any other characters in the movie, and was on camera the
most, being the main character. His acting made the audience portray him as a very independent
individual, although he has family. The character is also extremely mentally stable, despite what
terrors and near death experiences hes been exposed to. escapes from deaths clutch. In addition to
holding himself together despite the nearly end of the world, this particular character holds himself
together well for his family. ... Show more content on Helpwriting.net ...
Other than the significance to Brad Pitt s character, the wife, two daughters and little boy didn t
serve much of a purpose, except to be a change of scene, change of characters, and to move the
intensified attention off of Brad s character (also is a home base connection to Brad s
... Get more on HelpWriting.net ...
5. Essay about Business Processing Outsourcing
The documentary 1 800 India is a very informative documentary showing the out sourcing industry
in India. The documentary goes beyond just out sourcing and shows the many benefits it has for
the people in India. It tells how it has seventeen thousand employees, and about fifty percent of the
employees are woman, which is a change for woman in the society. Twenty percent of woman in
India have jobs now due to Business Process Outsourcing. This is good for India because more
women are getting an education and are learning more than ever before. The men and woman of
Business Processing Outsourcinghave been educated, and are able to speak English and speak to
people in places such as the United States and Australia. They are gaining a better... Show more
content on Helpwriting.net ...
One woman tells about how she was a doctor, one of the highest paying jobs in America, and she
tells about how she changed jobs for less stress and more money. It gave her self confidence and
now she is able to speak in front of a large group of people, whereas before she was not able to
do. Women are now able to own and afford their own things and are becoming more independent.
In the movie, one woman who works for Business Processing Outsourcing tells us about how her
father before really didn t respect her and was angry that he has a daughter. She tells about how
she s learning English so that she can move up in her job, and how she is able to help support
her family. She is paying for many things for her family, and now her father loves her and wants
her to stay home and help support the family. This is very much different from America because
most families want their children to go out and have their own lives and be able to live on their
own. The documentary also shows two woman who moved out of their parents houses and moved
into an apartment together and how people think of them negatively because they re working until
late into the night and then come home and have boys over and party and dance and have fun and
are assuming things about them. They speak about how they don t like being judged just because
they decided to live on their own and because they re working until late at night doesn t mean that
they re doing bad things, they re just trying to make a
... Get more on HelpWriting.net ...
6. Diverticulitis
Diverticular disease has two separate manifestations. The subtle signs and symptoms of
diverticulosis are important to understand because many people who have this problem are
asymptomatic, but often this diverticular disease can lead to a more serious condition known as
diverticulitis. In diverticulosis, there are diverticula present, but they do not cause any symptoms.
In diverticulitis, which will be discussed in detail, the diverticula are inflamed which can lead to
other serious consequences for the patient (Gramse, 1983). Diverticulitis is a bugling protrusion of
a mucous membrane through the wall of the colon(Marrs, 2006). These saclike or pouch protrusions
have the potential to cause inflammation, obstruction, infection, and... Show more content on
Helpwriting.net ...
Fifteen percent of the remaining patients develop symptoms of their diverticulosis, while the
remaining five percent develop diverticulitis. The symptoms of diverticulosis are often hard to
differentiate and determine because they are often nonspecific symptoms, such as simple
abdominal pain that is relieved by moving their bowels (Marrs, 2006). Once inflammation occurs,
the diverticulosis is progressed to diverticulitis. This inflammation occurs from the large number of
bacteria that target the areas of weakened gastrointestinal wall and combine with undigested foods.
It is still unknown today why some diverticula became inflamed while others do not. There are
some theories surrounding this issue that states the inflammation occurs only when the erosion of
the colon wall is so bad that the body s immune system is unable to protect such a large, disrupted
area. In some cases, the inflammation gets so bad and infection co exists. This combination can
result in the enlargement of the infection, allowing it to extend into the abdomen and become
peritonitis when it infects the lining of the abdomen (Unknown, 2010). Diverticulitis is often
classified as either uncomplicated and mild or complicated and chronic. Regardless of the
classification of the disease, pain is the main symptom. Since diverticulitis occurs most often in the
Sigmoid colon, the pain associated with diverticulitis occurs most often in the lower, left quadrant of
... Get more on HelpWriting.net ...
7. Lee Enfield Rifle
The standard rifle of the British army during World War I was the Lee Enfield .303, a variation
of a weapon that had been used by the army since 1902. Fed by a magazine that could hold 10
bullets, the bolt action Lee Enfield was a robust, reliable rifle well suited to the harsh conditions of
trench warfare. A trained regular soldier could fire 15 rounds per minute with the weapon. In fact,
it was so successful that further variants were used throughout World War II and, in some countries,
for decades after that. German infantry, meanwhile, were issued with the Gewehr 98, a rifle with a
bolt action designed by the famous Mauser company. The Gewehr was a well constructed and
accurate weapon, but it was ill suited to the conditions on the Western... Show more content on
Helpwriting.net ...
Chemical weapons in World War I included phosgene, tear gas, chlor arsines and mustard gas. A
secret report by Lt Colonel C. G. Douglas, on the physiological effects of chemical weapons,
stated that the particular value of the poison mustard gas is to be found in its remarkable
casualty producing power as opposed to its killing power . The report said that 1% of British
troops died due to chemical weapons, while an estimated 181,000 soldiers were victims of gas
casualties.Chemical weapons were easily attained, and cheap. Gas was especially effective against
troops in trenches and bunkers that protected them from other weapons. Studies show that over
1,300,000 people were exposed and intoxicated by gas during the First World War, and 90,000 were
killed due to
... Get more on HelpWriting.net ...
8. Mapp vs Ohio Essay
On May 23rd 1957, three police officers representing Cleveland Ohio came to the door of Miss
Mapp s residence with the suspicion of a bombing suspect hiding out in her home. Miss Mapp
and her daughter lived in a two family two story home. Upon their arrival at the house the police
knocked on the door and demanded entrance from Miss Mapp. However Miss Mapp didn t open
the door and instead asked them to provide a search warrant after she called her attorney. The
officers advised their headquarters of the situation and established surveillance of the home over the
next few hours. The officers once again sought entrance three hours later when they forced open
one of the doors to the home and went inside. It was around this time that miss... Show more content
on Helpwriting.net ...
In the basement they found a chest that contained an amount of pornography. The pornography
was a few magazines, some photos, and artworks which depicted nudity. This being illegal in the
state of Ohio at the time, being lewd and lascivious material, Mapp was arrested and charged
with having obscene materials. In the first trial she was given, the prosecution did not provide
the search warrant that was used. The prosecution also failed to state why the warrant was not
submitted, In fact the prosecution avoided the subject almost entirely. There was a reasonable
belief that there was never a search warrant made in the first place, However the courts convicted
her guilty anyways, on the grounds that she had broken the law whether the evidence was
legally seized or illegally seized. The court also determined that the evidence had not been taken
from the defendant s person by use of brutal force against the defendant. They also stated that
there was no law in the state of Ohio that prevented the use of illegally seized evidence, which
was also stated in wolf v Colorado, In which the court held that in a prosecution in a state for a
state crime the fourteenth amendment doesn t prevent the use of evidence obtained by an illegal
search and seizure. She was then sentenced to a women s reformatory for a year, where she began
to make her appeal to the Supreme Court. The case was argued in front of the Supreme Court on
March 29 1961. Miss Mapp s attorney A.L.
... Get more on HelpWriting.net ...
9. Parental Involvement in the Youth Criminal Justice System...
Summary of Context In their article Doug Hillian and Marge Reitsma Street examines parents
involvement in the youth criminal justice system in Western Canada. Their study was conducting
on ten Caucasian families nine of which were middle and upper middle class, with sons, involved
in the Juvenile Criminal JusticeSystem. The study was to determine the parents place in the judicial
system, which appears to make it more arduous for parents, attempting to deal with the difficult task
of parenting young offenders, while navigating a system, which labels, blames, and assumes that as
parents they are unfit, irresponsible, and uncaring. Hillian and Reitsma argues if one starts with the
conceptual approaches to youth justice,... Show more content on Helpwriting.net ...
Moreover, it is with the utmost importance, that the courts strategize, on how to empower and
motivate parent s participation and involvement. The most obvious or realistic approach, would be
to utilize studies with concrete outcomes and conclusion, or expound on, or develop a study or
focus group identifying the parents needs, parenting style, barriers, and other challenges that makes
parental involvement difficult. Thus, it would allow the implementation of practical and viable
solutions, specifically changing the systemic problems, empowering parents, and forging a
collaborative relationship between the juvenile justice system, the community, and parents. Some
things, should to be immediately done, such as treating parents with empathy and respect,
understanding that they have rights and should be informed of those rights. Some of the apparent
rights of the parents are fair treatment with dignity and respect, the rights to know what the courts
expects of them, and informed of all scheduled court dates and appointments, which could be
inserted in a pamphlet. The overall benefit would be to work together in a collaborative effort to
help reduce the recidivism rate among youth and lessen the inconvenient burden of the parents,
community and juvenile justice system.
Hillian and Reitsma provided the framework with
... Get more on HelpWriting.net ...
