Molecular approaches in improvement of fruit crops

2. Presented by
SYED SHABNAM J.
Ph.D. Hort. (Fruit Sci.) II year
Technical Guidance
Dr. S.S. Yadlod
Seminar Incharge
Course No. : FSC- 691
DEPARTMENT OF HORTICUTURE,
COLLEGE OFAGRICULTURE,
VASANTRAO NAIK MARATHWADA KRISHI
VIDYAPEETH,
PARBHANI- 431 402 (M.S.)
Doctoral Seminar-I
Research Guide
Dr. G. M. Waghmare
Associate Dean and Principal,
College of Agriculture,
Badnapur

3. OUTLINE
Introduction
Marker classification
Molecular techniques
Case study
Types of molecular marker
Application
Properties of different MM

4. What is Marker?
Marker is a piece of
DNA molecule that is
associated with a
certain trait of a
organism

5. A sequence of DNA or protein
that can be screened to reveal
key attributes of its state or
composition and thus used to
reveal genetic variation.
Definition of molecular marker
 A molecular markers a DNA sequence that is readily
detected and whose inheritance can be easily be
monitored. The uses of molecular markers are based on
the naturally occurring DNA polymorphism, which forms
basis for designing strategies to exploit for applied
purposes.

6. Why Molecular Marker ?
• Because they are selectively
neutral as they are present in the
non coding region of the genome.
• Makers are co-segregating with
the trait of interest.
• They follow exactly the
Mendelian pattern of inheritance.
•Free from epistatic interaction or
pleiotropic effect.

7. NEED OF MOLECULAR MARKERS FOR FRUIT CROP
IMPROVEMENT
• Assessment of genetic diversity:
• DNA markers to assess genetic diversity among species of several horticultural
crops, as well as validation of genetic relatedness among them. Using RAPD
markers the wide variability was observed in the mandarin germplasm present in
N.E. Himalayas. In China using SSR markers, genetic diversity in mandarin
landraces and wild races of mandarins, sweet orange, mandarins, grapefruit,
lemon and citranges was resolved. DNA markers have also been utilized to find
out the phylogenetic relationships in 30 accessions of citrus fruits.
• Identification of QTLs :
• The genetic loci for such characters have been referred to as quantitative trait loci
(QTLs). The essential feature which makes feasible the finding and
characterization of a QTL is its linkage with a known marker locus segregating
with Mendelian ratios. DNA markers provide this opportunity by making it
feasible to identify, map and measure the effects of genes underlying quantitative
trait. In grape QTLs were used for features such as like critical photoperiod,
growth cessation, or dormancy, bud break (BB) and winter hardiness.

8. • Varietal identification:
• Varietal identification is done with DNA fingerprinting. Singly or in groups, molecular
markers are capable of producing patterns that are unique for each individual genotype.
• Disease diagnostics:
• Molecular markers have made it possible to develop diagnostic techniques to identify
pathogen with an unprecedented accuracy and speed and to tap genes from as diverse sources
as microbes, plants and animals to enable the researchers to develop plants resistant to
diseases. eg. Apple Fire blight resistance SCAR, SSR, Citrus leprosis virus resistance AFLP
and RAPD, Pear Incompatibility AFLP and SSR.
• Marker assisted selection (MAS):
• MAS permit the breeder to make earlier decisions about the further selections while
examining fewer plants. An added advantage in breeding for disease resistance behaviour is
that this could be done in the absence of pathogen once marker information is available.
Pedigree analysis and detection of hybrids: isozyme been used for differentiating between
progeny produced by self-pollination and those produced via cross pollination and detection
of hybrids. They are used to confirm the production of interspecific Prunus hybrids, grape
interspecific crosses and progeny screening for hybrid seedlings in citrus breeding
programme, besides identification of zygotic and nucellar seedlings in citrus.

9. A Perfect Molecular Marker
• Closely linked to the trait of interest
• Polymorphic
• Easy to use
• Cost effective
• Co-dominant
• High throughput
• Robust
• Reproducible

10. Good molecular marker
(1) Provide adequate resolution of genetic differences
(2) Polymorphic and evenly distributed throughout the genome
(3) Generate multiple, independent and reliable markers
(4) Simple, quick and inexpensive
(5) Need small amounts of tissue and DNA samples
(6) Have linkage to distinct phenotypes, no epistasis
(7) Require no prior information about the genome of an organism
(8) Frequent occurrence in genome
(9) Selective neutral behaviour (the DNA sequences of any organism are neutral to
environment conditions or management practices)
(10)Easy access

11. • Major molecular techniques are commonly applied
to reveal genetic variation, these are:
 Polymerase chain reaction (PCR)
 Electrophoresis
 Hybridization
 DNA sequencing
POLYMERASE CHAIN REACTION
PCR is a procedure used to amplify (make multiple
copies of) a specific sequence of DNA
The method was invented by Kary Mullis in 1983, for
which he received the Nobel Prize in Chemistry ten
years later

12. HYBRIDIZATION
One of the most commonly used nucleic acid hybridization techniques is
Southern blot hybridization
Southern blotting was named after Edward M. Southern who developed this procedure
at Edinburgh University in the 1975

13. ELECTROPHORESIS
Migration rate
depend on electrical
charge and size
The term 'electrophoresis' literally means "to carry
with electricity"
Technique for separating the components of a mixture
of charged molecules (proteins, DNAs, or RNAs) in an
electric field within a gel or other support

14. SEQUENCING
The process of determining the order of the nucleotide
bases along a DNA strand is called sequencing
In 1977, 24 years after the discovery of the structure of
DNA, two separate methods for sequencing DNA were
developed: chain termination method and chemical
degradation method.
the purines(A+G) are depurinated
using formic acid, the guanines
(and to some extent the adenines)
are methylated by dimethyl sulfate,
and the pyrimidines (C+T) are
hydrolysed using hydrazine. The
addition of salt (sodium chloride)
to the hydrazine reaction inhibits
the reaction of thymine for the C-
only reaction.

