SlideShare a Scribd company logo
PRODUCTION AND CHARACTERISATION
OF
BY LACTOBACILLUS PARACASEI FROM DAIRY
SAMPLES
• Dextran is group of high molecular mass polysaccharides.
• Composed of complex branched Glucan chains of different
lengths(3to2000kd).
• It is used to medicinally as an Antithrombotic (antiplatelet) to
reduce blood viscosity.
Introduction Of Dextran
• Dextran was first discovered by Louis Pasteur as a microbial
product in wine.
• Scheilberin (1874) confirmed that this microbial
polysaccharide with the empirical formula (C6H10O6) n and
therefore named as “dextran”.
• Dextran is produced by species of Leuconostoc, Lactobacillus
, Streptococcus and Acetobacter.
• It finds various other industrial applications .
Objectives
 Isolation of bacterial stain from dairy sources.
 Biochemical Characterization of the isolated bacterial stain and
identification.
 Confirmation of the identified bacterial stain using Sanger’s sequencing
method.
 Production of Dextran by the bacterial stain isolated from dairy and
vegetable sources.
 Characterization and confirmation of Dextran using FTIR analysis.
D
E
X
T
R
A
N
Isolation of colonies
Characterization of
Bacterial strain
DNA sequencing
c
c
v
Production of
DEXTRAN
Characterization of
DEXTRAN
Application Of
DEXTRAN
Experimental design
• The Lactobacillus sp. were isolated from available sources :
Fermented vegetables :
 cabbage
 cauliflower
 pumpkins
 carrot and tomato
Dairy products :
 Yoghurt
 Milk
Materials and Methods
 Sources
MSE agar was prepared
and then pour into the petridish
and allowed to solidify.
Sample (milk) was
collected and was
diluted
Transfer 0.1ml of
Serial diluted sample
onto agar plates
Spread the inoculum on the
surface of the agar by L rod
method
The plate was
Incubated at
25ºC at 24 hrs
Colourless, mucous
colonies
were developed