10. Rafael Trujillo s Time Analysis
THE MIRABAL TIMES
THE DISCOVERY DAY DANCE DESTROYED LIVES!
It started with a letter....
Rafael Trujillo had sent an invitation to the Mirabal family to attend his private party. He had a
special request or was it a demand because its mighty El Jefe? The invitation had mention that
Minerva one of the Mirabal sisters to attend. Trujillo was the type to mess around with beautiful
girls, get them pregnant, mess their lives up and move on. He even had a wife. He was trying to
lure Minerva in too by making her attend his party. Minerva Mirabal was smarter, she knew how
El Jefe was and she did not fall for his tricks however that just led to more problems. How could
anymore say no to Trujillo? They all must have immense courage and bravery like
... Get more on HelpWriting.net ...
11. Romeo And Juliet Rhetorical Analysis
In Romeo and Juliet Shakespeare uses oxymora to help describe complicated human emotions.
People can have two opposing emotions such as love and hate. This is accuratly protrayed
throughout the play but mostly with the character of Juliet. For example Juliet uses the oxymoron
fiend angelical in her speech. This oxymoron means devil angle. Representing the fact that Juliet is
struggling with her interpation of Romeo character after he killed Tybalt. She thinks he may have
the same traits as the devil such as cruelness and wickedness. But her lovefor him makes her find it
hard to belive that that can be possible. She thinks of an angle in their love. Pure and happy is
what she sees him as and subconciously wishes he was.
Another
... Get more on HelpWriting.net ...
12. The Whaling Of The World Without Whales
The earth has a problem that will result in the evisceration of all cetaceans if it is not stopped.
What would happen if whales disappeared from the earth? In the event it would be catastrophic. A
world without whales is a world which has lost part of the key to the ecosystem of itself. A gentle
creature that has been hunted for its blubber, oils produced in the blubber, and for scientific
research. Rampant whalingcaused the population of many whale species to decrease. These marine
mammals dwindled to the point they were in danger of becoming extinct: One of the most
endangered of all marine mammals, the North Atlantic right whale currently hovers at a population
of around 500 (Finch). The International Whaling Commission(IWC) imposed... Show more content
on Helpwriting.net ...
Many countries and organizations are suspicious of Japan s intentions, which includes the Sea
Shepherd Conservation Society. Many saw this as an act of deception. Recently the state of
North Korea gave its stand on the argument of Japan s whaling industry and scientific research:
North Korea slammed Japan for its whaling practices . . ., calling the hunt for marine mammals a
criminal act (Shim). Some reason that scientific research as a means for commercial whaling.
Many believe that Japan wishes to continue its tradition of commercial whaling: North Korea also
said Japan s claims to scientific research was nothing more than a smokescreen to hide its
commercial objectives. Each country is responsible for regulating the whaling industry not the
IWC. Thus each country sets the amount whales that can be caught in the hunting season: In other
words, Japan s approves its own permits for scientific whaling without any external scrutiny or
need for explanation ( Ending Commercial Whaling ). The process of killing a whale or dolphin
is long and painful. The methods used by Japanese whalers are barbaric at best. The use of
... Get more on HelpWriting.net ...
13. Neolithic Revolution Essay
Introduction:
The emergence of agriculture was a major stepping stone in human history. During this birth of
agriculture, also known as the Neolithic revolution, humans began inhabiting permanent
settlements, grow their own crops, and domesticate both plants and animals for food (Weisdorf,
2005). Considering humans have been hunter gatherers for the majority of their approximately 7
million years of existence, the emergence of agriculture in the Old World only occurring 10,000
5,000 years ago, marks a significant transformation in food sustenance techniques (Weisdorf, 2005).
However, this turning point in history is associated with both positive and negative implications.
There is much controversy over whether or not the introduction of ... Show more content on
Helpwriting.net ...
Early Neolithic remains found at Catal HГјyГјk showed similar pathology, in which porotic
hypertosis affect approximately 41% of the population (Angel, 1971). In addition, transverse linear
hypoplasia markers were common on teeth throughout the population, these are generally
indicators of early childhood stresses such as disease or malnutrition (Angel, 1971). From these
two sites, it can clearly be seen that the diet composition had a great effect on the health of
Neolithic era humans. The excessive amount of skeletal markers that indicate malnutrition can
suggest the Neolithic diet lacked the nutrients needed for humans to be healthy. The Alepotrypa
skeletal remains had also shown high incidents of osteoarthritis generally located in the spine, this
could be an indicator of a physically stress full lifestyle (Papathanasiou, 2005). The stress markers
on these bones are very different from early hunter gatherers who were generally free of dietary
and activity influenced diseases (O Keefe Cordain, 2004). This comparison is fairly significant as
Neolithic individuals had a very different lifestyle from that of the hunter gatherers. Evidently, early
Neolithic individuals likely participated in much more labor intense activities than hunter gatherers
during daily life. Regardless of the causes for dietary and stress related skeletal markers, it can be
seen that the Neolithic populations experienced poor health in comparison to hunter gatherers.
Neolithic populations
... Get more on HelpWriting.net ...
14. The Death Of A Partner Essay
Disagreement Due To Death of a Partner
The death of a partner is an occurrence that is usually anticipated by people forming a partnership.
Much as it is anticipated, however, when it happens, it may bring about disagreements among the
remaining partners. The nature in which the resulting disagreement is handled determines whether
the remaining partners proceed on with the partnership or dissolve it and forget about it. Some
deaths of partners may not result in much disagreement depending on the situation at hand. For
instance, a partner may die with the partnership s unsettled debts. He may also die shortly after
creating a situation that compromises the financial standing of the partnership to a good extent.
When such an individual dies, there are a lot of conflicting ideas that may arise.
In most partnership agreements, there usually are conditions indicating what should be done in the
case of the death of a partner. These include giving the capital of the deceased individual to a
named estate or buying the shares of the partner from the estate, such that the partnership does not
have to be dissolved. This may be simple to decide on if the partner did not at any point interfere
with the financial position of the business. However, if the partner had indulged in transactions that
compromised the financial position of the Partnership before his death, at the point of his death,
some partners may not agree to give his share to the stated estate. Instead, they may feel that
... Get more on HelpWriting.net ...
15. The Trade And Freight Markets
2008 saw the beginning of an economic crisis which saw the failure of numerous shipping
companies and shipyards resulting in a remarkable decrease in the quantity and cost of newbuilding
orders. However, 2013 marked the beginning of a market revival following trippled orderbooks
compared to 2012, from 148 m dwt (1800 ships) to 54 m dwt (842 ships), aswell as a 10 20%
increase in selling prices following an 11 year all time low. Similarly, world order book which had
decreased by half in 5 years, between 2008 and 2012, increased significantly from 245 m dwt
(3,766) to 272 dwt (3,589 ships) which now amounts to 18% of fleet in service compared to 17% in
2012 and 53% in 2008. China remains by far the largest market share holder with 47% followed by
Korea and Japan which hold 28% and 15% of the market respectively and Europe owning a mere
1%. The maritime trade and freight markets took a similar turn to recovery despite economic
growth dropping to 3% in 2013 from 3.1% in 2012, far below the forecast 3.9%. Trade on the other
hand continued to suffer and reached 2.7%, far below 2011 and 2012 which had 6.1 and 12.6%.
There is reason for optimism however as shown by the Baltic Dry Index which started off very low
in the first quarter at 796 but rose significantly in the second of half of the year resulting in an
average of 1,198 compared to 920 in 2012. Despite falling short of the 2011 and 2010 indices of
1584 and 2758 respectively, the trend seems to be a positive one as
... Get more on HelpWriting.net ...
16. Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
content on Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)
... Get more on HelpWriting.net ...
17. Essay On Gustav Koch
Gustav Koch is a dissonance loving composer in the contemporary classical music scene of the
future who is preparing to have his pieces performed by a group of musicians on the planet Vetros.
This celestial body solely comprises an eminent concert hall. In spite of Koch artistic ambitions, he
is living under the shadow of death; during rehearsals, his performers die one by one. Charley is
baffled by Koch s phraseology as used in this concert s programme notes which the Doctor
intercepted. Explaining that his compositions contain pre Wagnerian dodecaphony with Mozartian
phrases, thus incorporating asymmetrical passages with an oxymoronically balanced contour, Koch
then apologises by stating that as cumbrous as this is, no shorthand... Show more content on
Helpwriting.net ...
All who prejudged Koch are now mourning over him. Back in the TARDIS, The Doctor admires
Koch s progressive ideology yet Charley muses on why she despises dissonance. Why is it that
Koch started out composing consonant and not dissonant music as a student? Was he terror
stricken, mortified or disgusted with the disharmony? If so, why? The terrorist we ve just met has
its temporal echoes throughout space, Charley, thus installing am instinctive prejudice against its
food dissonance. Consonance will enjoy artificial reign over dissonance for eternity; it will be the
most preferred sonorous clash. But in reality, they had both been conceived as equals. This ever
permeating process occurs in several bi entities throughout the universe: man and woman, black and
white, night and day, matter and antimatter...you name it, elucidates the
... Get more on HelpWriting.net ...