15. Recent detection techniques
TaqMan – a probe used to detect specific sequences in
PCR products by employing 5’ to 3’ exonuclease activity
of the Taq DNA polymerase
Pyrosequencing – refers to
sequencing by synthesis, a
simple to use technique for
accurate analysis of DNA
sequences
Microarray Technology – a high
throughput screening technique
based on the hybridization
between oligonucleotide probes
(genomic DNA or cDNA) and
either DNA or mRNA

16. MOLECULAR
MARKERS
Morphological
Molecular
marker
Biochemical
Molecular
marker
DNA based
molecular
markers
TYPES OF MOLECULAR MARKERS

17. Tab. 1. Comparison between morphological, isozyme and DNA
markers
Sr.
No.
Feature Morphological
markers
Biochemical
molecular markers
DNA based markers
1 Feature of the
organism scored
Phenotype Protein DNA base sequence
2 Biological meaning of
the markers
Consequences of
gene action
Genes that are
expressed
DNA sequences, may or
may not represent genes
3 Plant material
required for
detection
Intact plant or
plant organ
Little amount of
tissue
Little to medium amount
of tissue and no matter
what tissue is used
4 Efforts required for
detection
Simple Moderate Moderate to difficult
5 Ease of use Very easy Moderately difficult Moderately difficult to
difficult
6 Reproducibility High High Moderate to high
7 Dominance/
Codominance
Generally
dominant
Codominant Dominant (RAPD, AFLP)
Codominant (RFLP, SSR)
BHAT et al., (2010)

18. Level of analysis of markers
•Phenotype
1. Morphological
Markers
•Gene Product
2. Biochemical
Markers
•DNA Sequence
3. DNA markers /
genetic markers
Class of Marker • Level of Analysis

19. 1. Morphological Markers
• Are botanical descriptors of plant which are
visually or phenotypically characterized
• K/as DUS descriptors or universal markers
1. D- Distinctiveness
2. U- Uniformity
3. S- Stability
• Seed colour, seed shape, seed size, flower
colour, growth habits, plant pigmentation

20. 2. DNA based Markers
• On the basis of ability to discriminate
between same or different species
• 1. Co-dominant: discriminate
between homo and heterozygotes
• 2. Dominant: which do not
discriminate between homo and
heterozygotes
• They can be visualized by:
a. Gel electrophoresis
b. Ethidium bromide or silver staining
c. Radioactive or colorimetric probes

21. Application
of DNA
Markers
Genotyping
Genome Mapping
Phylogenetic Analysis
QTL Analysis
Association Mapping
Genome-wide selection
Bulk segregation selection
Marker Assisted Backcrossing
Trait Staking
Patenting
Plant Variety Protection
Essentially Derived Varieties
Genetic Purity analysis
Trait Purity analysis
Genetic
Studies
Breeding
Tools
Legal
Applications
Production
QA/QC

22. 1. Assessment of genetic diversity
Genetic diversity is the first hand information.
DNA markers are excellent tool for accessing genetic
diversity.
Direct utility in breeding programme.
Genetic diversity using molecular markers has been
studied by using DNA markers
2. DNA fingerprinting for varietal
identification
Method used to identify an individual from a sample of DNA
Breeders rights : DUS + molecular profiles
Molecular profiles: biotechnologically developed varieties
Characterization & protection of germplasm (esp. CMS lines)
Genetic purity of F1 hybrids

23. 3. Gene tagging
It refers to mapping of genes of economic importance close to known markers
Molecular marker very closely linked to gene act as a tag
Several genes of economic importance traits like resistance to diseases, insect, stress
tolerance, fertility restoration etc.
A pre-requisite for marker assisted selection (MAS) and map based gene cloning
Linkage maps indicate the position and relative genetic distances between
markers along chromosome. -----------QTL Mapping
4. Sex identification
In plant kingdom dioecy (4% of angiosperm)
Development of male/ female specific markers
Early identification of male & female plants
Efficiency in improving of dioecious fruits like (Papaya, Date palm
etc.)

24. 5. Genetic mapping
QTL: A region of genome that is associated with an effect on a
quantitative trait.
Software's for QTL analysis: Mapmaker, PlabQTL& MapQTL
The three main steps of linkage map construction are:
(1) production of a mapping population
(2) identification of polymorphism and
(3) linkage analysis of markers.

25. Objective of QTL mapping
 To identify the region of the genome that affect the trait of
interest
 To analyze the effect of the QTL on the trait
 How much of the variation for the trait is caused by specific
region
 What is the gene action associated with the QTL
 Which allele is associated with the favorable gene
Type and size of mapping population
 Parental line that are highly contrasting phenotypically
for the target trait.
 Parent should be genetically diverse, so that we can get
large number of polymorphism.

26. Basic procedure in QTL mapping
Confirmation and validation of detected QTL
Detection of QTL
Construction of genetic maps using molecular marker data
Genotyping and phenotyping of the mapping population
Development of mapping population

27. Steps
Selecting mapping population
Traits of interest
Genetic marker assay and trait evolution
Making interference about QTL based on association
analysis between the genetic marker and the QTL trait
•QTL mapping is a combination of qualitative linkage analysis and quantitative genetic analysis.
•Relationship between quantitative trait variation and qualitative traits can be quantified using
statistical models.

28. QTL analysis methods
QTL
analysis
methods
Interval
mapping
Composite
Interval
Mapping
Multiple
Interval
Mapping
Single
locus
mapping
QTL analysis problem
Does not follow standard probability distribution.
The tests are not independent among marker loci because of the linkage relationship and
possible gene interaction.
Traditional adjustment on the test statistics can not be applied to qtl mapping.

