The document describes a proposed new DNA encryption technique for secure data transmission with authentication and confidentiality. The technique uses DNA cryptography principles and technologies like DNA synthesis and polymerase chain reaction. It involves generating a substitution array from encryption parameters, converting plaintext to numerical ASCII values, dividing the array by values to get quotients and remainders, converting to a DNA base sequence, and embedding a hash for authentication. The decryption process reverses these steps to recover the original plaintext if the correct keys are provided. The algorithm aims to provide stronger security than previous DNA encryption methods.
Enhanced Level of Security using DNA Computing Technique with Hyperelliptic C...IDES Editor
Hyperelliptic Curve Cryptography (HECC) is a Public
Key Cryptographic technique which is required for secure
transmission. HECC is better than the existing public key
cryptography technique such as RSA, DSA, AES and ECC in
terms of smaller key size. DNA cryptography is a next
generation security mechanism, storing almost a million
gigabytes of data inside DNA strands. Existing DNA based
Elliptic Curve Cryptographic technique require larger key
size to encrypt and decrypt the message resulting in increased
processing time, more computational and memory overhead.
To overcome the above limitations, DNA strands are used to
encode the data to provide first level of security and HECC
encryption algorithm is used for providing second level of
security. Hence this proposed integration of DNA computing
based HECC provides higher level of security with less
computational and memory overhead.
DNA Encryption Algorithms: Scope and Challenges in Symmetric Key CryptographyAM Publications
Data security is now a crucial issue now in our day to day life. The protection of personal identity, personal finances depend on the protection of important and irreplaceable information. Cryptography is the science of converting some readable information into something unreadable format, which are hard to decipher. In modern times, cryptography has adopted a new medium: human DNA. At a time when conventional cryptography has been losing strength to more advanced cryptanalysis, DNA cryptography has added more elements of confusion and diffusion. The use of DNA sequences to encrypt data has strengthened the existing classical encryption algorithms. Thus, DNA cryptography has added another dimension to conventional cryptography. In the present paper the authors have made a systematics study on DNA encryption algorithms and how it can be used along with standard classical encryption algorithms.
Enhanced Level of Security using DNA Computing Technique with Hyperelliptic C...IDES Editor
Hyperelliptic Curve Cryptography (HECC) is a Public
Key Cryptographic technique which is required for secure
transmission. HECC is better than the existing public key
cryptography technique such as RSA, DSA, AES and ECC in
terms of smaller key size. DNA cryptography is a next
generation security mechanism, storing almost a million
gigabytes of data inside DNA strands. Existing DNA based
Elliptic Curve Cryptographic technique require larger key
size to encrypt and decrypt the message resulting in increased
processing time, more computational and memory overhead.
To overcome the above limitations, DNA strands are used to
encode the data to provide first level of security and HECC
encryption algorithm is used for providing second level of
security. Hence this proposed integration of DNA computing
based HECC provides higher level of security with less
computational and memory overhead.
DNA Encryption Algorithms: Scope and Challenges in Symmetric Key CryptographyAM Publications
Data security is now a crucial issue now in our day to day life. The protection of personal identity, personal finances depend on the protection of important and irreplaceable information. Cryptography is the science of converting some readable information into something unreadable format, which are hard to decipher. In modern times, cryptography has adopted a new medium: human DNA. At a time when conventional cryptography has been losing strength to more advanced cryptanalysis, DNA cryptography has added more elements of confusion and diffusion. The use of DNA sequences to encrypt data has strengthened the existing classical encryption algorithms. Thus, DNA cryptography has added another dimension to conventional cryptography. In the present paper the authors have made a systematics study on DNA encryption algorithms and how it can be used along with standard classical encryption algorithms.
IJERA (International journal of Engineering Research and Applications) is International online, ... peer reviewed journal. For more detail or submit your article, please visit www.ijera.com
A SECURE DNA CRYPTOSYSTEM BASED ON STEGANOGRAPHY AND INDEXING CIPHERIJNSA Journal
One of the essential challenges nowadays; is how to secure data with the increase of its volume as well as its transmission rate. The most frequent approach used to give a high degree of protection, preserve data from hackers, and accomplish multilayer security is steganography combined with encryption. DNA (Deoxyribonucleic Acid) is considered as a new promising carrier for data security while achieving powerful security and maximum protection. In this paper, a secure DNA cryptosystem model which combines steganography with encryption is introduced and categorized into two layers. The original data are hidden in the first layer into a reference DNA based on the insertion method to obtain a fake DNA sequence. In the second layer, this fake DNA sequence, which is the first layer's output, is encrypted using an indexing cipher to produce an encrypted message in the form of indexes. The proposed model guarantees multilayer security to the secret data with high performance and low-time wasting. It addresses the long-generation key problem of the DNA cryptography. The experimental results assess and validate the theoretical security analysis and model performance.
A Modified Technique For Performing Data Encryption & Data DecryptionIJERA Editor
In this age of universal electronic connectivity of viruses and hackers of electronic eavesdropping and electronic fraud, there is indeed needed to store the information securely. This, in turn, led to a heightened awareness to protect data and resources from disclosure, to guarantee the authenticity of data and messages and to protect systems from network-based attacks. Information security via encryption decryption techniques is a very popular research area for many people’s over the years. This paper elaborates the basic concept of the cryptography, specially public and private cryptography. It also contains a review of some popular encryption decryption algorithms. A modified method is also proposed. This method is fast in comparison to the existing methods.
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
Comparative Study of Three DNA-based Information Hiding MethodsCSCJournals
Cryptography is the science of protecting information by transforming data into formats that cannot be recognized by unauthorized users. Steganography is the science of hiding information using different media such as image, audio, video, text, and deoxyribonucleic acid (DNA) sequence. The DNA-based steganography is a newly discovered information security technology characterized by high capacity, high randomization, and low modification rate that leads to increased security. There are various DNA-based methods for hiding information.. In this paper, we compared three DNA-based techniques (substitution, insertion, and complementary) in terms of its capacity, cracking property, Bit Per Nucleotide (BPN), and payload. The selected algorithms combine DNA-based steganography and cryptography techniques. The results show that the substitution technique offers the best BPN for short secret messages and offers the best imperceptibility feature. We also found that both the substitution and the complementary method have a threshold BPN. On the other hand, the insertion method does not have a threshold BPN and it is more difficult to crack.