18. Voting Of The United States
Throughout the history of the United States, the right to vote is one of the most important
privileges and rights Americans have. Voting has always been very significant in America because
many people were not able to vote in the past. With movements, bills, and protests more and more
people earned the right to vote. America has come a long way in this democratic process. However,
votingin the 21st century is not as important to people as it was in the past.
Low voter turnout in the United States is due to poor rules and regulations, demographics,
participation, and plenty more but it has the potential to be higher.
The best way to learn about why things happen is to look at the history of it. In the 18th century,
voting was only eligible for white male property owners over the age of 21 with a certain
amount of land. This land was then valued at a price and depending on that price the government
would determine if they were eligible to vote. Now as years went on Americans would not have
to own a certain amount of property. Instead, they would be eligible to vote if they showed they
pay their taxes. Native Americans, African Americans, and women could not vote due to religion,
race, and mainly because they were not seen as equals. Catholics were not able to vote in five of
the 13 colonies and Jews in four. As for poor men, they decided they should not be allowed to vote
because they could be tempted with bribes.
Anderson 2
When 1790 rolled around religion was no longer
... Get more on HelpWriting.net ...
19. Human Experimentation Is Only Moral With Informed Consent
Introduction The argument I will be making in this essay is that human experimentation is only
moral with informed consent. I believe that it is essential to gain informed consent before starting
experimentation as to prevent any uninformed and unnecessary harm coming to the subject. In
arguing for informed consent, will do three things; first I will explain what informed consent means.
Second, I will consider an argument that sometimes informed consent is not required as it is
sometimes difficult to acquire and offer my objection to it. Third, and finally, I will offer my own
argument that human experimentation with informed consent is always necessary. Informed
Consent For the definition of informed consent, I will be using the... Show more content on
Helpwriting.net ...
I believe that a person who is persuaded into an experiment is at an increased risk for being
susceptible to harm. This issue has come up in history, such as in Word War II with the Nazis which
resulted in particular guidelines to follow for experiments, knows as the Nuremberg Codes.
Examples of these guidelines includes: The voluntary consent of the human subject...the experiment
should be conducted as to avoid all unnecessary physical and mental suffering and injury...during
the course of the experiment, the human subject should be at liberty to bring the experiment to an
end... (The Nuremberg Trials). The requirements of informed consent are similar to these
guidelines, and therefore should be considered necessary to all experiments in which human
subjects are involved. When Informed Consent is Difficult to Obtain One argument against the
requirement for informed consent is that at times, it can be difficult or impossible to obtain. An
example of a case where informed consent might be difficult to obtain is in experiments where it is
crucial for the subjects to not know they re being experimented on. One case similar to this is the
Milgram experiment. The Milgram was an experiment conducted in the 1960 s in which they
... Get more on HelpWriting.net ...
20. Writing Skills, Oral Communication, And Confident Level
People change by time goes by, so do I, especially in academic perspective. What usually happen
to me when it is approaching last week of the semester, I tend to compare myself in the present to
myself in the past. There are many aspect that I look to create subjects of comparison for a certain
class such as writingskill, oral communication, and confident level. English 150 is one of
important class that I can use to measure my academic level. A lot of important things I learned
in this class for this semester, which I can use to improve myself especially in generating ideas,
revising compositions, and improving editing process. Idea is the first thing we need to have
before working on our composition so that it can lead and keep us on our objective in writing an
essay. In this class, I notice that before working on any assignment, my instructor always ask the
whole class to write down any ideas we have to do the task. The reason why she gave us specific
time to think and write our ideas is she wantto train us to brainstorm before doing something. This
is how I generate my idea and choose the best option that I have using the list of ideas that I have
from brainstorming process. This process can be interesting part of generating idea because I just
write what I have in my mind even though it is not logic and impossible to do. However, here
come next step, which give solution to the brainstorming process. I used to call it elimination
process. In this process, I need
... Get more on HelpWriting.net ...
21. Choline Supplementation
BIO127IN
August 1, 2013
Choline Supplementation
During pregnancy, there are so many vitamins and minerals your doctor recommends you take that
it can make anyone feel overwhelmed. Luckily for people like me, they ve made these wonderful
things called pre natal vitamins that can make anyone s life easier by not having to track how much
of what you ve taken and when. Pre natal vitamins give you the vitamins and minerals one needs
during pregnancy in order to meet the mother s and the fetus needs and can have added nutrients
you may need because you may not consume enough of a certain nutrient in your diet. One of the
nutrients your pre natal vitamins can contain is choline.
Choline is a nutrient your body naturally produces. But ... Show more content on Helpwriting.net ...
One reasons is that children born with the benefits of choline intake during pregnancy also have
negative side effects. In Choline Baby, Prenatal Choline News and Discussions, Choline During
Pregnancy May Super Charge Children s Brains for Life, the writer refers to these children as
choline kids, and states that these choline kids have a higher thresholds for fear, meaning that it
takes a lot more for a choline kid to be afraid of a situation than a non choline kid. The writer
states that this is a positive thing, however because research is now showing that the less fear a
child has tends to put him or her at a higher risk for aggressive behavior, which the writer has
states he or she (sex of the writer is not revealed in the article) has witnessed in his or her children.
Additionally, this site refers to a study, which found that taking 800 milligrams a day during
pregnancy does nothing to improve a child s memory or language. However, the study provided the
pregnant mothers with a type of choline, not the actual choline supplement and only tested the
children at 10 and 12 months for language skills, general development, and long and short term
memory, so there were no additional test to test the theory or any long term follow ups to match the
results from the study on pregnant rats previously mentioned. It must be said, that Cholinebaby.com
was the only website I found with something negative to say about taking
... Get more on HelpWriting.net ...
22. Starship Troopers Essay
Starship Troopers is a classic novel written in 1959 by retired Navy Lieutenant Robert Heinlein.
At the time that it was published Starship Troopers was controversial yet won the Hugo Award
in the 1960 s for being one of the best science fiction novels. One of the controversies
surrounding the book is the main character s history teacher s view on violence and how
violence has settled more issues in history than has any other factor. The book had such a cult
following that there has been a film adaptation. It is a work of literature that has stood the test of
time and is being read in our schools today. This may not seem shocking for such a classic book,
but being science fictionit is a true accomplishment. The story within this novel... Show more
content on Helpwriting.net ...
The new strategy is for the federation to make hit and run raids to slowly reduce enemy
strongholds. During his time with Rasczak s Roughnecks the book begins a shift and starts to focus
on the daily routine of military life. During this shift Heinlein explains the relationship between non
rates, non commissioned officers, and commissioned officers. After fighting in several more battles
Rico proves that he has what it takes to become an officer. He makes the decision to become a
career soldier and so attends the Officer Candidate School, to become a commissioned officer.
Before Rico is able to graduate he must pass a field test, in which he performs extremely well,
passes and becomes a commissioned officer. In the end Rico commands the special unit and it is
renamed Rico s Roughnecks, as they prepare to make a critical strike to the enemy that could
decide the outcome of the war. This novel depicts the difference between non rates, non
commissioned, and commissioned officers very well. It explains their duties and what is
expected out of them and shows that if someone excels at those duties they will be entrusted with
more responsibility. Every young Marine should read this novel as it shows how one Marine is a
puzzle piece in the large picture, and how that one Marine can make or break a
... Get more on HelpWriting.net ...
23. John Doe Murder
This paper will investigate the anatomy of a mass murderer through a case study of the 1995 film
Seven. The central character in question, who is referred to in the movie as John Doe , is seen
committing unique acts of violence toward his victims. Based on the seven deadly sins of
Christianity, John Doe is observed targeting people that he perceives as sinful and fashions
gruesome methods of torture and murderdepending on their crimes. The assigned readings offer
helpful insight into the inner machinations of this fictional killer, specifically in the understanding
of his behavior and methods of thought.
To begin with, the selected passages from Ervin Staub offer the most valuable evidence to
rationalize the twisted nature of the film s ... Show more content on Helpwriting.net ...
If temperament is in fact perceived as the dominant factor driving human behavior, then this
would mean Doe s cold and calculating traits are evidence of the innate destructiveness that he
exhibits (Fromm, 268). A lack of empathy and remorse traits which are notoriously attributed to
psychopathic behavior are also used to characterize Doe. Indeed, this can be witnessed in the
opening credits of the film, where the viewer observes his meticulous conduct as he writes
extensively in numerous composition books (00:04:10). Doe s wicked character can be further
attested by Fromm in the case of sadism and necrophilia. Throughout the film Doe is seen
exhibiting the personality traits of a sadist: he desired power and control by performing violence
on others and claimed to have enjoyed his victims suffering through his elaborate methods of
torture and murder. Since he cites the bible as his motivation to kill, it can be inferred that he
wanted to take on the role of God to punish the sinners in His place. This could be his ultimate goal
as a killer, where he is able to undergo the transformation of impotence through the experience of
omnipotence by means of murder (Fromm,
... Get more on HelpWriting.net ...