29. • Advantages of single locus analysis
– Simple in terms of data analysis
– Simple in terms of implementation
– Gene order and complete linkage map are not required
• Disadvantages single locus analysis
• The putative QTL genotypic means and QTL positions
are confounded. This causes bias and statistical power to
be low, particularly when linkage map density is low.
• QTL position can not be precisely determined, due to
non - independence among the hypothesis tests for
linked markers that confound QTL effects and position.
Single locus mapping analysis
Methods Of QTL Mapping

30. Interval mapping
Lander & Botstein (1986 & 1989)
• It is based on joint frequency if pair of adjacent markers and a putative QTL
flanked by two markers.
• The method evaluates the target association between the trait values and the
genotype of the hypothetical QTL at multiple analysis point between pair of
adjacent marker loci.
• Presence of putative QTL estimated if the LOD score exceeds a critical threshold.
Composite interval mapping (CIM)
 CIM is combination of SIM and multiple linear regression
on marker associated with the QTL.
 Using regression
 It covers marker interval plus few other well chosen single
marker in each analysis.

31. Multiple interval mapping (MIM)
 It is the extension of interval mapping to multiple QTLs ,
just as multiple regression extends analysis of variance.
Advantages of MIM
 Makes proper allowance for missing genotypic data and
allow interaction between QTLs.

32. Software packages for QTL mapping
• SAS: is a general statistical analysis software. It can detect QTL by identifying associations
between marker genotype and quantitative trait phenotype by single marker analysis
approach such as ANOVA, t-test, GLM or REG.
• Qgene is a QTL mapping and marker-aided breeding package written for Macintosh. It has a
user-friendly graphical interface and produces graphical outputs. QTL mapping is conducted
by either single-marker regression or interval regression.
• QTL Cartographer is QTL software written for either UNIX, Macintosh, or Windows. It
performs single-marker regression, interval mapping, and composite interval mapping. It
permits analysis from F2 or backcross populations. It displays map positions of QTL using
the GNUPLOT software.
• PLABQTL is a freely distributed IBM computer program for composite interval mapping
and simple interval mapping of QTL. Its main purpose is to localize and characterize QTL in
mapping populations derived from a biparental cross by selfing or production of double
haploids. Currently, this program is the easiest software for composite interval mapping.
• MQTL is an IBM computer program for composite interval mapping in multiple
environments. It can also perform simple interval mapping. Currently, MQTL is restricted to
the analysis of data from homozygous progeny (double haploids, or recombinant inbred
lines). Progeny types with more than two marker classes (e.g., F2) are not handled.
• MapMaker/QTL is the original QTL mapping software for IBM computer. It is user-
friendly, freely distributed, and runs on almost all platforms. It will analyze F2 or backcross
data using standard interval mapping.
• MapmakerUnix, MapmakerMac, Gmendel, JointMap, Linkage, PGRI, QTLSTAT,
MAPQTL, Map Manager QT, QGENE

33. Limitations of QTL mapping
• QTL are hypothetical genes based on statistical
interference. Genetic effects used in QTL mapping could
have little biological meaning.
• The genetic models which QTL mapping is based on are
not accurate.
• The amount of genetic information contained is not
adequate.
• The statistical methodology is not powerful enough. The
current statistical tools are not adequate for dealing with
high levels of epistatic interaction.

34. 6. Molecular Breeding
6.
Molecular
Breeding
6.1 Marker assisted
selection (MAS)
6.2 Marker Assisted
Backcrossing (MABC)
6.3 Gene pyramiding
6.4 Combined approaches

35. Benefits of marker technology in MAS
• Speed
• Consistency
• Efficient
• Effective
Genesis of MAS
Tomato is the first crop in which QTL
mapping and MAS has been
demonstrated
• In 1981: MAS for metric traits using
isozyme markers
• In 1993: first time map-based cloning
• fw2.2 (fruit size)
• ovate (fruit shape)
•Se2.1 (stigma exsertion) Steven Tanksley
Advantages of MAS
It can be performed on seedling material
It is not affected by environmental conditions.
Determination of recessive alleles.
Gene pyramiding.
Selecting traits with low heritability.
Testing specific traits (quarantine).
It is cheaper and faster.

36. Gene Pyramiding
Assembling multiple desirable genes from
multiple parents into a single genotype
• Genotype with all target gene
• Objective
1. Enhance trait performance
2. Increase durability
3. Broadening genetic base
The success of gene pyramiding are the
inheritance model of the genes for the
target traits, linkage and pleiotropism
between the target trait and other traits
Problem
• Linkage drag
• Target gene tightly linked to gene with
large negative effects on other traits
• Patent DNA sequences
• Erythropoietin- stimulates RBC
• Patent Gene
• Constraints:
• Restrict competition
• Leads to higher prices
• Curtails new inventions
Other opportunity in
Biomarkers (PPV&FR)

37. 3 Biochemical Markers
• Are of two types:
1.Protein based
2.Enzyme based known as Isozyme
• First true biochemical marker was an allelic variant of
enzyme pyruvate dehydrogenase
• Isoforms can be resolved by gel electrophoresis based on
their size, shape and amino acid differences
• Can be easily assayed and detected
• They are low in polymorphism as compared to DNA
markers

38. TYPES OF BIOCHEMICAL MARKERS
• Due to rapid developments in the field of molecular
genetics, a variety of molecular markers has emerged
during the last few decades
Biochemical
marker
Allozyme
Non-PCR
based marker
RFLP, Minisatellite (VNTR)
PCR based
marker
Microsatellite, RAPD, AFLP, CAPS,
ISSR, SSCP, SCAR, SNP, etc.
Traditional
marker
systems
PCR
generation: in
vitro DNA
amplification

39. Allozyme or Isozymes(biochemical
marker)
• The alternative forms of a particular protein visualized
on a gel as bands of different mobility. Polymorphism
due to mutation in amino acid sequence. The net electric
charge of the protein may also altered.
• Electrophoretic variants of proteins produced by
different alleles at protein-coding genes.
Used for various research purposes in biology, viz. to
delineate phylogenetic relationships, to estimate genetic
variability and taxonomy, to study population genetics and
developmental biology, to characterization in plant genetic
resources management and plant breeding (Bretting &
Widrlechner 1995, Staub & Serquen 1996).

