DNA cryptography is a new instinctive cryptographic field emerged with the research of DNA
computing, in which DNA is used as information shipper and the modern biological technology is
used as accomplishment tool. The speculative study and implementation shows method to be
efficient in computation, storage and transmission and it is very powerful against certain attacks.
The contemporary main difficulty of DNA cryptography is the lack of effective protected theory
and simple achievable method. The most important aim of the research of DNA cryptography is
explore peculiarity of DNA molecule and reaction, establish corresponding theory, discovering
possible development directions, searching for simple methods of understand DNA cryptography,
and Laing the basis for future development. DNA cryptography uses DNA as the computational
tool along with several molecular techniques to manipulate it. Due to very high storage capacity of DNA, this field is becoming very talented. Presently it is in the development phase and it requires a lot of work and research to reach a established stage. By reviewing all the prospective and acerbic edge technology of current research, this paper shows the guidelines that need to be deal with development in the field of DNA cryptography.
SOM-PAD: Novel Data Security Algorithm on Self Organizing Map cscpconf
Data security is one of major challenges in the recent literature. Cryptography is the most
common phenomena used to secure data. One main aspect in cryptography is creating a hard to
guess cipher. Artificial Neural Networks (ANN) is one of the machine learning techniques
widely employed in several fields based on its characters, depending on the application area.
One of these fields is data security. The state of art in this paper is the use of self organizing
map (SOM) algorithm concept as a core idea to construct a pad; this pad is used to generate the
cipher at one end. At the other end of communication the same process is synchronized to
generate the same pad as the deciphering key. The security of the proposed model depends on
the complex nature of ANN's. The algorithm could be categorized under symmetric
cryptography, merging both stream and block cipher. A modified version of the same algorithm
also presented employs permutation and variable SOM neighborhoods. The proposal can be
applied over several file formats like videos, images, text files, data benchmarks, etc as show in
experimental results
IJERA (International journal of Engineering Research and Applications) is International online, ... peer reviewed journal. For more detail or submit your article, please visit www.ijera.com
A NOVEL IMAGE ENCRYPTION SCHEME WITH HUFFMAN ENCODING AND STEGANOGRAPHY TECHN...IJNSA Journal
In today’s day and age when everything is done with the aid of computing technology, the need for confidential communication has drastically increased. Not only the sensitive data such as top intelligent secrets of our nation but personal information of common people needs to be secure. Several combinations of cryptography and steganography techniques in different ways are used by researchers over the past to protect the data being transmitted. Cryptography uses mathematical algorithms to convert the data into an incomprehensible form and Steganography, on the other hand hides the data in a carrier such as image, data, audio or video. Cryptography provides necessary mechanisms for providing accountability, accuracy and confidentiality in public communication mediums such as the Internet and steganography is used in other fields such as copyright, preventing e-document forging etc. We are of the opinion that this security mechanism can further be increased by incorporating the use of Huffman coding in order to reduce the data length. This paper is an effort in the direction to hide, secure and compress the data. It explains the executed procedure by applying various encryption techniques one by one and our aim is to get the best security out of the existing ones. The proposed technique is implemented in MATLAB2016a and the results shown in this paper that our technique is better approach then the conventional techniques.
A NOVEL DNA ENCRYPTION SYSTEM USING CELLULAR AUTOMATAijsptm
DNA Cryptography is a new born cryptographic field emerged with the research of DNA Computing in which DNA is used as an Information carrier. Cellular automata is dynamic in nature so it provide dynamic behavior in the system which may increase the security in the system. DNA cryptography is
provide a secure way to encrypt the text and automata changes the state of the system based on the present
state, it will occur in discrete time. These qualities are most impressive in these techonology which help us to provide a highly secured security system for the users. Most of the encryption techniques based on the cellular automata have limitations. To overcome this lacuna, we propose a novel DNA cryptography algorithm with cellular automata to achieve randomness, parallelism, uniformity, reversibility and stable.
An algorithm implemented and its results obtained are depicts here, and a result analysis is done with other algorithms.
SOM-PAD: Novel Data Security Algorithm on Self Organizing Map cscpconf
Data security is one of major challenges in the recent literature. Cryptography is the most
common phenomena used to secure data. One main aspect in cryptography is creating a hard to
guess cipher. Artificial Neural Networks (ANN) is one of the machine learning techniques
widely employed in several fields based on its characters, depending on the application area.