Literature Review on DNA based Audio Steganographic TechniquesRashmi Tank
Steganography is the technique of hiding secret
message in a cover medium in such a way that only the sender and the intended recipient knows the existence of
communication. DNA due to its immense storage capacity and high randomness is used now in the field of steganography. Audio steganography is concerned with hiding information in a cover (host) audio signal in an imperceptible way. In this paper, various techniques using DNA Sequences and audio files for data hiding is discussed for secure data transmission and reception.
A brief discussion of network security and an introduction to cryptography. We end the presentation with a discussion of the RSA algorithm, and show how it works with a basic example.
Secured Paillier Homomorphic Encryption Scheme Based on the Residue Number Sy...ijcisjournal
In this paper, we present an improved Paillier Cryptosystem for a secured data transmission based on the
Residue Number System (RNS). The current state of Paillier Cryptosystem allows the computation of the
plaintext from the cipher text without solving its security assumption of Decisional Composite Residuosity
or the knowledge of its private keys under mathematical attacks
Advanced Encryption Standard (AES) with Dynamic Substitution BoxHardik Manocha
AES algorithm has been stated as secure against any attack but increasing fast computing is making hackers to develop the cracks for AES as well. Therefore to further increase the security of AES, i tried to replace Standard static and fixed Substitution Box with a dynamic S Box. Dynamicity is brought with the help of Input key. Static S box is altered using the input key and the new generated s box is used for encryption. Reverse steps goes for Decryption. Presently, working on to test this design against Side Channel attacks and would publish the results here.
PREDOMINANCE OF BLOWFISH OVER TRIPLE DATA ENCRYPTION STANDARD SYMMETRIC KEY A...IJNSA Journal
Computer data communication is the order of the day with Information Communication Technology (ICT) playing major role in everyone’s life, communicating with smart phones, tabs, laptops and desktops using internet. Security of the data transferred over the computer networks is most important as for as an organization is concerned. Hackers attempt hard to crack the software key and indulge in cyber crimes. In this paper, the main concern is not only to provide security to the data transferred at the software level but it provides the security at hardware level by the modified Blowfish Encryption and Decryption Algorithms. It results minimum delay, high speed, high throughput] and effective memory utilization compared to Blowfish (BF) and Triple Data Encryption Standard (TDES) algorithms. The implementation of Blowfish with modulo adder and Wave Dynamic Differential Logic (WDDL) is to provide security against Differential power analysis (DPA). In the proposed four implementations, BF with constant delay n-bit adder (BFCDNBA) yielded minimum delay, maximum frequency, high memory utilization and high throughput compared to BF with modulo adder and WDDL logic (BFMAWDDL), BF with modulo adder (BFMA) and TDES algorithms. The VLSI implementation of Blowfish and TDES algorithms is done using Verilog HDL.
Paying forward, this deck summarizes key concepts we need to be successful in IT Operations and security, focus is cryptographic controls and their relationship to cryptographic exploits. Please refer to the Networking and Security deck to better understand reference to layers and their associated protocols.
International Journal of Engineering Research and Development (IJERD)IJERD Editor
call for paper 2012, hard copy of journal, research paper publishing, where to publish research paper,
journal publishing, how to publish research paper, Call For research paper, international journal, publishing a paper, IJERD, journal of science and technology, how to get a research paper published, publishing a paper, publishing of journal, publishing of research paper, reserach and review articles, IJERD Journal, How to publish your research paper, publish research paper, open access engineering journal, Engineering journal, Mathemetics journal, Physics journal, Chemistry journal, Computer Engineering, Computer Science journal, how to submit your paper, peer reviw journal, indexed journal, reserach and review articles, engineering journal, www.ijerd.com, research journals,
yahoo journals, bing journals, International Journal of Engineering Research and Development, google journals, hard copy of journal
Innovative field of cryptography: DNA cryptography cscpconf
DNA cryptography is a new instinctive cryptographic field emerged with the research of DNA
computing, in which DNA is used as information shipper and the modern biological technology is
used as accomplishment tool. The speculative study and implementation shows method to be
efficient in computation, storage and transmission and it is very powerful against certain attacks.
The contemporary main difficulty of DNA cryptography is the lack of effective protected theory
and simple achievable method. The most important aim of the research of DNA cryptography is
explore peculiarity of DNA molecule and reaction, establish corresponding theory, discovering
possible development directions, searching for simple methods of understand DNA cryptography,
and Laing the basis for future development. DNA cryptography uses DNA as the computational
tool along with several molecular techniques to manipulate it. Due to very high storage capacity of DNA, this field is becoming very talented. Presently it is in the development phase and it requires a lot of work and research to reach a established stage. By reviewing all the prospective and acerbic edge technology of current research, this paper shows the guidelines that need to be deal with development in the field of DNA cryptography.
IJERA (International journal of Engineering Research and Applications) is International online, ... peer reviewed journal. For more detail or submit your article, please visit www.ijera.com
A SECURE DNA CRYPTOSYSTEM BASED ON STEGANOGRAPHY AND INDEXING CIPHERIJNSA Journal
One of the essential challenges nowadays; is how to secure data with the increase of its volume as well as its transmission rate. The most frequent approach used to give a high degree of protection, preserve data from hackers, and accomplish multilayer security is steganography combined with encryption. DNA (Deoxyribonucleic Acid) is considered as a new promising carrier for data security while achieving powerful security and maximum protection. In this paper, a secure DNA cryptosystem model which combines steganography with encryption is introduced and categorized into two layers. The original data are hidden in the first layer into a reference DNA based on the insertion method to obtain a fake DNA sequence. In the second layer, this fake DNA sequence, which is the first layer's output, is encrypted using an indexing cipher to produce an encrypted message in the form of indexes. The proposed model guarantees multilayer security to the secret data with high performance and low-time wasting. It addresses the long-generation key problem of the DNA cryptography. The experimental results assess and validate the theoretical security analysis and model performance.
A Modified Technique For Performing Data Encryption & Data DecryptionIJERA Editor
In this age of universal electronic connectivity of viruses and hackers of electronic eavesdropping and electronic fraud, there is indeed needed to store the information securely. This, in turn, led to a heightened awareness to protect data and resources from disclosure, to guarantee the authenticity of data and messages and to protect systems from network-based attacks. Information security via encryption decryption techniques is a very popular research area for many people’s over the years. This paper elaborates the basic concept of the cryptography, specially public and private cryptography. It also contains a review of some popular encryption decryption algorithms. A modified method is also proposed. This method is fast in comparison to the existing methods.