40. Advantages:
 Inexpensive;
 Markers are co-dominant.
 Simplicity because allozyme analysis does not require DNA extraction or
the availability of sequence information, primers or probes, they are quick
and easy to use.
 Zymograms (the banding pattern of isozymes) can be readily interpreted in
terms of loci and alleles, or they may require segregation analysis of
progeny of known parental crosses for interpretation.
Disadvantages:
 Only reveals small proportion of DNA variation.
 Many DNA variants do not result in changes in amino acid sequence.
 Some changes in amino acid sequence do not result in changes in mobility
on the gel.
 Relatively low abundance and low level of polymorphism.
 Affected by environmental conditions.

41. Applications
 Allozymes have been applied in many population genetics studies,
including measurements of out crossing rates (Erskine & Muehlenbauer
1991), population structure and population divergence(Freville et al. 2001).
 Useful to study diversity in crops and their relatives (Hamrick & Godt
1997).
 They have been used, often in concert with other markers, for fingerprinting
purposes (Tao & Sugiura 1987, Maass & Ocampo 1995), and diversity
studies (Lamboy et al. 1994, Ronning & Schnell 1994, Manjunatha et al.
2003), to study interspecific relationships (Garvin & Weeden 1994), the
mode of genetic inheritance (Warnke et al. 1998), and allelic frequencies in
germplasm collections over serial increase cycles in germplasm banks
(Reedy et al. 1995), and to identify parents in hybrids (Parani et al. 1997).

42. • Targets variation in DNA restriction sites and in DNA restriction fragments.
Sequence variation affecting the occurrence (absence or presence) of endonuclease
recognition sites is considered to be main cause of length polymorphisms.
• The technique centers around the digestion of genomic DNA digested with
restriction enzymes.
• These enzymes are isolated from bacteria and consistently cut DNA at specific
base pair sequences which are called recognition sites.
• These recognition sites are not associated with any type of gene and are
distributed randomly throughout the genome.
• When genomic DNA is digested with one of these restriction enzymes, a series of
fragment are produced of varying length.
• These fragments are separated using agarose or polyacrylamide gel
electrophoresis (PAGE) and yield a characteristic pattern.
• Variations in the characteristic pattern of a RFLP digest can be caused by
base pair deletions,
mutations,
translocations and transpositions
which result in the loss or gain of a recognition site resulting in a fragment of
different length and polymorphism.
Restriction fragment length polymorphism (RFLP)
(Non-PCR based marker)

43. • Genomic DNA digested with Restriction Enzymes
• • DNA fragments separated via electrophoresis and transfer to nylon
membrane
• • Membranes exposed to probes labelled with P32 via southern hybridization
• • Film exposed to X-Ray

44. Advantages:
Moderately polymorphic
High genomic abundance and random distribution
 Co-dominant
 High reproducibility.
 Reliable markers in linkage analysis and breeding.
Disadvantages:
large quantities (1–10 μg) of purified, high molecular weight DNA are required
for each DNA digestion and Southern blotting.
Larger quantities are needed for species with larger genomes and for the greater
number of times needed to probe each blot.
The requirement of radioactive isotope makes the analysis relatively expensive
and hazardous.
 The assay is time-consuming and labour-intensive and only one out of several
markers may be polymorphic, which is highly inconvenient especially for crosses
between closely related species.
Their inability to detect single base changes restricts their use in detecting point
mutations occurring within the regions at which they are detecting polymorphism.

45. Applications:
RFLPs can be applied in diversity and phylogenetic studies ranging from
individuals within populations or species, to closely related species.
RFLPs have been widely used in gene mapping studies because of their high
genomic abundance due to the ample availability of different restriction enzymes
and random distribution throughout the genome (Neale & Williams 1991).
 They also have been used to investigate relationships of closely related taxa
(Miller & Tanksley et al. 1990; Lanner et al. 1997), as fingerprinting tools (Fang et
al. 1997), for diversity studies (Debreuil et al. 1996), and for studies of
hybridization, including studies of gene flow between crops and weeds (Brubaker &
Wendel 1994, Clausen & Spooner 1998, Desplanque et al. 1999).
Tab. 2. Successful examples of RFLP techniques in fruit crops
S. No. Plant Species Work Done References
1. Peach Genetic linkage mapping Rajapakse et al. (1995)
2. Sour Cherry QTL analysis of flower and
fruit traits
Wang et al. (2000)
BHAT et al., (2010)

46. RAPD (PCR-based marker)
Uses primers of random sequence to amplify DNA fragments by PCR.
Polymorphisms are considered to be primarily due to variation in the
primer annealing sites, but they can also be generated by length
differences in the amplified sequence between primer annealing sites
 RAPD was the first PCR based molecular marker technique developed and it is
by far the simplest.
 Short PCR primers (approximately 10 bases) are randomly and arbitrarily
selected to amplify random DNA segments throughout the genome.
 The resulting amplification product is generated at the region flanking a part of
the 10 bp priming sites in the appropriate orientation.
 RAPD often shows a dominant relationship due to primer being unable to bind
on recessive alleles.
 RAPD products are usually visualized on agarose gels stained with ethidium
bromide.

47. DNA synthesis (72 °C for 1.5 min)
Primer annealed to template DNA strands
Annealing of primer (36 °C for 2 min))
DNA strands separated
Keep the tubes in PCR thermo cycler
Isolation of DNA
Denature the DNA (94 °C for 1 min)
Decaoligonucleotide enzyme, primer, Taq DNA polymerase
Protocol for RAPD

48. Advantages:
Quick and easy to assay.
Low quantities of template DNA are
required.
Since random primers are
commercially available, no sequence
data for primer construction are
needed.
RAPDs have a very high genomic
abundance and are randomly
distributed throughout the genome.
Dominant markers
Disadvantages:
 low reproducibility
highly standardized experimental
procedures are needed because of their
sensitivity to the reaction conditions.
require purified, high molecular weight
DNA, and precautions are needed to avoid
contamination of DNA samples because
short random primers are used that are able
to amplify DNA fragments in a variety of
organisms.
the inherent problems of reproducibility
make RAPDs unsuitable markers for
transference or comparison of results
among research teams working in a similar
species and subject.
RAPD markers are not locus-specific,
band profiles cannot be interpreted in terms
of loci and alleles (dominance of markers).