24. Worldwide Paper
Drexel University
Worldwide Paper Company
Group 2 Case Analysis
Brian Burke, John Lafferty
FIN 790 Winter 2015
Seminar in Finance
Dr. Samuel H. Szewczyk
Lebow School of Business
February 9, 2015
Executive Summary:
Blue Ridge Mill is a wood mill owned by Worldwide Paper Company and supplies wood pulp for
the company for use in paper production. Blue Ridge Mill bought its wood supply from
Shenandoah Mill s excess production of shortwood that was processed from its longwood
supplies. In 2006, Bob Prescott, the controller for Blue Ridge Mill, was considering a project that
would give Blue Ridge Mill the capability to process longwood into shortwood, which would
eliminate the need to purchase from Shenandoah Mill, as well as compete ... Show more content on
Helpwriting.net ...
As a result, the cost of debt is 5.88% and is calculated as follows:
The cost of equity can be calculated by using the capital asset pricing model (CAPM). CAPM
requires that a market risk free rate, the market risk premium, and the beta for the company. The
market risk premium (6%) and the company beta (1.1) is given directly and can be seen in tables 2
and 3 below. Government bonds are used for the risk free rate. Since 10 year corporate bonds are
used for the cost of debt, the 10 year Treasury Bond of 5.60% will be selected as the risk free rate.
The 10 year bonds are also a good match for the project duration, which is between 5 and 10 years.
The cost of equity of 11.20% is than calculated as follows:
With the cost of debt and the cost of equity calculated, the WACC is calculated below. The cost of
debt is further discounted by one minus the tax rate since the interest paid on debt is treated as an
expense prior to being taxed.
Table 2: Interest Rates December 2006
Table 3: Company Financial Information
Using the calculated WACC and the company s hurdle rate for this project, under Bob Prescott s
cost savings and additional revenues assumption, the project s IRR is now greater than the hurdle
rate. Furthermore, the net present value (NPV), payback period and the additional value added to
25. the earnings per share (EPS) are shown in Table 4 below. Using just these figures, the project
should be accepted.
... Get more on HelpWriting.net ...
26. Women Should Not Be A Mandatory Procedure For Chinese Women
Throughout history, women have tried many different ways to make themselves as beautiful as
possible to be accepted into their society. In the eleventh century, Foot Binding seemed to be a
mandatory procedure for Chinese Women. It was an excruciating process that women would go
through to please their husbands. Footbinding became popular as a means of a flaunting status
because women from wealthy families who did not need them to work could afford to have their
feet bound The practice became so established that a womanwho did not have bound feet would
have difficulty finding a husband, for most families they demanded a woman with tiny feet
when selecting a wife for their son. The woman who refused to bind her feet was known to
become an outcast and even punished to death. There are a thousand buckets of tears for one
who binds her feet and 5,000 more for the one who unbinds. ( ) Many young girls did it because
it was a mark of beauty and Chinese women with the smallest feet were given the best chance of
living a luxurious life style. This time in history was known to have lasted for at least one
thousand years. Although, Foot Binding was appreciated by Chinese men, but for women it didn
t seem like something to look forward too. This was an excruciating method of women folding all
of her toes, except for the big toe, into the sole of her foot. It was so that her foot appeared smaller
and pointier. This tradition began in the north, later spreading to all parts of
... Get more on HelpWriting.net ...
27. Our World Is Increasingly Being Taken Over By Workaholics.
Our world is increasingly being taken over by workaholics. The United Sates has been the leader
in very demanding work schedules for decades now. Furthermore, at least eighteen percent of
people work sixty or more hours a week in the United States (Cohen). One of the stimulus that
sparked my topic was The Myth of Sisyphus, by Albert Camus. It connects to my research
because it talks about how Sisyphus was condemned to ever lasting torment and despair knowing
he was doing a lot of futile labor. This labor caused him to have thoughts of suicide because he
saw his destiny and did not see the point of life. Another stimulus I used was Long working hours
and cancer risk: a multi cohort study. It shows how working long hours is linked to... Show more
content on Helpwriting.net ...
Those who worked more than eighty hours a week increased their risk of coronary heart disease
by ninety four percent. The increased risk found in the study may be due to distorted sleeping and
eating habits. When workers spend too much time in the office, they often choose fast food
establishments over cooking their own healthy, nutritious meals for dinner (Cohen). Furthermore,
people who work long hours usually do not exercise often. The Australian Diabetes, Obesity, and
Lifestyle Study found that people who have a high sedentary lifestyle have a 112 percent increase
risk of Type 2 diabetes (Bixby). Another study showed that people who sit for more than twenty
five hours a week have an increased risk in developing metabolic risk factors, such as bad
cholesterol and insulin resistance (Washington Post). On average, a person sittingfor too long is
likely to burn fifty less calories. Burning less calories, in addition to the six pounds gained from
consuming a multitude of office snacks, can have a detrimental effect on an individual s health
(Bixby). Working long hours can have an effect on child bearing women. It causes increased stress
from the conflicts of working long hours on family life. As a result, there is an increased risk of
spontaneous abortion, low birth weight, and prematurity (Harrington). Women who experienced
threatened abortion or preterm birth had longer weekly working hours during
... Get more on HelpWriting.net ...
28. The Alchemist Symbolism
An Analysis of Mirage Symbolism In The Alchemist Paulo Coelho s The Alchemist tells the story
of Santiago, a young shepherd living in an abandoned church in a small Andalusian town, who is
stripped of his comfortable and safe lifestyle after an encounter with Melchizedek, an Islamic king
who tells him of his Personal Legend (21). Melchizedek points Santiago in the direction of his
treasure only after taking one tenth of his money, giving him two stones, and a lesson on reading
omens. Throughout his journey, Santiago meets new friends, has everything stolen from him three
times, and travels the vast and unknown Sahara Desertall while achieving personal growth and an
understanding of his life s meaning. His journey leads him to an Oasis... Show more content on
Helpwriting.net ...
After being promised a guide to the pyramids and a short travel period he was instead left alone
and without money. What had minutes beforehand seemed like a perfect way to his treasure was
now only an empty promise. Soon after, Santiago is forced to work for a crystal merchant in the
hopes of replacing his lost money and continuing on his quest. He works for the merchant for
eleven months and during this time, continues to think less and less of his Personal Legend. He
becomes skilled in this practice and begins to work towards instead, replacing his flock of sheep
and returning to his past lifestyle. During this time, Santiago perceived reaching the pyramids as an
impossible feat claiming Egypt was now just a distant dream for him and that, like a mirage, it
would always be just out of his reach (56). In this way, Coelho shows that Santiago s morale is
lessening. The more that he stays at the crystal shop, the more he sees his treasure as a mirage
instead of a physical object. Not only can the boy s journey be related to mirages, so to can his
relationship with Fatima. He first meets her at the oasis by the water well. They next day he
returns and tells her that he loves her. From there he begins to tell her of his life as a shepherd and
his search for treasure. Fatima listens patiently for a month and then finally tells Santiago her true
feelings for him. She explains that she is a woman of the desert and
... Get more on HelpWriting.net ...
29. The Importance Of Essential For Healthy Family Functioning...
According to Professor Rick Peterson, there are five essential roles essential to healthy family
functioning, they include providing resources, support and nurturing, development of life skills
(especially for young children), maintenance and management of the family system, and sexual
gratification between spouses. (Peterson and Green) In this section we re going to look at how
these are incorporated into the familys instrumental functioning and their expressive functioning.
Instrumental Functioning As stated earlier in the paper, this family is very set in old traditions.
EM stays home with the kids all day while RM goes to work. While at home EM cooks for the
kids, cleans the house, takes care of the dog, and makes sure the household runs smoothly. They
have decided to homeschool their children when they get a little older, so she is also preparing
information and supplies for that.
Since the kids don t go to daycare, EM has to make sure that they have some interaction
throughout the day, so she brings them on walks to the park. Their daily routine is waking up
and having EM cook everyone breakfast. She packs a lunch for RM and he grabs it before
heading out the door. Once the kids are done eating, EM starts cleaning the house and EJM and
HM are sent outside to play. Then comes lunch time, which according to EM is the craziest part
of the day! The kids are tired and crabby and there is still so much to do. After the kids are done
eating they lay down for
... Get more on HelpWriting.net ...
30. Emotion Regulation in Infants Essay
Emotion regulation involves intrinsic and extrinsic processing of monitoring and modifying
emotional reactions in both positive or negative situations (Martins, 2012). In order for individuals
to have the ability to regulate emotions, they must beware of their emotions. Although infants are
unaware and lack the ability to regulate their emotions, it then becomes the role of a primary carer
to nurture the infant, thus acting as a model for regulating emotions. Evidently, infants grow to
reflect the ways in which their carers control and modify their emotions as well as social
boundaries. Furthermore, emotionregulationis considered an important aspect of an individuals life
as it can moderate emotions and keep them in a manageable range... Show more content on
Helpwriting.net ...
What is emotion regulation in infants 0 4?
The regulation of emotions within adults is considerably more complex than within an infant.