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
Comparative Study of Three DNA-based Information Hiding MethodsCSCJournals
Cryptography is the science of protecting information by transforming data into formats that cannot be recognized by unauthorized users. Steganography is the science of hiding information using different media such as image, audio, video, text, and deoxyribonucleic acid (DNA) sequence. The DNA-based steganography is a newly discovered information security technology characterized by high capacity, high randomization, and low modification rate that leads to increased security. There are various DNA-based methods for hiding information.. In this paper, we compared three DNA-based techniques (substitution, insertion, and complementary) in terms of its capacity, cracking property, Bit Per Nucleotide (BPN), and payload. The selected algorithms combine DNA-based steganography and cryptography techniques. The results show that the substitution technique offers the best BPN for short secret messages and offers the best imperceptibility feature. We also found that both the substitution and the complementary method have a threshold BPN. On the other hand, the insertion method does not have a threshold BPN and it is more difficult to crack.
Literature Review on DNA based Audio Steganographic TechniquesRashmi Tank
Steganography is the technique of hiding secret
message in a cover medium in such a way that only the sender and the intended recipient knows the existence of
communication. DNA due to its immense storage capacity and high randomness is used now in the field of steganography. Audio steganography is concerned with hiding information in a cover (host) audio signal in an imperceptible way. In this paper, various techniques using DNA Sequences and audio files for data hiding is discussed for secure data transmission and reception.
A brief discussion of network security and an introduction to cryptography. We end the presentation with a discussion of the RSA algorithm, and show how it works with a basic example.
Secured Paillier Homomorphic Encryption Scheme Based on the Residue Number Sy...ijcisjournal
In this paper, we present an improved Paillier Cryptosystem for a secured data transmission based on the
Residue Number System (RNS). The current state of Paillier Cryptosystem allows the computation of the
plaintext from the cipher text without solving its security assumption of Decisional Composite Residuosity
or the knowledge of its private keys under mathematical attacks
Advanced Encryption Standard (AES) with Dynamic Substitution BoxHardik Manocha
AES algorithm has been stated as secure against any attack but increasing fast computing is making hackers to develop the cracks for AES as well. Therefore to further increase the security of AES, i tried to replace Standard static and fixed Substitution Box with a dynamic S Box. Dynamicity is brought with the help of Input key. Static S box is altered using the input key and the new generated s box is used for encryption. Reverse steps goes for Decryption. Presently, working on to test this design against Side Channel attacks and would publish the results here.
PREDOMINANCE OF BLOWFISH OVER TRIPLE DATA ENCRYPTION STANDARD SYMMETRIC KEY A...IJNSA Journal
Computer data communication is the order of the day with Information Communication Technology (ICT) playing major role in everyone’s life, communicating with smart phones, tabs, laptops and desktops using internet. Security of the data transferred over the computer networks is most important as for as an organization is concerned. Hackers attempt hard to crack the software key and indulge in cyber crimes. In this paper, the main concern is not only to provide security to the data transferred at the software level but it provides the security at hardware level by the modified Blowfish Encryption and Decryption Algorithms. It results minimum delay, high speed, high throughput] and effective memory utilization compared to Blowfish (BF) and Triple Data Encryption Standard (TDES) algorithms. The implementation of Blowfish with modulo adder and Wave Dynamic Differential Logic (WDDL) is to provide security against Differential power analysis (DPA). In the proposed four implementations, BF with constant delay n-bit adder (BFCDNBA) yielded minimum delay, maximum frequency, high memory utilization and high throughput compared to BF with modulo adder and WDDL logic (BFMAWDDL), BF with modulo adder (BFMA) and TDES algorithms. The VLSI implementation of Blowfish and TDES algorithms is done using Verilog HDL.
Paying forward, this deck summarizes key concepts we need to be successful in IT Operations and security, focus is cryptographic controls and their relationship to cryptographic exploits. Please refer to the Networking and Security deck to better understand reference to layers and their associated protocols.
International Journal of Engineering Research and Development (IJERD)IJERD Editor
call for paper 2012, hard copy of journal, research paper publishing, where to publish research paper,
journal publishing, how to publish research paper, Call For research paper, international journal, publishing a paper, IJERD, journal of science and technology, how to get a research paper published, publishing a paper, publishing of journal, publishing of research paper, reserach and review articles, IJERD Journal, How to publish your research paper, publish research paper, open access engineering journal, Engineering journal, Mathemetics journal, Physics journal, Chemistry journal, Computer Engineering, Computer Science journal, how to submit your paper, peer reviw journal, indexed journal, reserach and review articles, engineering journal, www.ijerd.com, research journals,
yahoo journals, bing journals, International Journal of Engineering Research and Development, google journals, hard copy of journal
Innovative field of cryptography: DNA cryptography cscpconf
DNA cryptography is a new instinctive cryptographic field emerged with the research of DNA
computing, in which DNA is used as information shipper and the modern biological technology is
used as accomplishment tool. The speculative study and implementation shows method to be
efficient in computation, storage and transmission and it is very powerful against certain attacks.
The contemporary main difficulty of DNA cryptography is the lack of effective protected theory
and simple achievable method. The most important aim of the research of DNA cryptography is
explore peculiarity of DNA molecule and reaction, establish corresponding theory, discovering
possible development directions, searching for simple methods of understand DNA cryptography,
and Laing the basis for future development. DNA cryptography uses DNA as the computational
tool along with several molecular techniques to manipulate it. Due to very high storage capacity of DNA, this field is becoming very talented. Presently it is in the development phase and it requires a lot of work and research to reach a established stage. By reviewing all the prospective and acerbic edge technology of current research, this paper shows the guidelines that need to be deal with development in the field of DNA cryptography.
Automatic DNA Sequence Generation for Secured Effective Multi -Cloud StorageIOSR Journals
Abstract: The main target of this paper is to propose an algorithm to implement data hiding in DNA sequences
to increase the confidentiality and complexity by using software point of view in cloud computing environments.
By utilizing some interesting features of DNA sequences, the implementation of a data hiding is applied in
cloud. The algorithm which has been proposed here is based on binary coding and complementary pair rules.