49. Applications:
The application of RAPDs and their related modified markers in variability analysis and
individual-specific genotyping has largely been carried out, but is less popular due to problems
such as poor reproducibility, faint or fuzzy products, and difficulty in scoring bands, which
lead to inappropriate inferences.
RAPDs have been used for many purposes, ranging from studies at the individual level (e.g.
genetic identity) to studies involving closely related species.
RAPDs have also been applied in gene mapping studies to fill gaps not covered by other
markers (Williams et al. 1990, Hadrys et al. 1992).
Variants of the RAPD technique include Arbitrarily Primed Polymerase Chain Reaction
(AP-PCR), which uses longer arbitrary primers than RAPDs, and DNA Amplification
Fingerprinting (DAF) that uses shorter, primers to generate a larger number of fragments.
Multiple Arbitrary Amplicon Profiling (MAAP) is the collective term for techniques using
single arbitrary primers.
Tab. 3. Successful examples of RAPD techniques in fruit crops
S. No. Plant Species Work Done References
1. Peach Identification of peach cultivars Lu Zx et al. (1996)
2. Peach Comparison of genetic diversity Warburton et al.(1996)
3. Almond Genetic relatedness among
cultivars and breeding lines
Bartolozzi et al.
(1998)

50. AFLP (PCR-based marker)
(AFLP), which is essentially intermediate between RFLPs and PCR.
 AFLP is based on a selectively amplifying a subset of restriction
fragments from a complex mixture of DNA fragments obtained after
digestion of genomic DNA with restriction endonucleases.
 Polymorphisms are detected from differences in the length of the
amplified fragments by polyacrylamide gel electrophoresis (PAGE)
(Matthes et al. 1998) or by capillary electrophoresis.
.
Advantages:
 High genomic abundance, considerable reproducibility, the generation of many
informative bands per reaction, their wide range of applications, and the fact that no
sequence data for primer construction are required.
AFLPs can be analyzed on automatic sequencers, but software problems
concerning the scoring of AFLPs are encountered on some systems. The use of AFLP
in genetic marker technologies has become the main tool due to its capability to
disclose a high number of polymorphic markers by single reaction (Vos et al. 1995).

51. Applications:
AFLPs can be applied in studies involving genetic identity, parentage and
identification of clones and cultivars, and phylogenetic studies of closely related
species because of the highly informative fingerprinting profiles generally
obtained.
 Their high genomic abundance and generally random distribution throughout
the genome make AFLPs a widely valued technology for gene mapping studies
(Vos et al. 1995).
This technique is useful for breeders to accelerate plant improvement for a
variety of criteria, by using molecular genetics maps to undertake marker-assisted
selection and positional cloning for special characters.
AFLP markers are useful in genetic studies, such as biodiversity evaluation,
analysis of germplasm collections, genotyping of individuals and genetic distance
analyses.
Disadvantages:
Need purified and high molecular weight DNA.
Dominant markers.

52. The term minisatellites was introduced by Jeffrey et al. (1985).
These loci contain tandem repeats that vary in the number of repeat units between
genotypes and are referred to as variable number of tandem repeats (VNTRs) (i.e. a
single locus that contains variable number of tandem repeats between individuals) or
hypervariable regions (HVRs) (i.e. numerous loci containing tandem repeats within
a genome generating high levels of polymorphism between individuals).
 They consist of chromosomal regions containing tandem repeat units of a 10–50
base motif, flanked by conserved DNA restriction sites.
A minisatellite profile consisting of many bands, usually within a 4– 20 kb size
range, is generated by using common multilocus probes that are able to hybridize to
minisatellite sequences in different species.
Variation in the number of repeat units, due to unequal crossing over or gene
conversion, is considered to be the main cause of length polymorphisms
Minisatellites, Variable Number of Tandem Repeats (VNTR)
Advantages:
High level of polymorphism
High reproducibility.

53. Disadvantages:
large quantities (1–10 μg) of purified, high molecular weight DNA are required for
each DNA digestion and Southern blotting.
Larger quantities are needed for species with larger genomes and for the greater
number of times needed to probe each blot.
The requirement of radioactive isotope makes the analysis relatively expensive and
hazardous.
 The assay is time-consuming and labour-intensive and only one out of several
markers may be polymorphic, which is highly inconvenient especially for crosses
between closely related species.
Their inability to detect single base changes restricts their use in detecting point
mutations occurring within the regions at which they are detecting polymorphism.
Minisatellites are of reduced value for taxonomic studies because of hypervariability.
Applications:
The term DNA fingerprinting was introduced for minisatellites, though DNA
fingerprinting is now used in a more general way to refer to a DNA-based assay to
uniquely identify individuals.
 Minisatellites are particularly useful in studies involving genetic identity, parentage,
and identification of varieties and cultivars (Jeffreys et al. 1985a&b, Zhou et al. 1997),
and for population-level studies (Wolff et al.1994).

54. The term microsatellites was coined by Litt & Lutty (1989) and it also known as
Simple Sequence Repeats (SSRs), are sections of DNA, consisting of tandemly
repeating mono-, di-, tri-, tetra- or penta-nucleotide units that are arranged
throughout the genomes of most eukaryotic species.
 Microsatellite polymorphism can be detected by Southern hybridization or PCR.
Microsatellites, like minisatellites, represent tandem repeats, but their repeat
motifs are shorter (1–6 base pairs). If nucleotide sequences in the flanking regions
of the microsatellite are known, specific primers (generally 20–25 bp) can be
designed to amplify the microsatellite by PCR.
Microsatellites or Simple sequence Repeat (SSR)
Site of the
genome
having a
specific
SSR
Sequence is
considered
as a locus
for the
concerned
SSR
sequence
Sequence Primer
ACTGTCGACACACACACACACGCTAGCT (AC)7
TGACAGCTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACGCTAGCT (AC)8
TGACAGCTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACGCTAGCT (AC)10
TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12
TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA
AC
GA
AT