• Gram staining
• Indole test
• Oxidase test
• Catalase production test
The isolated bacterial strain was were confirmed the
Morphological and biochemical test.
Morphological and Biochemical characterization
of bacterial isolate:
 Conformation by sanger’s sequencing
 The sample was sent for analysis of 16s r RNA Analysis
in the laboratory of Yazzah genomics, Chennai. To analysis
 DNA isolation
 PCR
 Sequencing
NCBI – BLAST
 Phylogenetic tree construction
DEXTRAN PRODUCTION
Specific Dextran production Broth
A loopful of culture of colonies was inoculated in
10 ml of Dextran production broth
This Inoculum mainly used for Dextran production
Preparation of inoculum
Culture was incubated at 26˚.C
for 18 hrs.
40 ml of Sterile Dextran production
Medium was prepared and then added to
60 ml of inoculum medium
pH was adjusted at 5.5 to make
more it viscous
Production of Dextran
dextran
production
medium
After 18 hours of incubation, the culture medium was
precipitated by using chilled ethanol.
Precipitation of Dextran
Equal amount of
ethanol was added and
stirred well and
centrifuged at 4000
rpm at 30 minutes.
The supernatant was
discarded
Chilled ethanol
was added with constant
stirring and precipitates
of dextran was obtained
It was allowed to stand
for 5–10 minutes and
supernatant was again
decanted.
• precipitated Dextran was washed with distilled water
and centrifuged thrice to get purified Dextran .
• Sterile distilled water will be added step wise to make
a paste of dextran in water.
Purification Of Dextran
 RESULTS and DISCUSSIONS
Identification organism
The Bacterial strain were initially confirmed by growing it on
the selective MSE agar. Then they were confirmed by
phenotypic and biochemical characterization.
Figure 1: Isolation bacterial sp by spread plate method- The plate shows individual
colonies of bacterial isolate
Biochemical Test Results
Gram staining Positive
Motility Non-Motile
Oxidase Negative
Catalase Negative
Indole Negative
Morphological and biochemical characterization o f bacterial
strain
Gram staining - positive
Indole test - Negative
Oxidase - Negative
Conformation of bacterial strain by sanger’s sequencing
Figure 10: Sanger sequencing
sequence
>KIR_800R.ab1 821
CCGGTCTTTTCGAGCCTCAGCGTCAGTTACAGACCAGACAGCCG
CCTTCG
CCACTGGTGTTCTTCCATATATCTACGCATTTCACCGCTACACATG
GAGT
TCCACTGTCCTCTTCTGCACTCAAGTTTCCCAGTTTCCGATGCGC
TTCCT
CGGTTAAGCCGAGGGCTTTCACATCAGACTTAAAAAACCGCCTG
CGCTCG
CTTTACGCCCAATAAATCCGGATAACGCTTGCCACCTACGTATTAC
CGCG
GCTGCTGGCACGTAGTTAGCCGTGGCTTTCTGGTTGGATACCGT
CACGCC
GACAACAGTTACTCTGCCGACCATTCTTCTCCAACAACAGAGTTT
TACGA
CCCGAAAGCCTTCTTCACTCACGCGGCGTTGCTCCATCAGACTT
GCGTCC
ATTGTGGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTTTGGGC
CGTGTC
TCAGTCCCAATGTGGCCGATCAACCTCTCAGTTCGGCTACGTATC
 NCBI - BLAST
Figure 11: The figures shows that Nucleotide sequence analysis of BLAST
Figure 12: Description Query coverage analysis of BLAST
Figure 15: Multiple Sequence alignment and Similarity studies
 Phylogenetic tree construction
Figure 16: Phylogenetic tree construction – The figure shows the
relationship of the Lactobacillus paracasei sp with its related
bacteria
Dextran production
 Preparation of inoculum
Medium pH: ± 6. 9
Temperature: 25 °C
Incubation time: 24hrs
Figure17: Preparation of inoculum
 Dextran production
Figure18: Production of Dextran in MSE Dextran preparation media
Medium pH: ± 5.7
Temperature: 25 °C
Incubation time: 18hrs
 Precipitation and Purification of Dextran
Centrifuge speed: 4000 rpm
Minutes: 10mins
 conformation of Dextran by FTIR analysis
 Application of Dextran
 Protein stabilization
 Vaccines
 Antiplaetlet
 food
• Sarwat, F., Qader, S. A. U., Aman, A., & Ahmed, N. (2008).
Production & characterization of a unique dextran from an
indigenous Leuconostoc mesenteroides CMG713.Int. J. Biol. Sci,
4(6), 379-386.
• Üretimi, D. (2005). Production of dextran by newly isolated
strains of Leuconostoc mesenteroides PCSIR-4 and PCSIR-
9.TürkBiyokimyaDergisi [Turkish Journal of Biochemistry-Turk J
Biochem], 31(1), 21-26.
 References
production and characterisation dextran by lactobacillus paracasei

More Related Content

What's hot

Enzymes used in food industry
Enzymes used in food industryEnzymes used in food industry
Enzymes used in food industry
Ibad khan
 
Food and fermented products
Food and fermented productsFood and fermented products
Food and fermented products
Priyengha R.S
 
Dairy fermented products
Dairy fermented productsDairy fermented products
Dairy fermented products
varsha chauhan
 
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
Dr. Pavan Kundur
 
Fermentation of vegetables and meat products
Fermentation of vegetables and meat productsFermentation of vegetables and meat products
Fermentation of vegetables and meat products
Aman Kumar
 
Contamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and VegetablesContamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and Vegetables
SuganthiA4
 
Fermented sausages .pptx
Fermented sausages .pptxFermented sausages .pptx
Fermented sausages .pptx
rahulkumar509502
 
Fermented food products cheese,yoghurt,kefir
Fermented food products cheese,yoghurt,kefirFermented food products cheese,yoghurt,kefir
Fermented food products cheese,yoghurt,kefir
narayanianu
 
Microbial spoilage of milk and milk product
Microbial spoilage of milk and milk productMicrobial spoilage of milk and milk product
Microbial spoilage of milk and milk product
Tribhuwan university
 
Sauerkraut
SauerkrautSauerkraut
Sauerkraut
Mohit Kohli
 
production of baker's yeast
production of baker's yeastproduction of baker's yeast
production of baker's yeast
Samyuktha Magesh
 
Mechanism of enzyme and function in food processing
Mechanism of enzyme and function in food processingMechanism of enzyme and function in food processing
Mechanism of enzyme and function in food processing
sivaranjaniarunnehru
 
Fermented dairy foods
Fermented     dairy foodsFermented     dairy foods
Fermented dairy foods
Mamta Sahurkar
 