One of these fields is data security. The state of art in this paper is the use of self organizing
map (SOM) algorithm concept as a core idea to construct a pad; this pad is used to generate the
cipher at one end. At the other end of communication the same process is synchronized to
generate the same pad as the deciphering key. The security of the proposed model depends on
the complex nature of ANN's. The algorithm could be categorized under symmetric
cryptography, merging both stream and block cipher. A modified version of the same algorithm
also presented employs permutation and variable SOM neighborhoods. The proposal can be
applied over several file formats like videos, images, text files, data benchmarks, etc as show in
experimental results
IJERA (International journal of Engineering Research and Applications) is International online, ... peer reviewed journal. For more detail or submit your article, please visit www.ijera.com
A NOVEL IMAGE ENCRYPTION SCHEME WITH HUFFMAN ENCODING AND STEGANOGRAPHY TECHN...IJNSA Journal
In today’s day and age when everything is done with the aid of computing technology, the need for confidential communication has drastically increased. Not only the sensitive data such as top intelligent secrets of our nation but personal information of common people needs to be secure. Several combinations of cryptography and steganography techniques in different ways are used by researchers over the past to protect the data being transmitted. Cryptography uses mathematical algorithms to convert the data into an incomprehensible form and Steganography, on the other hand hides the data in a carrier such as image, data, audio or video. Cryptography provides necessary mechanisms for providing accountability, accuracy and confidentiality in public communication mediums such as the Internet and steganography is used in other fields such as copyright, preventing e-document forging etc. We are of the opinion that this security mechanism can further be increased by incorporating the use of Huffman coding in order to reduce the data length. This paper is an effort in the direction to hide, secure and compress the data. It explains the executed procedure by applying various encryption techniques one by one and our aim is to get the best security out of the existing ones. The proposed technique is implemented in MATLAB2016a and the results shown in this paper that our technique is better approach then the conventional techniques.
A NOVEL DNA ENCRYPTION SYSTEM USING CELLULAR AUTOMATAijsptm
DNA Cryptography is a new born cryptographic field emerged with the research of DNA Computing in which DNA is used as an Information carrier. Cellular automata is dynamic in nature so it provide dynamic behavior in the system which may increase the security in the system. DNA cryptography is
provide a secure way to encrypt the text and automata changes the state of the system based on the present
state, it will occur in discrete time. These qualities are most impressive in these techonology which help us to provide a highly secured security system for the users. Most of the encryption techniques based on the cellular automata have limitations. To overcome this lacuna, we propose a novel DNA cryptography algorithm with cellular automata to achieve randomness, parallelism, uniformity, reversibility and stable.
An algorithm implemented and its results obtained are depicts here, and a result analysis is done with other algorithms.
A SECURE DNA CRYPTOSYSTEM BASED ON STEGANOGRAPHY AND INDEXING CIPHERIJNSA Journal
One of the essential challenges nowadays; is how to secure data with the increase of its volume as well as its transmission rate. The most frequent approach used to give a high degree of protection, preserve data from hackers, and accomplish multilayer security is steganography combined with encryption. DNA (Deoxyribonucleic Acid) is considered as a new promising carrier for data security while achieving powerful security and maximum protection. In this paper, a secure DNA cryptosystem model which combines steganography with encryption is introduced and categorized into two layers. The original data are hidden in the first layer into a reference DNA based on the insertion method to obtain a fake DNA sequence. In the second layer, this fake DNA sequence, which is the first layer's output, is encrypted using an indexing cipher to produce an encrypted message in the form of indexes. The proposed model guarantees multilayer security to the secret data with high performance and low-time wasting. It addresses the long-generation key problem of the DNA cryptography. The experimental results assess and validate the theoretical security analysis and model performance.
DNA Encryption Algorithms: Scope and Challenges in Symmetric Key CryptographyAM Publications
Data security is now a crucial issue now in our day to day life. The protection of personal identity, personal finances depend on the protection of important and irreplaceable information. Cryptography is the science of converting some readable information into something unreadable format, which are hard to decipher. In modern times, cryptography has adopted a new medium: human DNA. At a time when conventional cryptography has been losing strength to more advanced cryptanalysis, DNA cryptography has added more elements of confusion and diffusion. The use of DNA sequences to encrypt data has strengthened the existing classical encryption algorithms. Thus, DNA cryptography has added another dimension to conventional cryptography. In the present paper the authors have made a systematics study on DNA encryption algorithms and how it can be used along with standard classical encryption algorithms.