Therefore, DNA reference sequence is chosen and a secret data M is hidden into it as well. As result of applying
some steps, M´´´ is come out to upload to cloud environments. The process of identifying and extracting the
original data M, hidden in DNA reference sequence begins once clients decide to use data. Furthermore,
security issues are demonstrated to inspect the complexity of the algorithm. In addition, providing better privacy
as well as ensure data availability, can be achieved by dividing the user’s data block into data pieces and
distributing them among the available SPs in such a way that no less than a threshold number of SPs can take
part in successful retrieval of the whole data block. In this paper, we propose a secured cost-effective multicloud
storage (SCMCS) model in cloud computing which holds an economical distribution of data among the
available SPs in the market, to provide customers with data availability as well as secure storage.
Keywords: DNA sequence; DNA base pairing rules; complementary rules; DNA binary coding; cloud service
provider.
A comparative review on symmetric and asymmetric DNA-based cryptographyjournalBEEI
Current researchers have focused on DNA-based cryptography, in fact, DNA or deoxyribonucleic acid, has been applied in cryptography for performing computation as well as storing and transmitting information. In the present work, we made use of DNA in cryptographic, i.e. its storing capabilities (superior information density) and parallelism, in order to improve other classical cryptographic algorithms. Data encryption is made possible via DNA sequences. In this paper, two cases utilizing different DNA properties were studied by combining the DNA codes with those conventional cryptography algorithms. The first case concerned on symmetric cryptography that involved DNA coding with OTP (one time pad) algorithms. Asymmetric cryptography was considered in the second case by incorporating the DNA codes in RSA algorithm. The efficiencies of DNA coding in OTP, RSA, and other algorithms were given. As observed, the computational time of RSA algorithm combined with DNA coding was longer. In order to alleviate this problem, data redundancy was reduced by activating the GZIP compressed algorithm. The present experimental results showed that DNA symmetric cryptography worked quite well in both time and size analyses. Nevertheless, it was less efficient than the compressed DNA asymmetric cryptography.
Data protection based neural cryptography and deoxyribonucleic acidIJECEIAES
The need to a robust and effective methods for secure data transferring makes the more credible. Two disciplines for data encryption presented in this paper: machine learning and deoxyribonucleic acid (DNA) to achieve the above goal and following common goals: prevent unauthorized access and eavesdropper. They used as powerful tool in cryptography. This paper grounded first on a two modified Hebbian neural network (MHNN) as a machine learning tool for message encryption in an unsupervised method. These two modified Hebbian neural nets classified as a: learning neural net (LNN) for generating optimal key ciphering and ciphering neural net CNN) for coding the plaintext using the LNN keys. The second granulation using DNA nucleated to increase data confusion and compression. Exploiting the DNA computing operations to upgrade data transmission security over the open nets. The results approved that the method is effective in protect the transferring data in a secure manner in less time
HYBRID CRYPTOSYSTEM WITH DNA BASED KEY FOR WIRELESS SENSOR NETWORKS ijwmn
A number of various techniques have been already developed for providing security in sensor networks. It
may be anticipated that these techniques provide less secure sensor network which has numerous adverse
effects associated with them. Thus there is a sufficient scope for improvement of secure electronic
communication, as the proficiency of attacks is growing rapidly in wireless sensor networks. DNA
steganography is a technique of covered writing, which provides secure system in sensor network to some
extent. Steganography is more effective over cryptography as later one only conceals information but
steganography obscures the information, as well as camouflage the data to various attackers. DNA
steganography is an inventive approach to reduce the popularity of public key cryptography over the
wireless sensor networks. In the proposed work, a secret key is introduced which is purely based on DNA
sequence named as DNA stego key and is only known to sender and receiver. This DNA stego key is used to
hide information and is stored in a carrier. The proposed technique is implemented using java to verify its
correctness.
HYBRID CRYPTOSYSTEM WITH DNA BASED KEY FOR WIRELESS SENSOR NETWORKSijwmn
A number of various techniques have been already developed for providing security in sensor networks. It may be anticipated that these techniques provide less secure sensor network which has numerous adverse effects associated with them. Thus there is a sufficient scope for improvement of secure electronic communication, as the proficiency of attacks is growing rapidly in wireless sensor networks. DNA steganography is a technique of covered writing, which provides secure system in sensor network to some
extent. Steganography is more effective over cryptography as later one only conceals information but steganography obscures the information, as well as camouflage the data to various attackers. DNA steganography is an inventive approach to reduce the popularity of public key cryptography over the wireless sensor networks. In the proposed work, a secret key is introduced which is purely based on DNA
sequence named as DNA stego key and is only known to sender and receiver. This DNA stego key is used to
hide information and is stored in a carrier. The proposed technique is implemented using java to verify its
correctness
HYBRID CRYPTOSYSTEM WITH DNA BASED KEY FOR WIRELESS SENSOR NETWORKS ijwmn
A number of various techniques have been already developed for providing security in sensor networks. It
may be anticipated that these techniques provide less secure sensor network which has numerous adverse
effects associated with them. Thus there is a sufficient scope for improvement of secure electronic
communication, as the proficiency of attacks is growing rapidly in wireless sensor networks. DNA
steganography is a technique of covered writing, which provides secure system in sensor network to some
extent. Steganography is more effective over cryptography as later one only conceals information but
steganography obscures the information, as well as camouflage the data to various attackers. DNA
steganography is an inventive approach to reduce the popularity of public key cryptography over the
wireless sensor networks. In the proposed work, a secret key is introduced which is purely based on DNA
sequence named as DNA stego key and is only known to sender and receiver. This DNA stego key is used to
hide information and is stored in a carrier. The proposed technique is implemented using java to verify its
correctness.