55. Advantages:
codominance of alleles, their high
genomic abundance in eukaryotes and
their random distribution throughout the
genome.
Due to the use of long PCR primers,
the reproducibility of microsatellites is
high and analysis do not require high
quality DNA.
The screening of microsatellite
variation can be automated by using
automatic sequencers like EST-SSR
markers are one class of marker that can
contribute to ‘direct allele selection’.
Disadvantages:
One of the main drawbacks of microsatellites
is that high development costs are involved if
adequate primer sequences for the species of
interest are unavailable, making them difficult to
apply to unstudied groups.
Although microsatellites are in principle co-
dominant markers, mutations in the primer
annealing sites may result in the occurrence of
null alleles (no amplification of the intended
PCR product), which may lead to errors in
genotype scoring.
A very common observation in microsatellite
analysis is the appearance of stutter bands that
are artifacts in the technique that occur by DNA
slippage during PCR amplification. These can
complicate the interpretation of the band profiles
because size determination of the fragments is
more difficult and heterozygotes may be
confused with homozygotes

56. .
Application
•In general, microsatellites show a high level of polymorphism. As a
consequence, they are very informative markers that can be used for
many population genetics studies, ranging from the individual level to
that of closely related species.
•Microsatellites are also considered ideal markers in gene mapping
studies (Hearne et al. 1992, Morgante & Olivieri 1993, Jarne & Lagoda
1996).
•Molecular markers have proven useful for assessment of genetic
variation in germplasm collections (Mohammadi & Prasanna 2003).
• Expansion and contraction of SSR repeats in genes of known function
can be tested for association with phenotypic variation or, more
desirably, biological function (Ayers et al.1997).
•Several studies have found that SSRs are useful for estimating genetic
relationship and at the same time provide opportunities to examine
functional diversity in relation to adaptive variation (Eujayl et al.2001,
Russell et al. 2004).

57. Other markers
• Inter Simple Sequence Repeat (ISSR)
• Cleaved Amplified Polymorphic Sequence (CAPS/PCR-RFLP)
• Single-strand conformation Polymorphism (SSCP)
• Sequence Characterized Amplified Region (SCAR)

58. ISSRs are DNA fragments of about 100–3000 bp located between
adjacent, oppositely oriented microsatellite regions.
This technique, reported by Zietkiewicz et al. (1994) and primers based
on microsatellites are utilized to amplify inter-SSR DNA sequences.
ISSRs are amplified by PCR using microsatellite core sequences as
primers.
About 10–60 fragments from multiple loci are generated simultaneously,
separated by gel electrophoresis and scored as the presence or absence of
fragments of particular size.
Techniques related to ISSR analysis are Single Primer Amplification
Reaction (SPAR) that uses a single primer containing only the core motif of
a microsatellite, and Directed Amplification of Minisatellite region DNA
(DAMD) that uses a single primer containing only the core motif of a
minisatellite.
Inter Simple Sequence Repeats (ISSR)

59. Advantages:
The main advantage of ISSRs is that no sequence data for primer construction
are needed.
Because the analytical procedures include PCR, only low quantities of
template DNA are required.
ISSRs are randomly distributed throughout the genome. This is mostly
dominant marker, though occasionally its exhibits as co-dominance.
Disadvantages: disadvantages include the possible non-homology of similar
sized fragments. Moreover, ISSRs, like RAPDs, can have reproducibility
problems.
Applications: ISSR analysis can be applied in studies involving genetic
identity, parentage, clone and strain identification, and taxonomic studies of
closely related species.
ISSRs are considered useful in gene mapping studies (Godwin et al. 1997,
Zietkiewicz et al. 1994, Gupta et al. 1994).

60. SSCP provides a method to detect nucleotide variation among DNA samples
without having to perform sequence reactions.
In SSCP the amplified DNA is first denatured, and then subject to non-
denaturing gel electrophoresis.
Related techniques to SSCP are Denaturing Gradient Gel Electrophoresis
(DGGE) that uses double stranded DNA which is converted to single stranded
DNA in an increasingly denaturing physical environment during gel
electrophoresis, and Thermal Gradient Gel Electrophoresis (TGGE) which uses
temperature gradients to denature double stranded DNA during electrophoresis.
Advantages:
codominance of alleles and the low quantities of template DNA required due to
the fact that the technique is PCR-based.
Single-Strand Conformation Polymorphism
(SSCP)

61. Disadvantages:
Drawbacks include the need for sequence data to design PCR
primers and the necessity of highly standardized electrophoretic
conditions in order to obtain reproducible results. Furthermore,
some mutations may remain undetected, and hence absence of
mutation cannot be proven.
Applications:
SSCPs have been used to detect mutations in genes using gene
sequence information for primer construction (Hayashi 1992).

62. CAPS are DNA fragments amplified by PCR using specific 20–25 bp primers,
followed by digestion of the PCR products with a restriction enzyme.
Subsequently, length polymorphisms resulting from variation in the occurrence
of restriction sites are identified by gel electrophoresis of the digested products.
CAPS have also been referred to as PCR-Restriction Fragment Length
Polymorphism (PCR-RFLP).
Advantages: Requiring only low quantities of template DNA, the co-
dominance of alleles and the high reproducibility. Compared to RFLPs, CAPS
analysis does not include the laborious and technically demanding steps of
Southern blot hybridization and radioactive detection procedures. These
markers are co-dominant in nature.
Disadvantages: In comparison with RFLP analysis, CAPS polymorphisms are
more difficult to find because of the limited size of the amplified fragments
(300–1800 bp). Sequence data needed for synthesis of the primers.
Applications: CAPS markers have been applied predominantly in gene
mapping studies (Akopyanz et al. 1992, Konieczny & Ausubel 1993).
Cleaved Amplified Polymorphic Sequence (CAPS)