A brief over overview of steganographical security techniques and how it has been applied, is applied and will continue to be applied in maintaining confidentiality between two communication parties
Neural Cryptography for Secret Key ExchangeIJMTST Journal
The goal of any cryptography system is the exchange of information among the intended user without any leakage of information to other who may have unauthorized access to it. A common secret key could be created over a public channel accessible to any opponent. Neural networks can be used to generate common secret key. In case of neural cryptography, both the communicating networks receive an identical input vector, generate an output bit and are trained based on the output bit. The two networks and their weights vectors exhibit a new phenomenon, where the networks synchronize to a state with identical time-dependent weights. The generated secret key over a public channel is used for encryption and decryption of the message or information send over the channel.
A Literature Review of Some Modern RSA Variantsijsrd.com
RSA cryptosystem is the most commonly used public key cryptosystem. It is the first public key cryptosystem. The strength of this cryptosystem is based on the larger key size. There are many algorithms and variants of RSA. But, it is steal a burning topic of research. Because the thrust to store data secret is never going to end. In this paper, we have proposed a literature review of some modern variants of the RSA algorithm. All the algorithms have been analyzed. Their merits and demerits are also discussed.
SECURED TEXT MESSAGE TRANSMISSION IN A WIRELESS COMMUNICATION SYSTEM WITH THE...caijjournal
A broad variety of wireless data applications and services depend on security. This paper presents a
simulation-based study of a wireless communication system using a secured Vigenere cipher and the RSA
cryptographic algorithms on text message transmission. The system under consideration uses 1/2-rated
CRC channel coding and BPSK digital modulation over an Additive White Gaussian noise (AWGN)
channel. To address security concerns, a text message is encrypted at the transmitter with the Vigenere
cipher and RSA before being decrypted and compared for different levels of SNR at the receiver end. To
carry out the computer simulation, the Matlab 2016a programming language has been used. The
transmitted text message is successfully retrieved at the receiver end after the Vigenere cipher and the RSA
cryptographic algorithm are implemented. It is also anticipated that as noise power increases, the
effectiveness of a wireless communication system based on the Vigenere cipher and RSA security will
decrease.
Enhanced Level of Security using DNA Computing Technique with Hyperelliptic C...IDES Editor
Hyperelliptic Curve Cryptography (HECC) is a Public
Key Cryptographic technique which is required for secure
transmission. HECC is better than the existing public key
cryptography technique such as RSA, DSA, AES and ECC in
terms of smaller key size. DNA cryptography is a next
generation security mechanism, storing almost a million
gigabytes of data inside DNA strands. Existing DNA based
Elliptic Curve Cryptographic technique require larger key
size to encrypt and decrypt the message resulting in increased
processing time, more computational and memory overhead.
To overcome the above limitations, DNA strands are used to
encode the data to provide first level of security and HECC
encryption algorithm is used for providing second level of
security. Hence this proposed integration of DNA computing
based HECC provides higher level of security with less
computational and memory overhead.
Review on Encrypted Image with Hidden Data Using AES AlgorithmEECJOURNAL
Steganography is the art of hiding the fact where communication is taking place, by hiding information in other information. Steganography becomes more important as more people join the cyberspace revolution. . In contrast to cryptography, it is not to keep others from knowing the hidden information but it is to keep others from thinking that the information even exists. Steganography include an array of secret communication methods that hide the message from being seen or discovered. Many different carrier file formats can be used, but digital images are the most popular because of their frequency on the internet. For hiding secret information in images, there exists a large variety of steganography techniques some are more complex than others and all of them have respective strong and weak points. Different applications may require absolute invisibility of the secret information, while others require a large secret message to be hidden. This project report intends to give an overview of image steganography, its uses and techniques. In addition to this our project also adds security to both the data hidden and the image that carries the information. Security is provided by Encrypting the data that is sent in the image and again encrypting the image that carries the information using AES algorithm. This encryption of the data and image thus provides double security layer.