However, this does not mean that infants do not share the same feelings as adults do. Infant
emotion regulation is evidently derived from their primary carers. Empirical research supports idea
as stated by Diener (et al, 2002) whereby the study conducted involved infants completing a strange
situations procedure, this explored the connection between mother infant relationship and the
behavioural strategies used by infants for emotion regulation. Therefore, behavioural strategies used
by infants including self soothing, withdrawal and self distraction with objects is when it is clear
that infants have the ability to control and monitor their emotions (Martins, 2012; Diener et al.,
2002). These strategies are supported through various studies conducted by Martins (2012) as they
explore infants who are able to cope with their emotions obtain certain strategies which contribute
to their ability to regulate their behaviour for example using distractions. Evidently, this shows the
development of infant emotion regulation skills (Diener et al, 2002). Moreover, infants experience
a range of emotions in numerous frustrating situations, including some as simple as waiting to be
fed or sitting in a car seat waiting to go out. It is from this that infants become more aware of their
emotions and begin to find ways of coping
... Get more on HelpWriting.net ...
31. Trayvon Martin s Struggle In The US
I was fourteen when I first became aware of black struggles, particularly in the United States. An
innocent, 17 year old Trayvon Martin was fatally shot by neighborhood watch volunteer George
Zimmerman. Martin was shot plainly because he was Black and yet, Zimmerman walked away a
free man on the grounds of self defense. His death had ignited something in me. A teenage boy
was murdered because an ignorant, racist and self glorified man had garnered the sympathy of the
justice system. Truthfully, this was only a nudge to the direction. As sad it is, I was still naГЇve.
However, with every bullet that pierced through each innocent black body, the systemic racism that
had targeted the Black community for centuries had made itself known to me. More
... Get more on HelpWriting.net ...
32. Cold War in The Hunt for Red October Essay
The Hunt for Red October(1990)
A. Summary
REd October is a hypothetical movie about a soviet defector named Marko Ramius. It was based
on a Tom Clacy novel. Ramius was a Lithuanian submarine commander for the soviets. The red
october is an expiramental nuclear typhoon submarien equipped win an expiramental propulsion
device that is almost undetectable by sonar, and when detected it sounds like an anomoly.Red
October follows agent Jack Ryan as he trys to prove that Marko Ramius is in fact defecting
instead of trying to nuke america. The Captain lost his wife a year before because of a soviet
officer who went unpunished due to political connections. He defected because of her death and the
fear of the new technology. When the soviets... Show more content on Helpwriting.net ...
6. The US strategy for the Cold Warwas based on Mutually Assured Destruction, meaning if the
Soviets launched their missiles, we would launch ours and wipe them out. Our strategy was MAD.
7. The third leg of Mutually Assured Destruction was submarines, which could dive into the ocean
for weeks at a time and had nuclear warheads attached to them.
8. The Russians had failsafes so that an AWOL officer couldn t go and blow up the world. They
had two keys to access the nuclear warheads held by different people on the ship.
9. The Americans had vastly superior submarines over the Russians. While the russian submarines
were noisy, ours could go undetected.
D. Happenings in 1984
Politically:
Ghandi was assassinated
The Soviets boycott the Los Angleles Olympics
Economically:
Average cost of a house was $86,730
A gallon of gas was $1.10
Socially/culturally:
Ghostbusters was popular
Prince Harry was born
E.Happenings in 1990
Politically:
Saddam Hussein ordered Iraq invasion of Kuwait
Nelson Mandela was released from prison
Economically:
Saturn is launched by GM
A formal ban on the trade of ivory was introduced
Socially/culturally:
Bon Jovi and Red Hot Chili Peppers were popular
The Simpsons television show was launched
33. F.How might things happening when movie was made have influenced tone of movie?
In 1990, the Cold War was still fresh on the
... Get more on HelpWriting.net ...
34. The Battle Of Santa Rosa Island
After several months of battles between the north and the south in several states, including
North Carolina, Virginia, Missouri, Kentucky and Tennessee, the war reached Florida in 1861.
The first battle to reach Florida occurred when there was a standoff at Fort Pickens. When
Florida seceded from the Union, there were Union soldiers stationed at Fort Pickens that were
asked to surrender. A force of almost 1,000 volunteer soldiers landed on Santa Rosa Island with
the intent of raiding the outlying defenses and camps near Fort Pickens. General Richard H.
Anderson led these soldiers. Mainly the Sixth New York Infantry Regiment defended the forts
and camps. Soon after the Confederates burned and ransacked the Union camp, reinforcements
were sent from Fort Pickens to assist the confused Union soldiers. The Confederates had 18
killed, 39 wounded, and 30 imprisoned soldiers, while the Union had 14 killed, 29 wounded, and
20 imprisoned. By March 1862, the Confederates completely withdrew from the area. This battle
became known as the Battle of Santa Rosa Island because the union troops landed on Santa Rosa
Island, four miles east of Fort Pickens. Most of the civil war took place in the states of Virginia
and Tennessee but two major battles of and several smaller altercations took place in the state of
Florida. On February 20, 1864 the largest civil war battle in Florida took place near Lake City.
This battle occurred a year after the Emancipation Proclamation was signed and it was
... Get more on HelpWriting.net ...
35. Healthcare Common Procedure Coding System
Clinical vocabularies are defined as terminologies or coding systems that are structured list of
terms which together with their definitions are designed to describe unambiguously the care and
treatment of patients. The clinical vocabularies are used to create classification systems that are
used around the world to provide a method of distributing coded concepts in a stored meaningful
manner. (Thomson 2013) 1.What vocabularies do you have to choose from? The week 4 Neehr
Perfect Assignment gives a list of the more well known and most commonly used classification
systems and are as followed: Healthcare Common Procedure Coding System (HCPCS) Healthcare
Common Procedure Coding System (HCPCS) Level II International Classification of Diseases,...
Show more content on Helpwriting.net ...
International Classification of Diseases, 10th revision, Procedure Coding System (ICD 10
PCS): Coding system developed to replace Volume 3 of the ICD 9 CM manual. International
Classification of Diseases for Oncology (ICD O): Coding system used in tumor or cancer
registries for coding the site (topography) and the histology (morphology) of neoplasms. National
Drug Codes (NDC): Universal product identifier for human drugs used to identify and report drug
products. Current Procedural Terminology (CPT): Coding system established by the American
Medical Association for coding of procedures and services. Diagnostic and statistical manual of
Mental disorders (DSM): Standard classification of mental disorders used by mental health
professionals in the US. Logical Observation Identifiers Names and Codes (LOINC): A free,
universal standard for laboratory and clinical observations, and to enable exchange of health
information across different systems. 3.Is the vocabulary appropriate for your setting and
... Get more on HelpWriting.net ...
36. Wells Fargo Scandal
The Wells Fargo scandal involved a variety of stakeholders who have stake in the issue; however,
the main stakeholders include the consumers, the employees and their families, and stockholders of
the organization. The affect these stakeholders suffer varies, but the ultimate affect the scandal has
had is violation of trust by Wells Fargo and its leadership. When examining this situation, the main
stakeholders who suffered the greatest harm from the scandal were the customers who fell victim to
the fraudand had their privacy violated by an organization they trusted. In the course text, Trevino
and Nelson spoke of the importance of trust and its importance in a service economy. Wells Fargo
violation of the consumers trust has ultimately added... Show more content on Helpwriting.net ...
In California, eight Wells Fargo employees were convicted of committing fraud facing a
maximum penalty of 30 years in federal prison, also each employee is charged with at least one
count of aggravated identity theft, which carries another two years in prison (https:/
/www.justice.gov/usao cdca/pr/eight people charged bank fraud scheme allegedly used
information stolen wells fargo). In the wake of the scandal, over 5,300 employees were fired
over the course of five years for their involvements in the creation of the fake accounts. Some of
the initial whistleblowers of the scandal faced retaliation by being terminated for speaking out
against the orders to open fake accounts. CNN Money correspondent Matt Egan spoke with Bill
Bado, a former employee of Wells Fargo, who has not been able to security another banking
securities job since his termination for calling the Ethics Hotline to report the fraudulent activities.
The last stakeholder of this scandal are the stockholders who have suffered financial lost in having
to pay out millions in the lawsuits filed against Wells Fargo. The stockholders have also lost
confidence in the leadership on the organization affecting how and if they will continue to invest
and whether they will demand for a leadership change among the board of directors. This scandal
not only affect how these investors will spend their money but other investors as well. Scandals of
this magnitude as a negative domino effect on how investors and how they will spend their many
within the
... Get more on HelpWriting.net ...