Kefir & Kumis
Kefir & KumisKefir & Kumis
Kefir & Kumis
Ammar Babar
 
Fermentation of cheese (1)
Fermentation of cheese (1)Fermentation of cheese (1)
Fermentation of cheese (1)
sajid ali
 
Control systems in fermenter
Control systems in fermenterControl systems in fermenter
Control systems in fermenter
Dhanya K C
 
Vinegar production
Vinegar productionVinegar production
Vinegar production
Yen Ng
 
Xanthan gum
Xanthan gumXanthan gum
Xanthan gum
Srisha Belur
 
MICROBIAL METABOLITES AS FLAVOURING AGENTS
MICROBIAL METABOLITES AS FLAVOURING AGENTSMICROBIAL METABOLITES AS FLAVOURING AGENTS
MICROBIAL METABOLITES AS FLAVOURING AGENTS
sarabjit777
 
Organic acids production copy
Organic acids production   copyOrganic acids production   copy

What's hot (20)

Enzymes used in food industry
Enzymes used in food industryEnzymes used in food industry
Enzymes used in food industry
 
Food and fermented products
Food and fermented productsFood and fermented products
Food and fermented products
 
Dairy fermented products
Dairy fermented productsDairy fermented products
Dairy fermented products
 
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
Anti-foaming agents, inducers, precursors and inhibitors in Fermentation tech...
 
Fermentation of vegetables and meat products
Fermentation of vegetables and meat productsFermentation of vegetables and meat products
Fermentation of vegetables and meat products
 
Contamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and VegetablesContamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and Vegetables
 
Fermented sausages .pptx
Fermented sausages .pptxFermented sausages .pptx
Fermented sausages .pptx
 
Fermented food products cheese,yoghurt,kefir
Fermented food products cheese,yoghurt,kefirFermented food products cheese,yoghurt,kefir
Fermented food products cheese,yoghurt,kefir
 
Microbial spoilage of milk and milk product
Microbial spoilage of milk and milk productMicrobial spoilage of milk and milk product
Microbial spoilage of milk and milk product
 
Sauerkraut
SauerkrautSauerkraut
Sauerkraut
 
production of baker's yeast
production of baker's yeastproduction of baker's yeast
production of baker's yeast
 
Mechanism of enzyme and function in food processing
Mechanism of enzyme and function in food processingMechanism of enzyme and function in food processing
Mechanism of enzyme and function in food processing
 
Fermented dairy foods
Fermented     dairy foodsFermented     dairy foods
Fermented dairy foods
 
Kefir & Kumis
Kefir & KumisKefir & Kumis
Kefir & Kumis
 
Fermentation of cheese (1)
Fermentation of cheese (1)Fermentation of cheese (1)
Fermentation of cheese (1)
 
Control systems in fermenter
Control systems in fermenterControl systems in fermenter
Control systems in fermenter
 
Vinegar production
Vinegar productionVinegar production
Vinegar production
 
Xanthan gum
Xanthan gumXanthan gum
Xanthan gum
 
MICROBIAL METABOLITES AS FLAVOURING AGENTS
MICROBIAL METABOLITES AS FLAVOURING AGENTSMICROBIAL METABOLITES AS FLAVOURING AGENTS
MICROBIAL METABOLITES AS FLAVOURING AGENTS
 
Organic acids production copy
Organic acids production   copyOrganic acids production   copy
Organic acids production copy
 

Similar to production and characterisation dextran by lactobacillus paracasei

ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture MediaANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
cdhfinechemical
 
Rapid MIcrobiological Methods
Rapid MIcrobiological MethodsRapid MIcrobiological Methods
Rapid MIcrobiological Methods
Alat Alat Laboratorium [dot] com
 
Feather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOTFeather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOT
Resmi Raj L
 
Pathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic BacteriaPathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic Bacteria
AyushiSharma843565
 
gene cloning
gene cloninggene cloning
gene cloning
Abhay Tiwari
 
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
Reshma Balakrishnan
 
Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.
NEHA MISHRA
 
Practical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdfPractical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdf
ssuser668f10
 
DNA & RNA Extraction Kit
DNA & RNA  Extraction KitDNA & RNA  Extraction Kit
DNA & RNA Extraction Kit
Jesús C. Morales
 
Microbiologica Samples processing
Microbiologica Samples processing Microbiologica Samples processing
Microbiologica Samples processing
tabeenaali
 