DATA ENCRYPTION USING BIO MOLECULAR INFORMATIONijcisjournal
Cryptography is a field, which makes the transmitted message unreadable to unauthorised users. In this
work we take inspiration from DNA encryption schemes and use of biological alphabets to manipulate
information by employing the DNA sequence reaction, to autonomously make a copy of its threads as an
extended encryption key. Information is converted from plain text to several formats and then follows the
stages of protein formation from DNA sequences to generate an extended key using chemical property and
attributes to be used in encryption mechanism. This technique will enhance the security of the encryption
mechanism by substitution, manipulation, and complexity. Furthermore this technique can be used in many
applications of informat
A NOVEL DNA ENCRYPTION SYSTEM USING CELLULAR AUTOMATAijsptm
DNA Cryptography is a new born cryptographic field emerged with the research of DNA Computing in which DNA is used as an Information carrier. Cellular automata is dynamic in nature so it provide dynamic behavior in the system which may increase the security in the system. DNA cryptography is
provide a secure way to encrypt the text and automata changes the state of the system based on the present
state, it will occur in discrete time. These qualities are most impressive in these techonology which help us to provide a highly secured security system for the users. Most of the encryption techniques based on the cellular automata have limitations. To overcome this lacuna, we propose a novel DNA cryptography algorithm with cellular automata to achieve randomness, parallelism, uniformity, reversibility and stable.
An algorithm implemented and its results obtained are depicts here, and a result analysis is done with other algorithms.
File transfer with multiple security mechanismShubham Patil
The system enhances the security and the data confidentiality between the users and receiver by the two-layer encryption mechanism and the QR code for verification. The system consists of three main components which are very important to providing the security between sender and receiver while transmitting the data
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
A NOVEL IMAGE ENCRYPTION SCHEME WITH HUFFMAN ENCODING AND STEGANOGRAPHY TECHN...IJNSA Journal
In today’s day and age when everything is done with the aid of computing technology, the need for confidential communication has drastically increased. Not only the sensitive data such as top intelligent secrets of our nation but personal information of common people needs to be secure. Several combinations of cryptography and steganography techniques in different ways are used by researchers over the past to protect the data being transmitted. Cryptography uses mathematical algorithms to convert the data into an incomprehensible form and Steganography, on the other hand hides the data in a carrier such as image, data, audio or video. Cryptography provides necessary mechanisms for providing accountability, accuracy and confidentiality in public communication mediums such as the Internet and steganography is used in other fields such as copyright, preventing e-document forging etc. We are of the opinion that this security mechanism can further be increased by incorporating the use of Huffman coding in order to reduce the data length. This paper is an effort in the direction to hide, secure and compress the data. It explains the executed procedure by applying various encryption techniques one by one and our aim is to get the best security out of the existing ones. The proposed technique is implemented in MATLAB2016a and the results shown in this paper that our technique is better approach then the conventional techniques.
SOM-PAD: Novel Data Security Algorithm on Self Organizing Map cscpconf
Data security is one of major challenges in the recent literature. Cryptography is the most
common phenomena used to secure data. One main aspect in cryptography is creating a hard to
guess cipher. Artificial Neural Networks (ANN) is one of the machine learning techniques
widely employed in several fields based on its characters, depending on the application area.
One of these fields is data security. The state of art in this paper is the use of self organizing
map (SOM) algorithm concept as a core idea to construct a pad; this pad is used to generate the
cipher at one end. At the other end of communication the same process is synchronized to
generate the same pad as the deciphering key. The security of the proposed model depends on
the complex nature of ANN's. The algorithm could be categorized under symmetric
cryptography, merging both stream and block cipher. A modified version of the same algorithm
also presented employs permutation and variable SOM neighborhoods. The proposal can be
applied over several file formats like videos, images, text files, data benchmarks, etc as show in
experimental results
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
1. A New DNA Encryption Technique for Secure Data Transmission with Authentication
and Confidentiality.
Md. Sajedul Karim, Shyla Afroz
Rajshahi University of Engineering and Technology
Department of Computer Science & Engineering
Rajshahi-6204, Bangladesh
Mesukcse08@gmail.com, shyla_cse05@yahoo.com
Abstract— Internet use and network growing quickly. So there
are more requirements to secure the data transmitted over
different networks using different services. To provide the
security to the network and data different encryption methods
are used. Encryption is the process of translating , plaintext in
“readable” form to a cipher text “non-readable” to provide
the security again different attacks. Thus, to provide a secure
service to the network there two wide DES and RSA secret
and public key cryptography based algorithms are used[5].
DNA Cryptography is one of the emerging techniques in
today’s world of science. It uses the biological element known
as DNA alongwith cryptography. One of the major drawbacks
of DNA Cryptography field is that a lot of research and work
is required to reach a position in which it can be implemented
and made useful for practical purposes. There is a need that
knowledge from traditional cryptography and DNA
technology should be exchanged and a cryptosystem could be
devised so that benefits from both the fields can be enjoyed.
The DNA technology focuses on experiments. There are very
few technologies which have been developed and well
accepted in the last few years. Some of these accepted key
technologies are polymerase chain reaction (PCR), DNA
synthesis and DNA digital coding. Various encryption
algorithms are devised based
on these technologies which results in excellent security of the
data. The main focus of this paper is to provide with an
encryption decryption algorithm using the above mentioned
technologies with secure strength, bringing failure to the
intruder effort to break the cipher.
Keywords—Cryptograph, Decryption, DNA, Encryption,
DNA Computing, DNA Cryptography.
I. INTRODUCTION
DNA cryptography is encrypting or hiding a data in terms
of DNA sequences, which can be done using several DNA
technologies with the biochemical methods. The vast
parallelism and extraordinary information density
characteristics of DNA molecules are explored for
cryptographic purposes such as encryption, authentication,
signature, and so on. DNA cryptography might become of
practical significance in the context of labelling organic and
inorganic materials with DNA ‘barcodes’ [1]. DNA computing
has its own application in the field of huge information storage,
massive parallel processing, and low energy consumption.
DNA computational logic can be used in cryptography for
encrypting, storing and transmitting the information, as well as
for carrying out computation. DNA cryptography has shown
its effectiveness in the field of secured data transmission. DNA
is a medium for ultra-compact information storage. Currentlyit
is in the development phase and requires a lot of work and
research to reach a mature stage. DNA as a means of
cryptography has high technical laboratory requirements and
computational limitations, as well as the effort demanding
extrapolation means so far. DNA-based Cryptography is an
approach to guarantee highly secure environment. Various
encryption schemes have been designed by using the
technologies of DNA synthesis, PCR amplification and DNA
digital coding including the theory of traditional cryptography.