37. The Uniqueness Of The Kodaly Method
Chapter One The Uniqueness of the Kodaly Method Zoltan Kodaly chose a child developmental
approach when developing his method. This approach teaches skills in the order and pace in
which the child develops rather than subject logic. In a subject logic approach there is no
relationship between the order of presentation and the order in which children learn easily. The
subject matter is simply organized in a fashion that seems reasonable in terms of content. The
subject logic approach rhythmically begins with the whole note and progresses in a manner that is
mathematically reasonable, proceeding next to the half note and then to the quarter note. This
progression is, however, very difficult for a beginning student who has not yet even learned how
to feel a basic beat. Melodically speaking, the diatonic major scale is the general starting point
from a subject logic approach. This also causes issues because the average young child cannot
accurately sing a diatonic major scale. According to research, most children are able to sing a range
of only five or six tones and cannot produce half steps in tune. Unlike the subject logic approach, the
child development approach of the Kodaly method requires arranging subject matter into patterns
that align with the sequence of normal child abilities at various stages of growth. Rhythmically
speaking, moving rhythms are more child related than sustained rhythms. Children can relate a
rhythm such as steady beat quarter
... Get more on HelpWriting.net ...
38. The Joys Of Hyderabadi Cuisine
Hyderabadi Cuisine is also known as Deccani Cuisine. Hyderabadi Cuisine is a very sumptuous
part of the Andhra Pradesh Food. Hyderabadi Cuisine is a princely legacy of the Nizams of
Hyderabad, India. Hyderabadi Cuisine is served all over the World. Hyderabadi Cuisine is famous
for its hot and spicy foods along with its rich cultural heritage. Hyderabadi Cuisinecould be found
in the kitchens of the former Hyderabad state that includes Telangana region, Karanataka region
and Marathwada region. The cuisine also contain city specific specialities like Hyderabad
(Hyderabadi Biryani, Hyderabadi Meethi Dal, Hyderabadi Nargisi Kofta, etc), Aurangabad (Naan
Qalia), Gulbarga (Tahari) and Bidar (Kalyani Biryani).
Hyderabadi Cuisine was developed after the foundation of Qutb shahi dynasty by ... Show more
content on Helpwriting.net ...
The breads fron this cuisine is equally popular. Breads is not only an accompaniment to the meal
but also forms a base of a popular sweet dish of Hyderabadi cuisine Double ka Meetha .
In Hyderabad presentation of food is also important which reflect richness of food and culture.
Royal dining hall was called Shahi Dastarkhana where royal families used to relax and party on the
delicious Hyderabadi Cuisine.
Equipments Used In The Hyderabadi Cuisine
1. Heated stone slab (Pathaar): This was used in making of kebabs. The stone was heated using live
coals.
2. Skewers (saliyans): The meat was cooked over the flame by either coating the skewers with the
meat or by piercing the meat with the skewer.
3. Taater (sigri): It consist of a metal framework that is heated by coal. The meat pieces are grilled
on the framework.
4. Tandoor: A tandoor is a cylindrical clay oven used in cooking and baking. The heat for h tandoor
was traditionally generated by a wood fire, burning within the tandoor itself, thus exposing the food
to both live free, radiant heat cooking, and hot air, convection
... Get more on HelpWriting.net ...
39. Loving a Vampire is a Fantasy and a Nightmare in Stephanie...
To be irrevocably in love with a vampire is both a fantasy and a nightmare woven into a reality for
Bella Swan. Pulled in one direction by her passion for Edward Cullen, and in another by her
connection to werewolf Jacob Black, she has endured a tumultuous year of temptation, loss and
strife to reach the ultimate turning point. Her pending choice, to either join the dark but seductive
world of immortals or pursue a fully human life, has become the thread from which the fate of two
completely different tribes hangs. Now that Bella has made her decision, a startling chain of
unprecedented events is about to unfold with potentially devastating and unfathomable
consequences. Breaking Dawnis split into three separate parts. The first part... Show more content
on Helpwriting.net ...
The third section of Breaking Dawn shifts back to Bella s perspective, finding her changed into a
vampire and enjoying her new life and abilities. However, the vampire Irina misidentifies
Renesmee as an immortal child , a child who has been turned into a vampire. Because immortal
children are uncontrollable, the Volturi has outlawed creating them. After Irina presents her
allegation to the Volturi, they plan to destroy Renesmee and the Cullens. In an attempt to survive,
the Cullens gather other vampire clans from different parts of the world. All put forth a special
talent that makes them almost unbeatable. Towards the end they go and meet at the battlefield.
Renesmee then goes and uses her powers of memories or possibilities of the future to the Volturi,
not liking their fate if they continue and fight, the Volturi back out and end things peacefully until
next time. When the Cullen friends leave to return to their covens, Nahuel, the vampire hybrid,
and his companion stay. Nahuel keeps staring at Bella, which makes her, feel uncomfortable.
When she tells Edward, he explains to her that it s because she is alive. When he saw Bella,
Nahuel realized that being half immortal doesn t mean he s inherently evil. Bella s excited to see
Charlie again. She s happy that he found a great match in Sue Clearwater the werewolf s mom
with the vampire s dad. Most importantly, Bella is happy that she ll be with Edward, forever. After
they
... Get more on HelpWriting.net ...
40. Larkin Is Misogynist
Larkin is a misogynist who hates marriage and children. Discuss how far you agree. I agree with
this statement to some extend but not fully. I think Larkin can come across in these ways however
to put a definite label on him would be an assumption. Also I think that by saying he hates children
and marriageis too much of a strong statement and perhaps he personally never chose to do these
particular things in life or couldn t understand them. Larkin comes across as a misogynist from
the way he presents women as just objects for the purpose of men. For example in the poem For
Sidney Bechet he writes sporting house girls like circus tigers (priced far above rubies) which is
perhaps referring to wild prostitute women who have been... Show more content on Helpwriting.net
...
He describes the dresses and the cheep fabrics of nylon and fake colours lemons mauves and
olives and from the way he uses foods can be interpreted to have a significant symbolic meaning
in the sense that these organic foods become out of date in time, which could be suggesting he
has a bitter opinion on marriage that it will soon become dull over time and never last. In the
penultimate stanza he writes how none thought of the others they would never meet or how
their lives would all contain this hour he really expresses Larkin s view on marriage and
commitment, as he appears to feel that marriage limits chances and options it also raises the
question as to whether he feared marriage and the change it could have on his life and freedom.
This would suggest that as opposed to hating marriage Larkin merely feared it. The line sun
destroys the interest of what s happening in the shade metaphorically could be interpreted to
show how fabulous display of a wedding can destroy or distract what happened out of view from
the public like the stress, disputes and reality of faults in the relationship. The imagery of the sun
also creates a bright beautiful link with weddings that people see on the surface juxtaposed with
the reality of dullness as the years go on. In the poem Self s the Man he portrays Man to be more
superior to women. His opinion of love s initial excitement contrasted with the
... Get more on HelpWriting.net ...
41. Evaluation of Reclaimed Asphalt Pavement
Evaluation of RAP Material
Reclaimed Asphalt Pavement (RAP) is the term given to removed and/or reprocessed pavement
materials from an old pavement containing bitumen and aggregates. These materials are obtained
when asphalt pavements are removed for reconstruction, resurfacing, or to gain access to buried
utilities. When properly crushed and screened, RAP consists of high quality, well graded
aggregates coated by asphalt cement (FHWA 1998).
The collected RAP material used in the study is collected from Narela and was tested in the
laboratory for the following properties: Determination of Bitumen Content (ASTM D 6307) Binder
recovery through Abson Method (ASTM D 2172 and D 1856) Gradation of the recovered
aggregates of RAP (IRC 37:2012 specifications)
Detailed description of these tests is provided in the following subsections.
(a) Determination of Bitumen Content
The RAP sample is heated in the furnace at the 538 п‚°C temperature until the difference between
consecutive measured mass loss does not exceed 0.01 % of the sample mass for three consecutive
1 min intervals. This point shall be determined automatically by the furnace s data collection
system. The furnace s data collection system shall measure and record automatically the aggregate
mass of the sample after ignition to the nearest 0.1 g. The mass shall be obtained immediately upon
completion of tests by subtracting the mass loss measured by the furnace from the initial mass of
the mix. The corrected asphalt
... Get more on HelpWriting.net ...
42. The Examination Of The Prosecution Witness
Dear James Blackburn, thank you for contacting me with your case. As an expert witness, I am
more than happy to assist you in the examination of the prosecution witness evidence and account
of the incident. Firstly, we must consider any confounding factors that may have influenced the
witness memory and therefore influencing their testimony. Some factors we must consider are;
cross raceeffect (CRE), weapon focus effect, own age bias (OAB) and the bystander effect. I will
attempt to aid you in this case by referring to information and knowledge that has been provided
and highlighted by previous research. These factors must be deliberated in regards to the validity
and credibility of the witnesss statement. Nonetheless, I will provide as much information I can to
help with your client s case.
Issue: Cross race effect
Fact: The witness is Black and the client is Caucasian.
Opinion: The cross race effect, otherwise referred to as own race bias explains why people are
more likely to recognise someone who is the same race as them. In this case, the witness may have
misinterpreted the scene as a result of this effect. For example, the criminal justice system regularly
relies on eyewitness identification when a crime has been committed (Sporer, 2001). Eyewitness
identification is still used despite the common difficulties eyewitnesses have recognising faces of
racial outgroup members. In your client s case, a black witness, and a white out group. These
recognition errors
... Get more on HelpWriting.net ...