Adaptive Steganography Based Enhanced Cipher Hiding Technique for Secure Data...iosrjce
IOSR Journal of Computer Engineering (IOSR-JCE) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of computer engineering and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications in computer technology. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A New Approach of Cryptographic Technique Using Simple ECC & ECFIJAEMSJORNAL
Cryptography is the technique in which usually a file is converted into unreadable format by using public key and private key system called as public key cryptosystem. Then as per the user requirement that file is send to another user for secure data transmission. In this paper we purposed an image based cryptography that Elliptic Curve Function (ECF) techniques and pseudo random encoding technique on images to enhance the security of RFID communication. In the ECF approach, the basic idea is to replace the Elliptic Curve Function (ECF) of the cover image with the Bits of the messages to be hidden without destroying the property of the cover image significantly. The ECF based technique is the most challenging one as it is difficult to differentiate between the cover object and Crypto object if few ECF bits of the cover object are replaced. In Pseudo Random technique, a random key is used as seed for the Pseudo Random Number Generator in needed in the embedding process. Both the techniques used a Crypto key while embedding messages inside the cover image. By using the key, the chance of getting attacked by the attacker is reduced.
A Study of Various Steganographic Techniques Used for Information Hidingijcses
The art of information hiding has received much attention in the recent years as security of information has
become a big concern in this internet era. As sharing of sensitive information via a common communication
channel has become inevitable, Steganography – the art and science of hiding information has gained
much attention. We are also surrounded by a world of secret communication, where people of all types are
transmitting information as innocent as an encrypted credit card number to an online-store and as
insidious as a terrorist plot to hijackers. Steganography derives from the Greek word steganos, meaning
covered or secret, and graphy (writing or drawing) [1]. Steganography is a technology where modern data
compression, information theory, spread spectrum, and cryptography technologies are brought together to
satisfy the need for privacy on the Internet. This paper is an attempt to analyse the various techniques used
in steganography and to identify areas in which this technique can be applied, so that the human race can
be benefited at large.
Two level data security using steganography and 2 d cellular automataeSAT Publishing House
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology
A SECURE DNA CRYPTOSYSTEM BASED ON STEGANOGRAPHY AND INDEXING CIPHERIJNSA Journal
One of the essential challenges nowadays; is how to secure data with the increase of its volume as well as its transmission rate. The most frequent approach used to give a high degree of protection, preserve data from hackers, and accomplish multilayer security is steganography combined with encryption. DNA (Deoxyribonucleic Acid) is considered as a new promising carrier for data security while achieving powerful security and maximum protection. In this paper, a secure DNA cryptosystem model which combines steganography with encryption is introduced and categorized into two layers. The original data are hidden in the first layer into a reference DNA based on the insertion method to obtain a fake DNA sequence. In the second layer, this fake DNA sequence, which is the first layer's output, is encrypted using an indexing cipher to produce an encrypted message in the form of indexes. The proposed model guarantees multilayer security to the secret data with high performance and low-time wasting. It addresses the long-generation key problem of the DNA cryptography. The experimental results assess and validate the theoretical security analysis and model performance.
DNA Encryption Algorithms: Scope and Challenges in Symmetric Key CryptographyAM Publications
Data security is now a crucial issue now in our day to day life. The protection of personal identity, personal finances depend on the protection of important and irreplaceable information. Cryptography is the science of converting some readable information into something unreadable format, which are hard to decipher. In modern times, cryptography has adopted a new medium: human DNA. At a time when conventional cryptography has been losing strength to more advanced cryptanalysis, DNA cryptography has added more elements of confusion and diffusion. The use of DNA sequences to encrypt data has strengthened the existing classical encryption algorithms. Thus, DNA cryptography has added another dimension to conventional cryptography. In the present paper the authors have made a systematics study on DNA encryption algorithms and how it can be used along with standard classical encryption algorithms.
A brief over overview of steganographical security techniques and how it has been applied, is applied and will continue to be applied in maintaining confidentiality between two communication parties
Neural Cryptography for Secret Key ExchangeIJMTST Journal
The goal of any cryptography system is the exchange of information among the intended user without any leakage of information to other who may have unauthorized access to it. A common secret key could be created over a public channel accessible to any opponent. Neural networks can be used to generate common secret key. In case of neural cryptography, both the communicating networks receive an identical input vector, generate an output bit and are trained based on the output bit. The two networks and their weights vectors exhibit a new phenomenon, where the networks synchronize to a state with identical time-dependent weights. The generated secret key over a public channel is used for encryption and decryption of the message or information send over the channel.