63. •SCARs are DNA fragments amplified by the PCR using specific 15–30 bp
primers, designed from nucleotide sequences established from cloned RAPD
fragments linked to a trait of interest.
•By using longer PCR primers, SCARs do not face the problem of low
reproducibility generally encountered with RAPDs.
•Obtaining a co-dominant marker may be an additional advantage of converting
RAPDs into SCARs, although SCARs may exhibit dominance when one or both
primers partially overlap the site of sequence variation.
• Length polymorphisms are detected by gel electrophoresis.
Advantages: Quick and easy to use, high reproducibility and are locus-specific.
Due to the use of PCR, only low quantities of template DNA are required.
Disadvantages: Disadvantages include the need for sequence data to design the
PCR primers.
Applications: SCARs are locus specific and have been applied in gene mapping
studies and marker assisted selection (Paran & Michelmore 1993).
Sequence Characterized Amplified Region
(SCAR)

64. More recent markers
• Single-Nucleotide Polymorphism (SNP)
• Retrotransposon-based markers
Sequence-Specific Amplified Polymorphism (S-SAP)
Inter-retrotransposon Amplified Polymorphism (IRAP)
Retrotransposon-Microsatellite Amplified Polymorphism
(REMAP)
Retrotransposon-Based Insertional Polymorphism (RBIP)

65. In many organisms most polymorphisms results from changes in a single
nucleotide position (point mutations), has led to the development of
techniques to study single nucleotide polymorphisms (SNPs).
SNPs and flanking sequences can be found by library construction and
sequencing or through the screening of readily available sequence databases.
Once the location of SNPs is identified and appropriate primers designed, one
of the advantages they offer is the possibility of high throughput automation.
Application SNP analysis may be useful for cultivar discrimination in crops
where it is difficult to find polymorphisms, such as in the cultivated tomato.
SNPs may also be used to saturate linkage maps in order to locate relevant
traits in the genome.
Single Nucleotide Polymorphism (SNP)

66. Retrotransposons consist of long terminal repeats (LTR) with a highly
conserved terminus, which is exploited for primer design in the development of
retrotransposon-based markers.
Retrotransposons have been found to comprise the most common class of
transposable elements in eukaryotes, and to occur in high copy number in plant
genomes. Several of these elements have been sequenced and were found to
display a high degree of heterogeneity and insertional polymorphism, both
within and between species. Because retrotransposon insertions are irreversible
(Minghetti & Dugaiczyk 1993, Shimamura et al. 1997), they are considered
particularly useful in phylogenetic studies. In addition, their widespread
occurrence throughout the genome can be exploited in gene mapping studies,
and they are frequently observed in regions adjacent to known plant genes.
Retrotransposon-based markers

67. Sequence- Specific Amplified Polymorphism (S-SAP) is a dominant,
multiplex marker system for the detection of variation in DNA flanking
the retrotransposon insertion site.
Interretrotransposon Amplified Polymorphism (IRAP) and
Retrotransposon- Microsatellite Amplified Polymorphism (REMAP)
are dominant, multiplex marker systems that examine variation in
retrotransposon insertion sites.
Retrotransposon- Based Insertional Polymorphism (RBIP) is a
codominant marker system that uses PCR primers designed from the
retrotransposon and its flanking DNA to examine insertional
polymorphisms for individual retrotransposons.
Variations of Retrotransposon-based markers

68. Features RFLP PCR-
RFLP/
CAPS
DFP RAPD Microsatellite SNP
Detection method Hybridization PCR Hybridization PCR PCR PCR
Type of
probe/primer used
DNA/ cDNA
sequence of
structural genes
Sequence
specific
primers
Mini satellite
synthetic
oligos
Arbitrarily
design
primer
Sequence
specific primers
Sequence
specific
primers
Requirement of
radioactivity
Yes No/Yes Yes No/Yes No/Yes No/Yes
Extant of genomic
coverage
Limited Limited Extensive Extensive Extensive Extensive
Degree of
polymorphisms
Low Low High Medium to
High
High High
Phenotype
expression
Co dominant Co
dominant
Co dominant Dominant Dominant Co
dominant
Possibility of
automation
No Yes No Yes Yes Yes

69. Tab. 4. Supporting institutes on DNA projects
Institute Crop Work
IIHR Mango,
Citrus,
Pomegranate
i) Identification of Mango varieties and genetic relatedness
through RAPDS
ii) Identification of markers linked to bacterial canker resistance
in Lemon
iii) Development of markers to test clonal fidelity of
pomegranate plants raised through tissue culture.
CPCRI-
Kasargod
Coconut i) Standardization of protocol for DNA extraction
ii) DNA fingerprinting of all major coconut accessions, hybrids
and high yielding palms using RFLP,RAPD markers
iii) Development of molecular markers linked with important
traits especially root wilt disease resistance/tolerance and
drought tolerance.
NRC-
Trichy
Banana i) Typing of Musa genotypes using isozymes, RAPD and RFLP
ii) Marker aided selection for important traits
iii) DNA finger printing of new Musa clones
CISH-
Lucknow
Mango DNA fingerprinting for identification and analysis of existing
genotypes, promising new hybrids and clones of mango

70. Which marker to be use in which situation?
.
• Within and among population variation – Allozyme, SSR, AFLP and RAPD
• Genetic Linkage Mapping – AFLP, RAPD, Allozyme, RFLP, SSR, CAPS, SNP
• Mating system study – Allozyme or microsatellite
• Estimating gene flow via pollen and seed – Microsatellite (SSR)
• Clonal identification – AFLP or RAPD
• Polyploidy – multilocus dominant marker (AFLP)
• Phylogenetic study – conserve within species (DNA sequencing)

71. Tab. 5. DNA Markers for Genetic Diversity Assessment
in Fruit Crops
Fruit Marker Type References
Apple AFLP and RAPDs Coart et al. (2003); Botez et
al. (2009); Sestras et al.
(2009)
Avocado Mini satellite DNA Ashworth et al. (2003)
Banana RAPDs Brown et al. (2009)
Citrus RFLP Durham et al. (1992)
Grapes RFLP and SSRs Bourquin et al. (1993)
Mango cpISSR and RAPDs He et al. (2007)
Marcela et al. (2009)
Pistachio Mini satellite marker Riaz Ahmad et al. (2003)
Cashew RAPD and ISSR Thimmappaiah et al.
(2009)
Pear SSRs and AFLP Sisko et al. (2009)
Zahoor Ahmad BHAT 2010