Work report_15_08_2016
Work report_15_08_2016Work report_15_08_2016
Work report_15_08_2016Sonali Uttam
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probiotic
Alexander Decker
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticAlexander Decker
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecularisabelpalaciom
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
inventionjournals
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
inventionjournals
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
inventionjournals
 
Reduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINSReduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINS
nisaiims
 
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.Annadurai B
 

Similar to production and characterisation dextran by lactobacillus paracasei (20)

ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture MediaANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
 
Rapid MIcrobiological Methods
Rapid MIcrobiological MethodsRapid MIcrobiological Methods
Rapid MIcrobiological Methods
 
Feather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOTFeather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOT
 
Pathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic BacteriaPathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic Bacteria
 
gene cloning
gene cloninggene cloning
gene cloning
 
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
 
Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.
 
Practical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdfPractical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdf
 
DNA & RNA Extraction Kit
DNA & RNA  Extraction KitDNA & RNA  Extraction Kit
DNA & RNA Extraction Kit
 
Microbiologica Samples processing
Microbiologica Samples processing Microbiologica Samples processing
Microbiologica Samples processing
 
Work report_15_08_2016
Work report_15_08_2016Work report_15_08_2016
Work report_15_08_2016
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probiotic
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probiotic
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecular
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Reduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINSReduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINS
 
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
 
WMB3
WMB3WMB3
WMB3
 

Recently uploaded

Knowledge engineering: from people to machines and back
Knowledge engineering: from people to machines and backKnowledge engineering: from people to machines and back
Knowledge engineering: from people to machines and back
Elena Simperl
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance
 
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
Product School
 
ODC, Data Fabric and Architecture User Group
ODC, Data Fabric and Architecture User GroupODC, Data Fabric and Architecture User Group
ODC, Data Fabric and Architecture User Group
CatarinaPereira64715
 
Epistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI supportEpistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI support
Alan Dix
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance
 
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptxIOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
Abida Shariff
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
Laura Byrne
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
Alison B. Lowndes
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
DianaGray10
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
DanBrown980551
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
James Anderson
 
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
Jeffrey Haguewood
 
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualitySoftware Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Inflectra
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
Guy Korland
 
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
Product School
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Tobias Schneck
 
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
UiPathCommunity
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
Elena Simperl
 

Recently uploaded (20)

Knowledge engineering: from people to machines and back
Knowledge engineering: from people to machines and backKnowledge engineering: from people to machines and back
Knowledge engineering: from people to machines and back
 
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdfFIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
FIDO Alliance Osaka Seminar: FIDO Security Aspects.pdf
 
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
From Daily Decisions to Bottom Line: Connecting Product Work to Revenue by VP...
 
ODC, Data Fabric and Architecture User Group
ODC, Data Fabric and Architecture User GroupODC, Data Fabric and Architecture User Group
ODC, Data Fabric and Architecture User Group
 
Epistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI supportEpistemic Interaction - tuning interfaces to provide information for AI support
Epistemic Interaction - tuning interfaces to provide information for AI support
 
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdfFIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
FIDO Alliance Osaka Seminar: Passkeys at Amazon.pdf
 
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptxIOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
IOS-PENTESTING-BEGINNERS-PRACTICAL-GUIDE-.pptx
 
The Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and SalesThe Art of the Pitch: WordPress Relationships and Sales
The Art of the Pitch: WordPress Relationships and Sales
 
Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........Bits & Pixels using AI for Good.........
Bits & Pixels using AI for Good.........
 
Connector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a buttonConnector Corner: Automate dynamic content and events by pushing a button
Connector Corner: Automate dynamic content and events by pushing a button
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
 
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...
 
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered QualitySoftware Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
Software Delivery At the Speed of AI: Inflectra Invests In AI-Powered Quality
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
 
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
AI for Every Business: Unlocking Your Product's Universal Potential by VP of ...
 
FIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdfFIDO Alliance Osaka Seminar: Overview.pdf
FIDO Alliance Osaka Seminar: Overview.pdf
 
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
Kubernetes & AI - Beauty and the Beast !?! @KCD Istanbul 2024
 
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
 
When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...When stars align: studies in data quality, knowledge graphs, and machine lear...
When stars align: studies in data quality, knowledge graphs, and machine lear...
 

production and characterisation dextran by lactobacillus paracasei