A Literature Review of Some Modern RSA Variantsijsrd.com
RSA cryptosystem is the most commonly used public key cryptosystem. It is the first public key cryptosystem. The strength of this cryptosystem is based on the larger key size. There are many algorithms and variants of RSA. But, it is steal a burning topic of research. Because the thrust to store data secret is never going to end. In this paper, we have proposed a literature review of some modern variants of the RSA algorithm. All the algorithms have been analyzed. Their merits and demerits are also discussed.
SECURED TEXT MESSAGE TRANSMISSION IN A WIRELESS COMMUNICATION SYSTEM WITH THE...caijjournal
A broad variety of wireless data applications and services depend on security. This paper presents a
simulation-based study of a wireless communication system using a secured Vigenere cipher and the RSA
cryptographic algorithms on text message transmission. The system under consideration uses 1/2-rated
CRC channel coding and BPSK digital modulation over an Additive White Gaussian noise (AWGN)
channel. To address security concerns, a text message is encrypted at the transmitter with the Vigenere
cipher and RSA before being decrypted and compared for different levels of SNR at the receiver end. To
carry out the computer simulation, the Matlab 2016a programming language has been used. The
transmitted text message is successfully retrieved at the receiver end after the Vigenere cipher and the RSA
cryptographic algorithm are implemented. It is also anticipated that as noise power increases, the
effectiveness of a wireless communication system based on the Vigenere cipher and RSA security will
decrease.
Enhanced Level of Security using DNA Computing Technique with Hyperelliptic C...IDES Editor
Hyperelliptic Curve Cryptography (HECC) is a Public
Key Cryptographic technique which is required for secure
transmission. HECC is better than the existing public key
cryptography technique such as RSA, DSA, AES and ECC in
terms of smaller key size. DNA cryptography is a next
generation security mechanism, storing almost a million
gigabytes of data inside DNA strands. Existing DNA based
Elliptic Curve Cryptographic technique require larger key
size to encrypt and decrypt the message resulting in increased
processing time, more computational and memory overhead.
To overcome the above limitations, DNA strands are used to
encode the data to provide first level of security and HECC
encryption algorithm is used for providing second level of
security. Hence this proposed integration of DNA computing
based HECC provides higher level of security with less
computational and memory overhead.
Review on Encrypted Image with Hidden Data Using AES AlgorithmEECJOURNAL
Steganography is the art of hiding the fact where communication is taking place, by hiding information in other information. Steganography becomes more important as more people join the cyberspace revolution. . In contrast to cryptography, it is not to keep others from knowing the hidden information but it is to keep others from thinking that the information even exists. Steganography include an array of secret communication methods that hide the message from being seen or discovered. Many different carrier file formats can be used, but digital images are the most popular because of their frequency on the internet. For hiding secret information in images, there exists a large variety of steganography techniques some are more complex than others and all of them have respective strong and weak points. Different applications may require absolute invisibility of the secret information, while others require a large secret message to be hidden. This project report intends to give an overview of image steganography, its uses and techniques. In addition to this our project also adds security to both the data hidden and the image that carries the information. Security is provided by Encrypting the data that is sent in the image and again encrypting the image that carries the information using AES algorithm. This encryption of the data and image thus provides double security layer.
Adaptive Steganography Based Enhanced Cipher Hiding Technique for Secure Data...iosrjce
IOSR Journal of Computer Engineering (IOSR-JCE) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of computer engineering and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications in computer technology. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A New Approach of Cryptographic Technique Using Simple ECC & ECFIJAEMSJORNAL
Cryptography is the technique in which usually a file is converted into unreadable format by using public key and private key system called as public key cryptosystem. Then as per the user requirement that file is send to another user for secure data transmission. In this paper we purposed an image based cryptography that Elliptic Curve Function (ECF) techniques and pseudo random encoding technique on images to enhance the security of RFID communication. In the ECF approach, the basic idea is to replace the Elliptic Curve Function (ECF) of the cover image with the Bits of the messages to be hidden without destroying the property of the cover image significantly. The ECF based technique is the most challenging one as it is difficult to differentiate between the cover object and Crypto object if few ECF bits of the cover object are replaced. In Pseudo Random technique, a random key is used as seed for the Pseudo Random Number Generator in needed in the embedding process. Both the techniques used a Crypto key while embedding messages inside the cover image. By using the key, the chance of getting attacked by the attacker is reduced.