72. Tab. 6. Markers associated to main polygenic traits in
fruit crops
Fruit Trait Marker Type References
Apple Fire blight
resistance
SCAR, SSR Sylwia et al. (2009)
Citrus Citrus leprosis
virus resistance
AFLP and RAPD Bastianel et al.
(2009)
Pear Incompatibility AFLP and SSR Sun et al. (2009)
Banana Sugar content RFLP Ming et al. (2001)
Grapes Seedlessness,
Berry Size, and
Ripening Date
AFLP, SSR, RAPDs,
ISSRs and SCARs
Mejía et al. (2007)
Strawberry Day-neutrality AFLP Weebadde et al.
(2008)
Apricot Plum Pox Virus SSR Soriano et al.
(2007)

73. Tab. 7. DNA Markers for Varietal Identification
Crop Marker Type References
Raspberry RAPD Parent et al. (1993)
Apple RAPD Koller et al. (1993)
Grape Cultivar SSR Thomas et al. (1995)
Grape Roostock RAPD Hong Xu et al. (1995)
Lemon RAPD Deng et al. (1995)
Mango RAPD Schnell et al. (1995)
Blackberry RFLP Antonius et al. (1997)

74. Tab. 8. DNA Markers for disease diagnostics
Character Fruit crops with
population
Major
gene
(symbol)
Markers
linked
Reference
Grey mold
(Botrytis cinerea)
Strawberry RAPDs Rigotti et al., 2002
Downy mildew Vitis vinifera cv. ‘Mocato
Binaco’ x V. riparia
Marino et al., 2003
Brown spot
disease
(Alternaria
alternata)
‘Clementine’ x ‘LB-8-10’
(‘Clementine’ x
‘Minneola’)
Aa
M1/aaM1
P12 (15.3 cM)
and AL3 (36.7
cM) (RAPDs)
Dalkilic et al., 2005
Eastern filbert
blight
(Anisogramma
anomala)
Hazelnut OSU 245.098 x
OSU 408.040
5 AFLP
markers B2-125
at 4.1 cm
Chen et al., 2005
Citrus tristeza
virus
Different citrus hybrids Ctv-R RAPDs Cristofani et al.,
2000

75. Character Fruit crops with population Major gene
(symbol)
Markers
linked
Reference
Sharka disease Apricot (Padre x 54P455) Y Bliss et al.,
2002
Citrus nematodes
resistance
LB 26 (Clementine mandarin
x Hamlin sweet orange) x
Swingle citrumelo (C.
paradisi)
Markers
linked with
Ctv were
evaluated
Ling et al.,
2000
Plum root
nematode
resistance
Bulked segregate analysis of
clones P 2175, P. 1079 and P.
2980
Ma1, Ma2
and Ma3
SCAL 16 &
SCAL 19
(Practically
applied)
Lecoules et
al., 1999
Peach root knot
nematodes
resistance
Peach cv. ‘Juseitou’ Mj STS-834b Yamamoto
and
Hayashi,
2002
Conti…Tab. 8. DNA Markers for disease
diagnostics

76. Tab. 9. Markers are developed for traits governed by
multigenes or polygenes
Fruit Trait of interest Reference
Apple Scab resistance Patocchi et al., 2007
Citrus Citrus Tristeza Virus Mestre et al., 2007
Papaya Fruit skin colour Inoue et al., 2006
Plum Root-knot nematodes Lecouls et al., 2006

77. Conti.. Tab. 10. Studies of genomic selection in perennial tree species
Sr.
No.
Crop Population
Type And Size
Marker Trait References
1 Mango
(Mangifera indica L.)
ten mango cultivars simple sequences
repeat (SSR)
markers
genetic diversity Kumar M. et
al.(2013)
2 Citrus Fruit Genetic
Variability
Shahnawaz
Ahmed et
al.(2013)
3 Khasi mandarin (Citrus
reticulata Blanco)
Embryos from 27
polyembryonic and
7 monoembryonic
seeds of Khasi
mandarin were
grown in-vitro.
ISSR and RAPD identification of
zygotic and
nucellar
seedlings
Karishma
Kashyap et al.
(2018)
4 Banana (Musa spp.), 22 banana
genotypes
ISSR markers evaluate genetic
variability
Swain S. et
al.(2016)
5 Passion fruit (Passiflora
edulis Sims f. flavicarpa
Deg)
ISSR (Inter
Simple Sequence
Repeat) markers.
genetic
variability in
yellow passion
fruit
Juliana Leles
Costa et al.
(2012)

78. Tab. 11. Studies of genomic selection in perennial tree species
Sr.
No.
Crop Population Type
And Size
Marker Trait References
6 Banana ten important banana
cultivars
RAPD markers Genetic diversity Usha Kiran et al.
(Oct. - 2015)
7 Vitis vinifera L. grape cultivars
including 31 table
grape, 22 juice grape, 6
table grape, raisin, 2
table grape, raisin, wine
and one table grape,
wine were analyzed
SSR markers Genetic structure and
diversity analysis
Hamed Doulati
Baneh
et al. (2013)
8 Carica papaya L. Eighty-three lines
originating from two
segregating F3
populations
Polymorphic
microsatellite
marker
to evaluate the
informativeness of a
microsatellite marker
set when used in
marker-assisted
selection (MAS) for the
development of new
papaya lines.
Oliveira et al.(
(2010)
9 papaya ( Carica
papaya L.).
population of 182 F2
plants from a 'SunUp'
by crossing.
RAPD sex determination in
papaya
Deputy, J.C. et
al. (2003)

79. Conclusion
 In terms of scientific progress, the old disciplines of quantitative
genetics and plant taxonomy have been revived by the molecular
marker approach. The markers have immediate applications in
supportive research for advanced breeding programmes. The major
application of markers lies in the strategic research for rapid
understanding of basic genetic mechanisms and genome organization
at molecular level. The success of DNA marker technology for
bringing genetic improvement in fruit crops would depend on close
interaction between plant breeders and biotechnologists, availability
of skilled man power and substantial financial investment on
research.

80. THANK YOU