There are various algorithms for encryption of messages in
DNA cryptography using DNA base: Bi-serial DNA
encryption algorithm, IDEA algorithm for making it more
secure, Image encryption algorithm based on DNA self-assembly
technology. As Prabhu and Adimoolam [2] claim an
encryption algorithm which is based on number conversion,
DNA digital coding, PCR amplification and XOR operation. In
this scheme two primer pairs were used as the key which were
not independently designed by the sender or receiver. The
traditional encryption method and DNA Digital Coding were
used to preprocess operation to get completely different cipher
text from the same plaintext, which can effectively prevent
attack from possible word as PCR primers. This encryption
scheme provided a double layer security but a single
imperfection in the design of encryption scheme could allow
successful attacks. The cost of encryption was also very high
with process of techniques. According to Rakheja [3] a more
secure algorithm using DNA computing on international data
encryption algorithm (IDEA) was designed. A layer of DNA
cipher was added over the basic IDEA algorithm. The cipher
now will be in form of DNA sequence which will even hide
very existence of the underlying IDEA algorithm. Key space
was extended a bit to make it more immune to cryptanalytic
attacks [1].
II. Biological Background
The biological background of DNA cryptography consists of
the biological elements that work as the backbone of the
whole scheme. These elements are described as:
A. DNA
A Deoxyribonucleic Acid (DNA) is the genetic content of the
cell found in every living organism. The main task of the
DNA is to carry the genetic information from parents to their
offspring. DNA is a double helix structure consisting of four
bases: Adenine (A), Thymine (T), Cytosine (C), and Guanine
(G). The pairing will be done in such a way that Adenine will
2. always pair up with Thymine and Cytosine will always pair up
with Guanine[7].
Figure 1: Structure of DNA Molecule
B Amino Acid
The DNA sequences after pairing are matched with the amino
acid sequence. Combination of any three nucleotide of DNA
results in an element of the codon table and there is a
corresponding amino acid for it. Based on the building of
DNA codon, the amino acid is made [3].
III. Bimolecular Computation
Recombinant DNA techniques have been developed for a
wide class of operations on DNA strands. There has recently
arisen a new field of research known as DNA computing,
that makes use of recombinant DNA techniques for carrying
out computation [6]. Recombinant DNA operations were
shown to be theoretically sufficient for universal computation
[7]. Bimolecular computing (BMC) methods have been
proposed to solve difficult combinatorial search problems such
as the Hamiltonian path problem [8], using the vast
parallelism available to do the combinatorial search among a
large number of possible solutions represented by DNA
strands. For example [9] and [6] proposed bimolecular
computing methods for breaking the Data Encryption
Standard (DES). While these methods for the solution of hard
combinatorial search problems might succeed for fixed sized
problems, they are ultimately limited by their volume
requirements, which may grow exponentially with input size.
For example, DNA is appealing media for data storage due to
the very huge amount of data can be stored in compact
volume. It vastly exceeds the storage capacities of
conventional electronic, magnetic, optical media. A gram of
DNA contains about 10^21 DNA bases, or about 108 tera-bytes.
Hence, a few grams of DNA may have the probability
of storing all the data stored in the whole world.
IV. Proposed Algorithm
The encryption process in this case is little different from the
encryption schemes used till now. In those encryption schemes
DNA technologies like PCR amplification, XOR operation etc
were used. Primer pairs were added to the data which were
used as keys. And after the encryption is finished when it
comes to sending of data, the encrypted data is compressed.
But in this proposed algorithm of DNA encryption/decryption,
no primer pairs are used and no compression technique is
applied. The proposed encryption algorithm firstly will
generate a substitution array after entering all the three
parameters. Firstly decide the STARTING_NUMBER and
MODULO. Those can be of any Integer number. From this
two integer generate the Substitution_Array. After this give
input on which encryption is to be done and obtain ASCII
value for it. Then perform ASCII code to numerical value
conversion. This will convert the ASCII characters into their
The proposed scheme presents with a symmetric algorithm
which will provide with secure strength, bringing failure to
the intruder effort to break the cipher. In this, the main task is
to grant security to the cipher text by using three parameters
(discussed below) which will work as key. This will include a
substitution array which will play a major role in giving the
strength to the algorithm. The encryption and the decryption
algorithm will be made public. These five parameters of the
key will give secure strength to the algorithm. This will bring
failure to the intruders’ effort in breaking the algorithm. The
algorithm will proceed with both the sender and the receiver
knowing the value of all the five parameters of the key.
Key= { STARTING_NUMBER, Modulus,
hyphen_Indices_Array }
STARTING_NUMBER: Is an Integer number that
generate the Substitution_Array using modulo.
Modulo: It is an Integer number that generate the
Substitution_Array using STARTING_NUMBER.
Hyphen_Indices_Array: It generate after the end of the
computation. Using this array element four-base numbers
are separated. To know about all the three parameters
correctly will be a difficult task for the intruder. So this
algorithm is assured to be secure. This algorithm will
successfully perform encryption and decryption for all the
256 ASCII characters.
Figure 2: Block Diagram of Proposed model
Here,
M: Plain text;
H: HASH code;
E: Encryption
C: Cipher Text;
D: Decryption;
||: Append;
From the figure message will first encrypt with a set of key
and a HASH code also generate from that input message. The
3. encrypted message only some DNA bases. Both HASH code
and encrypted message are embedded and send to the receiver.
In server total transition is (H||E(M,k)). In receiver side
receiver decrypt the message using that key and also generate
a HASH code . Then compare both HASH code. If both
HASH code are same then Message is authenticated.
V. Encryption
The encryption process in this case is little different from the
encryption schemes used till now. Firstly generate the
corresponding ASCII value from Plaintext. Then perform
ASCII code to numerical value conversion. This will convert
the ASCII characters into their respective numeric code. After
that decide the STARTING_NUMBER and Modulus. Those
can be of any size, depending on the need of the user. Using
this two number generates the SUBSTITUTION_ARRAY.
Size of the Substitution_Array is equal the size of ASCII
Array. This conversion is very simple. Calculate Quotient and
Remainder using division the Substitution_Array value with
corresponding ASCII value. The message will now be the
series of Quotient followed by the Remainder. Apply Base 10-
Base 4 conversion on the generated series of Quotient and
Remainder. With this a string of Hyphen_Indices will be
generated which will represent the indices of the hyphen that
are used to separate the characters in the input after base
conversion. After generating base 4, replace all the 0,1,2,3 in
the series by A, T, C, and G respectively to get the DNA
sequence. According to the above mentioned assumptions,
the proposed encryption algorithm consists of following steps:
Step 1: Convert each letter from plaintext into its numerical
value using ASCII code and store it in ASCII_Array. Also
calculate HASH code from the Plaintext.