43. Use Of Utilitarianism
Utilitarianism is a theory that was founded by Jeremy Bentham and was later revised by John
Stuart Mill. This theory is based on producing the greatest amount of happiness for the greatest
amount of people and all self aware beings on Earth. Utilitarianism factors in the amount of bad
and good that will be produced by an act. It uses this whether it is during the act or after the act
has been done. A utilitarianist believes in one ultimate goal: living a life without pain and a life
with many enjoyments. Pain and enjoyments are different to everyone so they are hard to judge
sometimes. Mill stated that overall happiness is key and that we as a society should try to
maximize quality and quantity of overall happiness.
Utilitarianism has three
... Get more on HelpWriting.net ...
44. Symbolism In Eventide 3
Mary Gilbert, the world renowned botanist, is back and if the previous two Eventide games
taught us anything, this means that one of her unfortunate family members are going to end up
kidnapped. This time it is Mary s brother John who gets whisked away by some sinister creatures
called Zmeys after she decides to pay him a visit. The monsters take him to a land in the clouds,
but luckily for Mary, a house spirit called Aitvar arrives to assist her with reaching this magical
world on the other end of the rainbow. Once there, Mary discovers that it is an evil sorcerer that is
behind the kidnapping, so she has no choice other than defeating him and finding her brother while
also saving the world in the process.
Players who are familiar with hidden ... Show more content on Helpwriting.net ...
The tracks on offer thankfully never becomes repetitive, but some more variety would have been
even better. The sound effects are very good and even the voice acting is quite solid for the
genre. Too many hidden object games suffer from voice acting that sounds like characters are
merely reading their lines from a script, so it is great to hear that a little more effort went into
this one. Of course, if you are not a fan of voice acting it can be muted as the game allows you to
adjust the music, sound and voice volumes separately. The interface of Eventide 3 is standard
hidden object game fare, and if you ve played any other title in the genre you ll feel right at
... Get more on HelpWriting.net ...
45. Fun House, Not So Fun
Linda Ray
English 230
Instructor: Dr. Hernandez
Date: November 6, 2016
Fun House, Not So Fun
The autobiographical graphic novel Fun Home, by Alison Bechdel presents characters evolving to
the reader in an intimate way. She reveals within her novel the high cost of claiming to be gay or
lesbian within America. Instead of reading the author s recollection of her experiences, her graphic
novel connects the reader within the experience as the observer. This allows the reader to look at
both the personality of the novelist and the developmental impacts that have shaped her. Fun Home,
is a distinctively persuasive novel that is entangled within the lives of Alison s family. While
presenting to the reader the explanations of Bruce s death, Alison endeavors to adjust to the reality
of her father s death by remembering family life at the Fun House.
Alison introduces the mourning of her father to the readers as the central event of the story in
the first chapter. She proclaims her father s demise by saying; His death was quite possibly his
consummate artifice, his masterstroke. In essence she is broadcasting Bruce Bechdel death as a
clever move, while trying to acclimate to the reality of her father s death. Her lack of emotions
shows she has not adapted to reality, the comic strip illustrates her dead stair looking away from
her father s coffin. At the same time, family and friends believe Bruce was run over by a truck and
his death is an accident, but Alison is convinced
... Get more on HelpWriting.net ...
46. Passive Feminist
The dictionary tells us that feminist are women fighting for political, social, and personal equality.
The dictionary however, is not always correct because anyone in society, whether young or old,
man or woman, can be a feminist. What makes a person an active feminist, a passive feminist or if
they are solely against feminism? Many people have passively agreed with feminist ideals without
realizing they are doing so. I can say I am a passive feminist because I disagree with construction
signs indicating men working when womanmay also be working at the same construction site, but
have never created action to change the name of the signs indicating construction. I have no
problem associating myself as a passive feminist because I agree with... Show more content on
Helpwriting.net ...
Anthony and Disney I placed Anthony as an active feminist and Disney as a passive feminist.
When I look at America today, I would place a majority of men and woman under the passive
feminist category. I feel a majority of people fall into those ideals because there are small
arguments regarding feminist issues, but no action is taken on a broader scale to promote
change. When I think of a feminist I think of someone such as Susan B. Anthony, who did
something regarding women s rights and made a positive change within society. In today s
society, technology regulates much of our daily life and technology is where people go to voice
their opinions about feminist ideals. Often times, celebrities will tweet about how woman can
stand alone from men and how woman should not be sent home for what they wear because it
could distract a male classmate. Those tweets circulate for a while but are soon forgotten. Those
celebrities who type those messages are not an active feminist, they are simply an American
utilizing their right of freedom of press under the First Amendment. Anyone can be a feminist, but
to be a feminist he or she needs to do more than tweet to create change. Circulating the idea is a
minimal step, one needs to advocate the issue on a more public level to create change for woman
and therefore be considered an active feminist. Some celebrities often argue for woman having
more equality with men and their ideals follow feminist s ideals, but they deny ever associating
themselves with the word. These people feel that if they say they are a feminist than, they are
saying that woman are better and more superior then men. These celebrities are acting as passive
feminist who are voicing their opinions about subjects related to the matter but doing nothing more
to create change. In another sense some celebrities are active feminist and want to promote change
but will still deny associating themselves with the name. People feel that if they
... Get more on HelpWriting.net ...
47. Medicare In Canada Research Paper
Medicare in Canada is a government funded universal health insurance program established by
legislation passed in 1957, 1966 and 1984 (Canada, 2012). Openly funded and administered,
comprehensive, accessible hospital and medical services insurance plan has a much longer and
more complex history than simply the politics of creating a federal provincial territorial shared cost
agreement. This viewpoint was challenged by those who stated that individuals must take
responsibility for their own and their family s health care needs through private, prepaid insurance
plans, and that the government should underwrite the costs for those who could not afford such
benefits Canada, 2012). In contrast to the United States, where Medicare is restricted to... Show
more content on Helpwriting.net ...
(2012, October 09). Canada s Health Care System. Retrieved December 13, 2017, from https:/
/www.canada.ca/en/health canada/services/health care system/reports publications/health care
system/canada.html
World Health Organization. (n.d.). Canada. Retrieved December 12, 2017, from http:/
/www.who.int/countries/can/en/
Fuchs, V. R., Hahn, J. S. (1990). How does Canada do it? A comparison of expenditures for
physicians services in the United States and Canada. New England Journal of Medicine, 323(13),
884 890.
Canadian Health Care. (2007). Retrieved December 12, 2017, from http://www.canadian
healthcare.org/page3.html
Diagnosis of COPD. (n.d.). Retrieved December 06, 2017, from http://www.who.int/respiratory
/copd/diagnosis/en/
World Health Organization. (2015, January). Canada: WHO Statistical Profile. Retrieved December
12, 2017, from http://www.who.int/gho/countries/can.pdf?ua=1
Mittmann, N., Kuramoto, L., Seug, S. J., Haddon, J. M., Bradley Kennedy, C., FitzGerald, J. M.
(2007, December 20). The cost of moderate and severe COPD exacerbations to the Canadian
healthcare system. Retrieved December 05, 2017, from
... Get more on HelpWriting.net ...
48. Differences Of Arial And Helvetica
As we have seen from this case, typefaces, more than any other design elements, provide a link to
the history of printing and how technology influences the concept of normal . The development of
normal rests on how human interfaced with the technology: partly on the new added or
disappeared constraints; partly due to the different interactions in a totally new context. Design is
refining the normal bit by bit so that the typefaces as well as other products are still fits in with
people s life with the core of absence and familiarity and finally exceeds normal design to Super
Normal design by the judgement of time.
Super Normal, from a conceptual point of view, leans on an intentional and extraordinary
ambivalence (Fukasawa Morrison, ... Show more content on Helpwriting.net ...
They both are sans serif typefaces that are universally embraced by different communication
platforms. At first glance, they seem very similar. When Arial was released in 1982, it was seen as
a copy of Helvetica of 1957. But if a user examines the characters in each typeface closely, the
differences between them become apparent. Mark Simonson, an American graphic designer,
produced an analysis of the two, which shows how much more refined Helvetica s detailing is
than Arial s. The tail of the a is gently curved in Helvetica, as is the first connection of the bowl to
the stem, but not in Arial. Similarly, the top of the t and the ends of the strokes in the C and S are
perfectly horizontal in the former, but slightly angled in the latter. He also noted that the stem of
Helvetica is more complex in the structure than those in Arial. The distinguishing details are so tiny
that can be noticed when they are scrutinized magnified versions of each character as Simonson
did. Yet it is these subtleties that constitute Helvetica a finer example of design than Arial for
professionals. Functionally the two fonts are roughly equal, as both are admirable clear and
considered to be Super Normal, but aesthetically Helvetica is
... Get more on HelpWriting.net ...
49. San Francisco Social Inequality Essay
Social Inequality of the Golden City The Golden Gate Bridge takes a curious traveler across the
San Francisco Bay area into a marvelous journey towards a technologically innovative city of San
Francisco. The city of San Francisco has forever been a national symbol of coveted opportunity,
cultural disapprobation, technological blossoming and, frankly, economic inequality. In the past,
countless attempts were made by multiple scholars to identify the sources of San Francisco s
social inequality. Statisticians compiled large tomes of data, while Sociologists wrote unending
arrays of books; all in efforts to understand the basis of social inequality in the Golden City.