A Study of Various Steganographic Techniques Used for Information Hidingijcses
The art of information hiding has received much attention in the recent years as security of information has
become a big concern in this internet era. As sharing of sensitive information via a common communication
channel has become inevitable, Steganography – the art and science of hiding information has gained
much attention. We are also surrounded by a world of secret communication, where people of all types are
transmitting information as innocent as an encrypted credit card number to an online-store and as
insidious as a terrorist plot to hijackers. Steganography derives from the Greek word steganos, meaning
covered or secret, and graphy (writing or drawing) [1]. Steganography is a technology where modern data
compression, information theory, spread spectrum, and cryptography technologies are brought together to
satisfy the need for privacy on the Internet. This paper is an attempt to analyse the various techniques used
in steganography and to identify areas in which this technique can be applied, so that the human race can
be benefited at large.
Two level data security using steganography and 2 d cellular automataeSAT Publishing House
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology
A New Method for Encrypting Digital Data Using Symmetric Key in Information E...Editor IJCATR
with the arrival of the information age and much more important information systems and communication in human
everyday life, necessity immunization information and communication strategy were also raised. The easiest way to meet this
necessity is conventional encryption algorithms. Encryption is a right tool for data protection in an unsecure channel. To this end, from
two-method symmetric key encryption and public-key cryptography are used. In this paper we examine text cryptography, one of the
most important topics in cryptography. A unique attribute of this kind of encryption has been of interest to many researchers in this
field. This paper, considering the symmetric encryption algorithm, provides a text encryption algorithm using a 128-bit key. The
proposed algorithm uses a 128-bit key, the text data using the XOR operator to convert the encrypted information. Therefore, the aim
of this method is to provide a convenient method for symmetrically encrypting data not to be easily decoded, and finally, the results of
the tests show that the proposed method is better in terms of security and speed of execution
DATA SECURITY USING PRIVATE KEY ENCRYPTION SYSTEM BASED ON ARITHMETIC CODINGIJNSA Journal
Problem faced by today’s communicators is not only security but also the speed of communication and size of content.In the present paper, a scheme has been proposed which uses the concept of compression and data encryption. In first phase the focus has been made on data compression and cryptography. In the next phase we have emphasized on compression cryptosystem. Finally, proposed technique has been discussed which used the concept of data compression and encryption. In this first data is compressed to reduce the size of the data and increase the data transfer rate. Thereafter compress data is encrypted to provide security. Hence our proposed technique is effective that can reduce data size, increase data transfer rate and provide the security during communication.
International Journal of Computational Engineering Research(IJCER) ijceronline
International Journal of Computational Engineering Research (IJCER) is dedicated to protecting personal information and will make every reasonable effort to handle collected information appropriately. All information collected, as well as related requests, will be handled as carefully and efficiently as possible in accordance with IJCER standards for integrity and objectivity.
ARTIFICIAL NEURAL CRYPTOGRAPHY DATAGRAM HIDING TECHNIQUES FOR COMPUTER SECURI...IAEME Publication
Cryptography is the scientific study of mathematical and algorithmic techniques relating to information security. Cryptographic techniques will help to protect information in cases where an attacker can have physical access to the bits representing the information, ex. When the information has to be sent over a communication channel that can be eaves dropped on by an attacker. Cryptographic primitives are the basic building blocks for constructing cryptographic solutions to information protection problems. A cryptographic primitive consists of one or more algorithms that achieve a number of protection goals. There is no well-agreed upon complete list of cryptographic primitives, nor are all cryptographic primitives independent, it is often possible to realize one primitive using a combination of other primitives.
Secured Paillier Homomorphic Encryption Scheme Based on the Residue Number Sy...ijcisjournal
In this paper, we present an improved Paillier Cryptosystem for a secured data transmission based on the
Residue Number System (RNS). The current state of Paillier Cryptosystem allows the computation of the
plaintext from the cipher text without solving its security assumption of Decisional Composite Residuosity
or the knowledge of its private keys under mathematical attacks
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
Overview on Symmetric Key Encryption AlgorithmsIJERA Editor
In today’s digital communication era sharing of information is increasing significantly. The information being transmitted is vulnerable to various passive and active attacks. Therefore, the information security is one of the most challenging aspects of communication. Cryptography is the one of the main categories of computer security that converts information from its normal form into an unreadable form by using Encryption and Decryption Techniques. The two main characteristics that identify and differentiate one encryption algorithm from another are its ability to secure the protected data against attacks and its speed and efficiency in doing so. There are basically two techniques of cryptography Symmetric and Asymmetric. This paper presents a detailed study of the symmetric encryption techniques.