Step 2: Generate Substitution_Array using
STARTING_NUMBER and MODULO. Size of
Substitution_Array is equal to size of ASCII_Array.Equation
is:
SUBSTITUTION_ARRAY [0]=STARTING_NUMBER;
For(i=1 to ASCII_Array_Length )
SUBSTITUTION_ARRAY[i]=Substitution_Array[i-1] +
Modulo;
Step 3: Calculate the Remainder and Quotient from
ASCII_Array and Substitution_Array.
Equation is:
For(i=0 to ASCII_Array size)
Remainder_Array[i]=SUBSTITUTION_ARRAY[i]/
ASCII_Array[i];
For (i=0 to ASCII_Array size)
uotient_Array[i]=SUBSTITUTION_ARRAY[i]%
ASCII_Array[i];
Step 4: Merge the Remainder_Array and Quotient_Array into
Final_Array using Quotient followed by the Remainder.
Calculation is:
For(i=0 to ASCII_Array size )
Final_Array[I]=Quotient_Array[i];
For(i= ASCII_Array size to 2*ASCII_Array size )
Final_Array[++i]=Remainder_Array[i];
Here Merge Array contains 10 base decimal numbers.
Step 5: Apply Base 10- Base 4 conversion on the generated
series of Quotient and Remainder. Reasons of 4-base
conversion are DNA contains only 4 bases. To represent 4
DNA bases need 4 base numbers.
Step 6: Replace all the 0,1,2,3 in the series by A, T, C, and G
respectively.
Here A means Adenine, T means Thiamin, C means Cytosine
and G means Guanine.
Replacement is:
0----A
1----T
2----C
3----G
The Encrypted message is now ready to forward to the
receiver for communication. The transmitted message
contains DNA bases and HASH code.
VI. Decryption
From the sender’s side we get the encrypted data.
There is no need of applying decompression algorithm to
recover compressed data as used before in other encryption
schemes. This is because we are getting the cipher in DNA
bases form in which the data is already in very small
sequence. We will get a sequence of amino acid in the form of
cipher from the sender. After we get DNA sequence, the A, T,
C, G in sequence are replaced by 0, 1, 2 and 3 respectively i.e.
DNA digital coding is converted into binary code. The
generated series will now go through hexadecimal conversion
i.e. base4 – base10 conversion after getting the
Hyphen_Indices string. Now we get the series of quotient
followed by the remainder. Once this series is got, a loop is
run for all the elements. Each ASCII value is multiplied and
the generated remainder is added to it. Now compare it with
the number in the SUBSTITUTION_ARRAY. The ASCII
valued character that matches with the number in the
SUBSTITUTION_ARRAY will be stored in a separate array
and will be read as the final message. In case anyone of the
key is wrong, then they’re missing of data or improper form of
data. So, there are chances of maintaining more secure of data.
Another thing to be kept in mind is that, chances are there
when any number of the SUBSTITUTION_ARRAY happens
to be zero. Special care should be taken in that case. The
decryption algorithm consists of following steps:
Step 1: The nucleotide sequences of the DNA i.e. A, T, C and
G is replaced by 0, 1, 2 and 3 respectively. Separate the
embedded HASH code.
Step 2: Separate the 4-base individual number using
Hyphen_Indices_Array.
4. Step 3: Base 4 – Base10 conversion is applied on the
generated sequence to get the quotients followed by the
remainders.
Step 4: Separate the 10-base array into Quotient_Array and
Remainder_Array.
Step 5: Cconstruct the SUBSTITUTION_ARRAY using the
STARTING_NUMBER and MODULO.
Step 6:
Calculate the ASCII_ARRAY using following equation:
ASCII_ARRAY[i]=(SUBSTITUTION_ARRAY[i]
Remainder_Array[i])/ Quotient_Array [i]
Step 7: Calculate the HASH code from ASCII_ARRAY. IF
both HASH code are same then Message are Authenticated
otherwise not. Map the ASCII value to character from
ASCII_ARRAY. This is the plain text.
Step 8: Map the ASCII value to character from
ASCII_ARRAY. This is the plain text.
Let we represent ,
Quotient=Q
Remainder=R
SUBSTITUTION_ARRAY=A and
Length of Quotient Array=L
5. Figure 3 process of encryption and decryption.
Separate 4- base number using
Hyphen_Indices_Array
VII. Results
The implementation of the DNA Cryptography algorithm for
encryption and decryption algorithm presented
above have been carried out using PC with Intel Pentium
Dual Core Processor running on 1.60 GHz. The
proposed algorithms are designed by using Android as
programming language and Eclipse for providing user
interface. The plaintext after going through encryption and
decryption process has successfully been recovered.
After encrypting the plaintext and running the cipher, the
original text is generated. In the first snapshot, we first
entered the keys, which are passwords known only to the one
who encrypt and the one who decrypt the text. When sender
click the send button the message will convert to DNA bases
and send message to the receiver phone. In second snapshot,
we have browse the message from inbox and entering key
plaintext will recover. For simplicity I use only one
ENCRYPTION
Make
SUBSTITUTION_ARRAY
Input: Plain Text &
Perform ASCII conversion
Calculate HASH code from plaintext.
Calculate Substitution Array:
Divide the Chosen Number
of Array with ASCII Value
Generate Quotient and
Remainder
Base 10 - Base 4 Conversion
Calculate Hyphen_Indices_Array
DNA Digital Coding
Embede (Cipher Text + HASH code)
DECRYPTION
DNA Digital Coding
Base 10 – Base 4 Conversion
‘for loop’ for array elements ,
do (S[]-R[])/Q[] & get ASCII_Array[]
Calculate HASH code. Check Authenticity
ASCII value to character conversion.
6. key(Starting Number) and other two key are append will code
and cipher text.
VII. I. Sender Side
Suppose I want to send message MESUK. This Encryption
process is given below:
Plain Text=MESUK
Suppose, STARTING_NUMBER=500 and MODULO=50.