Likewise, this essay will begin by identifying early sources of... Show more content on
Helpwriting.net ...
By and large, the war continued until 1848 its victory awarded America with the new territory,
which marked the beginning of economic advancement of the west. Perhaps, 1848 also marked the
beginning of social inequality.
Upon the discovery of gold in California, thousands of fortune dwellers migrated to San
Francisco. In fact, the population of San Francisco increased from 450 in 1848 to a colossal size
of 25,000 by the end of 1949 (SFgenealogy 2017). Incidentally, multiple gold mining towns were
erected across San Francisco. The new towns grew often in the form of businesses, food courts, and
even entertainment facilities. Paradoxically, this historical nuance introduced the division of people
by class. Division of class in San Francisco, meant that individuals who initiated first business
facilities were now becoming wealthier by exploiting their lower class counterparts. A tempting
question arises, who were those lower class counterparts? A demographic report of 1853 provides
nothing unusual about the San Francisco s population: 98.3% of the population were white leaving
the remaining 1.7% to African Americans, Indians, etc. (SFgenealogy 2017). However, a statistical
report by the Secretary of State to the California Legislature, sheds light onto the demographic
description mentioned above; Figures for Hispanics were
... Get more on HelpWriting.net ...
50. The Burst Of The Housing Bubble Essay
The burst of the housing bubble in the U.S., which peaked in 2004, led to a huge decline in value
of securities that tied to U.S. real estate pricing. The effect caused massive damage to financial
institution globally. These three factors including price appreciation in housing market, high
growth of the private label residential mortgage backed security in the main fuel for the extensive
growth of the mortgage market beginning in 2000. This section describes the fundamental factors,
which are credit risk, liquidity risk, market risk, and operational risk, relating to the financial crisis
between 2007 and 2008.
Credit Risk
Credit risk refers to the probability of loss due a borrower s failure to meet its financial obligations
on any type of debt. Credit risk may involve the potential lost from the principle, interest rate,
coupon, insurance, bankruptcy, and etc. It is crucial for bank to manage credit risk, and maintain it
exposure within an acceptable parameter which would not lead to a tremendous loss to the banks
(BIS, 1999).
The source of credit risk varies from one bank to another. However, loans are commonly known to
be the largest source of credit risk. Credit risk occurs in other related banking activities, such as
banking book, trading book, and the off the balance sheet as well. Besides, there are different
financial instruments that create credit risk including bonds, equities, option, future contract,
foreign exchange, and swap. In addition, credit risk is
... Get more on HelpWriting.net ...
51. Woolworths Introduction
MBA503 Marketing for Managers
Session 1 2013
Faculty of Business
School of Management and Marketing
CSU Study Centre Melbourne
Internal Mode
Subject Coordinator Belinda Fridey
Subject Overview
Welcome to a new session of study at Charles Sturt University.
Marketing is an enterprise wide opportunity for any organisation to understand its customers and
the markets they might wish to participate in. Marketing management is concerned with
identifying, entering and developing markets and aligning the organisation s resources to achieve
its goals. This subject will introduce students to key ideas, philosophies and theories that make
marketing an essential activity in any organisation. Specifically, students will investigate marketing
s ... Show more content on Helpwriting.net ...
Learning outcomes
On completion of this subject you will be able to:
Assess and explain the nature of marketing and marketing management in contemporary
organisations, Investigate and assess the role of market orientation in an organisation of your choice
Investigate and describe how market research contributes to solving marketing problems;
Evaluate the key marketing aspects of segmentation, targeting and positioning (STP) and be able to
analyse organisations approach to STP
Apply the Marketing Mix and aspects of branding and positioning to a specific target market and be
able to evaluate competitors programs
Discover and evaluate how contemporary issues of environment, social media and other technology,
society and Corporate Social Responsibility (CSR) might affect marketing.
Analyse a marketing challenge and create a marketing plan to be applied to an organisational
situation, to achieve desired outcomes.
Graduate attributes
Marketing skills and experience will allow you to develop and understanding of the firm which cuts
across the functional areas of the firm and allows you a holistic understanding of customers and the
resources available to pursue them. These are valuable assets for the individual and the organisation.
Course objectives
The objective of this subject is to give you a sound appreciation of the marketing discipline and
how effective marketing can be used to help organisations compete effectively.
Attendance
Attendance is required
53. A Profile Of Hamilton Albert Fish
A Profile of Hamilton Albert Fish
In the early summer of 1870 a forth child, Hamilton, was born into the home of Randall and Ellen
Fish of Washington, DC. The Fish family had a history of severe mental disorders: an paternal
uncle who had been diagnosed with religious psychosis, a maternal uncle who was diagnosed with
schizophrenia, and his mother claimed she had visions. Hamilton s siblings also had problems:
his brother was confined to a state mental hospital, his sister was diagnosed with a mental
affliction, and his youngest brother was slow witted and an alcoholic(Wertham, 2012). In 1870,
little was known about the lineage of schizophrenia , its sub types, and how it could effect future
generations. Today we know genetic factors may lead to schizophrenia and its sub
types(Esterberg,2010). Little Hamilton Fish was born with a vulnerability to schizophrenia
and its sub types. This type of genetic vulnerability is called a genetic marker. It is easier to
think of a genetic marker as a genetic light switch, while not all switches are turned on, some
times a factor comes along and switches it to the on position; thus, the person develops the
genetic disorder. The traits and subtypes of this disorder in individuals who have been abused can
develop in to a perceived evil that will shock and strike terror in to society. In 1874, Randall Fish
died of a heart attack. Unable to care for her children Randall Fish s wife,Ellen Fish, placed five
year old
... Get more on HelpWriting.net ...
54. Should The Military Occupation Of Israel
Apart from the growth of infrastructure, the military occupation needs to end so that the Palestinian
people can move freely through Palestine because the current restrictions through the occupation
destroy Palestine s ability to self govern. We need to end the military occupation; it has gone on
long enough. After the Oslo Accords, the West Bankis now comprised of small detached Palestinian
areas within a continuous Israeli controlled region (Le More 984). For eventual stability, Israelmust
relinquish its control of the West Bank and Gaza. The occupation creates the conditions for
Palestinian hatred of Israel, especially when Israel bans travel between Palestinian villages in the
West Bank through the presence of military personnel and checkpoints (Hadid Sengupta). Israelis
need to let Palestine be a state, and if they support its development, the Palestinians will hate Israel
less. Palestinians need to be able to go throughout the West Bank, or else there will never be self
determination. To grant further autonomy, Israel should allow for more transportation between
Gaza and the West Bank. A road between the West Bank and the Gaza Strip would drastically
improve the free movement of the Palestinian people (Hazboun). If there is more freedom of
movement, Palestine would get more opportunity to develop, and Israel would dampen the anti
Israeli sentiments amongst the Palestinians. The freedom of movement can only occur if the
occupation ends; Israeli withdrawal is best
... Get more on HelpWriting.net ...
55. How Cuneiform Writing Has Changed The World
1)Cuneiform writing is known to be an ancient writing system and was created when early
civilizations needed a way to keep record of events that has happened year to year such as; grains
produced last year, the livestock that they had and the total cost of livestock. The system was
discovered in 500 BCE by the Sumerians and Mesopotamians. The use of Cuneiform writingled to
more advanced forms of writing as the years went on, it broadened their minds and later lead to
the use of papyrus as a means for portable media.
2)The printing press was such an important and revolutionary development because it allowed
books to be mass produced, before the printing press all books had to be hand written. This
created countless errors in the print and limited overall production of books due to the required
time it takes to handwrite a book. The first printed book that was known to have changed the world
was the Gutenberg Bible , produced in 1455. It was the first mass produced written word.
3) ... Show more content on Helpwriting.net ...
The two major individuals who created T.V were Sarnoff and Paley, who used their profits from
the radio industry to develop T.V. They knew television would eventually take over radio. In
1939, NBC television s commercial debut. In the beginning of 1939, radio was drawing 81% of
all broadcasting audience, by the end of the year, it was only 41%. The 50 s were a huge
milestone for us, the first early experiments of colored T.V, and in 1951 TV casted the first female
studio lead and producer in I Love Lucy. Just fifteen short years after that, three networks were
broadcasting in
... Get more on HelpWriting.net ...
56. Orange Shading Filters
Color correction is one of the most used things in photography and new technology is allowing for
artists to take inspiring photos that can truly make a difference. A picture s natural beauty can be
everything but when something is missing in a photo, adding a filter can change the perspective of
the picture to the way the photographer sees it. One of the most used type of colorcorrection is black
and white. Black and white pictures often show emotions like sadness or happiness, this is because
the color reminds people of older photos.Out of all of the other correction tools that are used to
change photos, this filter is the most dramatic. Another common filter that is used by photographers
is orange shading filters. This is a famous because
... Get more on HelpWriting.net ...