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology
FellowBuddy.com is an innovative platform that brings students together to share notes, exam papers, study guides, project reports and presentation for upcoming exams.
We connect Students who have an understanding of course material with Students who need help.
Benefits:-
# Students can catch up on notes they missed because of an absence.
# Underachievers can find peer developed notes that break down lecture and study material in a way that they can understand
# Students can earn better grades, save time and study effectively
Our Vision & Mission – Simplifying Students Life
Our Belief – “The great breakthrough in your life comes when you realize it, that you can learn anything you need to learn; to accomplish any goal that you have set for yourself. This means there are no limits on what you can be, have or do.”
Like Us - https://www.facebook.com/FellowBuddycom
ANALYSIS OF LAND SURFACE DEFORMATION GRADIENT BY DINSAR cscpconf
The progressive development of Synthetic Aperture Radar (SAR) systems diversify the exploitation of the generated images by these systems in different applications of geoscience. Detection and monitoring surface deformations, procreated by various phenomena had benefited from this evolution and had been realized by interferometry (InSAR) and differential interferometry (DInSAR) techniques. Nevertheless, spatial and temporal decorrelations of the interferometric couples used, limit strongly the precision of analysis results by these techniques. In this context, we propose, in this work, a methodological approach of surface deformation detection and analysis by differential interferograms to show the limits of this technique according to noise quality and level. The detectability model is generated from the deformation signatures, by simulating a linear fault merged to the images couples of ERS1 / ERS2 sensors acquired in a region of the Algerian south.
4D AUTOMATIC LIP-READING FOR SPEAKER'S FACE IDENTIFCATIONcscpconf
A novel based a trajectory-guided, concatenating approach for synthesizing high-quality image real sample renders video is proposed . The lips reading automated is seeking for modeled the closest real image sample sequence preserve in the library under the data video to the HMM predicted trajectory. The object trajectory is modeled obtained by projecting the face patterns into an KDA feature space is estimated. The approach for speaker's face identification by using synthesise the identity surface of a subject face from a small sample of patterns which sparsely each the view sphere. An KDA algorithm use to the Lip-reading image is discrimination, after that work consisted of in the low dimensional for the fundamental lip features vector is reduced by using the 2D-DCT.The mouth of the set area dimensionality is ordered by a normally reduction base on the PCA to obtain the Eigen lips approach, their proposed approach by[33]. The subjective performance results of the cost function under the automatic lips reading modeled , which wasn’t illustrate the superior performance of the
method.
MOVING FROM WATERFALL TO AGILE PROCESS IN SOFTWARE ENGINEERING CAPSTONE PROJE...cscpconf
Universities offer software engineering capstone course to simulate a real world-working environment in which students can work in a team for a fixed period to deliver a quality product. The objective of the paper is to report on our experience in moving from Waterfall process to Agile process in conducting the software engineering capstone project. We present the capstone course designs for both Waterfall driven and Agile driven methodologies that highlight the structure, deliverables and assessment plans.To evaluate the improvement, we conducted a survey for two different sections taught by two different instructors to evaluate students’ experience in moving from traditional Waterfall model to Agile like process. Twentyeight students filled the survey. The survey consisted of eight multiple-choice questions and an open-ended question to collect feedback from students. The survey results show that students were able to attain hands one experience, which simulate a real world-working environment. The results also show that the Agile approach helped students to have overall better design and avoid mistakes they have made in the initial design completed in of the first phase of the capstone project. In addition, they were able to decide on their team capabilities, training needs and thus learn the required technologies earlier which is reflected on the final product quality
PROMOTING STUDENT ENGAGEMENT USING SOCIAL MEDIA TECHNOLOGIEScscpconf
Using social media in education provides learners with an informal way for communication. Informal communication tends to remove barriers and hence promotes student engagement. This paper presents our experience in using three different social media technologies in teaching software project management course. We conducted different surveys at the end of every semester to evaluate students’ satisfaction and engagement. Results show that using social media enhances students’ engagement and satisfaction. However, familiarity with the tool is an important factor for student satisfaction.