Table 1 Encryption Process
Msg Ascii Sub[] Division Quotient Remainder
M 77 500 500/77 6 38
E 69 550 550/69 7 67
S 83 600 600/83 7 19
U 85 650 650/85 7 55
K 75 700 700/75 9 25
HASH code is sum of all ASCII value: 389
Quotient followed by the Remainder.
{6, 7, 7, 7, 9, 38, 67, 19, 55, 25}
Applying Base 10 – Base 4 conversion on the generated series.
{12, 13, 13, 21, 212, 1003, 103, 313, 121}
Hyphen_Indices_Array will be:
{3, 6, 9, 12, 16, 21, 25, 29, 33}
Replacing 0,1,2,3 with the DNA bases A, T, C, and G
respectively: GTGCGCGTTGTGTGAACGACCGCGTG
This GTGCGCGTTGTGTGAACGACCGCGTG +389 are
send to the receiver.
Key: STARTING_NUMBER:500 MODULO:50 and
Hyphen_Indices_Array={3,6,9,12,16,21,25,29,33}
Snapshot 1 : DNA Encryption and its SMS application
Here cipher text contains four parts:
1. $(Dolor) sign: Here $ sign represents that this
message is encrypted using “DNA Encryption
Technique”.
2. DNA bases: A, T, G and C are the convert form of
original message. Using this technique plaintext is
converted to this DNA bases.
3. Hyphen Indices Array Value: After DNA bases there
are some integer number. Those numbers are the
Hyphen Indices Array Value. These values will use
to separate the 4- base number from DNA base in
Decryption phase.
4. HASH code: After the sign HASH (#) the number is
HASH code. It is generated from plaintext message.
This is used for message Authentication.
VII. II. Receiver Side
HASH code: 389
Cipher Text: GTGCGCGTTGTGTGAACGACCGCGTG
Replacing A, T, C, G with the 0,1,2,3 respectively
{121313212121003103313121}
Separate the 4-base number using Key
Hyphen_Indices_Array.
{12, 13, 13, 21, 212, 1003, 103, 313, 121}
Applying Base 4 – Base 10 conversion on the generated series.
{6, 7, 7, 7, 9, 38, 67, 19, 55, 25}
Split up the total array into Quotient and Remainder Array.
Quotient: {6, 7, 7, 7, 9}
Remainder :{ 38, 67, 19, 55, 25}
Generate the SUBSTITUTION_ARRAY Using key
STARTING_NUMBER and MODULO:
{500, 550, 600, 650, 700}
Table 2: Decryption Process
Quotient Remainder ASCII[i]=(A[i]-R[i])/Q[i]
0<=i<L;
Character
6 38 77 M
7 67 69 E
7 19 83 S
7 55 85 U
9 25 75 K
7. Snapshot 2: DNA Decryption and its SMS application
Result Analysis:
As the given figure represents the execution time of New
DNA Encryption technique and RSA algorithm to encrypt the
data of same length. In this scheme execution time varies due
to configuration of PC and size of Input.
The configuration of my PC is:
Intel Pentium Dual Core Processor running on 1.20 GHz.
Another important thing is execution time varies in different
time with same input for both algorithm.
Table1 3: Execution Time (Milliseconds) of Encryption
and decryption of Different data packet size
Input Size(KB) DNA Encryption RSA
4.096 31.2 52
6.025 35 57
15 51.3 62.4
21.8 57.3 65.03
24 59 70.21
Figure 4: Encryption decryption time comparison chart.
80
70
60
50
40
30
20
10
0
DNA Encryption RSA
4.096
6.025
15
21.8
24
Table 4:Comparison of performance with RSA algorithm
Parameters DNA Encryption
Technique
RSA
Encryption and
decryption process
running time
Lesser compared
with RSA
More than the
DNA
ryptosystems
Security Encryption key
depends on
message length.
Larger message
provide more
security.
If large key then
system will slow
down.
Amount of data
transfer
In server side
implementation
not any limitation
on amount of data.
For a n-bit RSA
key, direct
encryption
PKCS#1 works for
arbitrary binary
messages up
to floor(n/8)-11
bytes.
Key distribution
problem
No problem on
key distribution in
this technique.
If Two people
using the
same key, eceiving
the same message.
Cost High Less than the
DNA
cryptosystems
Problem on prime
factor
No prime factor
existing
Problem on prime
factor.
VIII. Conclusion and Future Work
In this paper, we designed a DNA encryption/decryption
algorithm which will provide more security from the
algorithms which are in existence till now. This algorithm’s
performance is also more than traditional Algorithm (RSA).
Apart from providing double layer security with complexity of
biological difficult problem and cryptography computing
difficulties, we can say this algorithm will provide a two
Cipher text size from a certain size of plaintext is respectively
high. Obviously it is a positive side for a encryption algorithm.
8. But for data transmission it can cause more cost from user. To
eliminate this problem I will reduce the length of cipher text
with keeps unchanged the quality of this method. This is also
avoid zero quotient or quotient in decimals. In future work
comprises of analyzing the performance of the algorithm
designed to various cryptanalytic attacks and comparing with
IDEA to knowing exactly how much improvement is
achieved.
IX. References
[1] William Starling ,”Cryptography and Network Security”,
Fourth Edition.
[2] Sanjeev Dhawan, Alisha Saini, “A New DNA
Encryption Technique for Secure Data Transmission”,
International Journal of Emerging Technologies in
Computational and Applied Sciences (IJETCAS), ISSN
(Online): 2279-0055:00:$,
[3] D.Prabhu ,M.Adimoolam, “Bi-serial DNA Encryption
Algorithm (BDEA)”, CoRR abs/1101.2577 -2011.
[4] Pankaj Rakheja, “Integrating DNA Computing in
International Data Encryption Algorithm (IDEA)”,
International Journal of Computer Applications (0975 –
8887) Volume 26– No.3 -July 2011.
[5] Abdullah Al Mueen & Md. Nurul Amin “Applications of
Graphs in Bioinformatics” pp.16-50, 2006
[6] Kang Ning. “A Pseudo DNA Cryptography Method”.
March 2009 .
[7] Shen Chang “IDEA International Data Encryption
Alrorithm” CS-627-1 fall 2004
[8] Guangzhao Cui, Cuiling Li, Haobin Li, Xiaoguang Li
“DNA Computing and Its Application to Information
Security Field”,2009 Fifth International Conference on
Natural Computation .