A SURVEY ON QUESTION ANSWERING SYSTEMS: THE ADVANCES OF FUZZY LOGICcscpconf
In real world computing environment with using a computer to answer questions has been a human dream since the beginning of the digital era, Question-answering systems are referred to as intelligent systems, that can be used to provide responses for the questions being asked by the user based on certain facts or rules stored in the knowledge base it can generate answers of questions asked in natural , and the first main idea of fuzzy logic was to working on the problem of computer understanding of natural language, so this survey paper provides an overview on what Question-Answering is and its system architecture and the possible relationship and
different with fuzzy logic, as well as the previous related research with respect to approaches that were followed. At the end, the survey provides an analytical discussion of the proposed QA models, along or combined with fuzzy logic and their main contributions and limitations.
DYNAMIC PHONE WARPING – A METHOD TO MEASURE THE DISTANCE BETWEEN PRONUNCIATIONS cscpconf
Human beings generate different speech waveforms while speaking the same word at different times. Also, different human beings have different accents and generate significantly varying speech waveforms for the same word. There is a need to measure the distances between various words which facilitate preparation of pronunciation dictionaries. A new algorithm called Dynamic Phone Warping (DPW) is presented in this paper. It uses dynamic programming technique for global alignment and shortest distance measurements. The DPW algorithm can be used to enhance the pronunciation dictionaries of the well-known languages like English or to build pronunciation dictionaries to the less known sparse languages. The precision measurement experiments show 88.9% accuracy.
INTELLIGENT ELECTRONIC ASSESSMENT FOR SUBJECTIVE EXAMS cscpconf
In education, the use of electronic (E) examination systems is not a novel idea, as Eexamination systems have been used to conduct objective assessments for the last few years. This research deals with randomly designed E-examinations and proposes an E-assessment system that can be used for subjective questions. This system assesses answers to subjective questions by finding a matching ratio for the keywords in instructor and student answers. The matching ratio is achieved based on semantic and document similarity. The assessment system is composed of four modules: preprocessing, keyword expansion, matching, and grading. A survey and case study were used in the research design to validate the proposed system. The examination assessment system will help instructors to save time, costs, and resources, while increasing efficiency and improving the productivity of exam setting and assessments.
TWO DISCRETE BINARY VERSIONS OF AFRICAN BUFFALO OPTIMIZATION METAHEURISTICcscpconf
African Buffalo Optimization (ABO) is one of the most recent swarms intelligence based metaheuristics. ABO algorithm is inspired by the buffalo’s behavior and lifestyle. Unfortunately, the standard ABO algorithm is proposed only for continuous optimization problems. In this paper, the authors propose two discrete binary ABO algorithms to deal with binary optimization problems. In the first version (called SBABO) they use the sigmoid function and probability model to generate binary solutions. In the second version (called LBABO) they use some logical operator to operate the binary solutions. Computational results on two knapsack problems (KP and MKP) instances show the effectiveness of the proposed algorithm and their ability to achieve good and promising solutions.
DETECTION OF ALGORITHMICALLY GENERATED MALICIOUS DOMAINcscpconf
In recent years, many malware writers have relied on Dynamic Domain Name Services (DDNS) to maintain their Command and Control (C&C) network infrastructure to ensure a persistence presence on a compromised host. Amongst the various DDNS techniques, Domain Generation Algorithm (DGA) is often perceived as the most difficult to detect using traditional methods. This paper presents an approach for detecting DGA using frequency analysis of the character distribution and the weighted scores of the domain names. The approach’s feasibility is demonstrated using a range of legitimate domains and a number of malicious algorithmicallygenerated domain names. Findings from this study show that domain names made up of English characters “a-z” achieving a weighted score of < 45 are often associated with DGA. When a weighted score of < 45 is applied to the Alexa one million list of domain names, only 15% of the domain names were treated as non-human generated.
GLOBAL MUSIC ASSET ASSURANCE DIGITAL CURRENCY: A DRM SOLUTION FOR STREAMING C...cscpconf
The amount of piracy in the streaming digital content in general and the music industry in specific is posing a real challenge to digital content owners. This paper presents a DRM solution to monetizing, tracking and controlling online streaming content cross platforms for IP enabled devices. The paper benefits from the current advances in Blockchain and cryptocurrencies. Specifically, the paper presents a Global Music Asset Assurance (GoMAA) digital currency and presents the iMediaStreams Blockchain to enable the secure dissemination and tracking of the streamed content. The proposed solution provides the data owner the ability to control the flow of information even after it has been released by creating a secure, selfinstalled, cross platform reader located on the digital content file header. The proposed system provides the content owners’ options to manage their digital information (audio, video, speech, etc.), including the tracking of the most consumed segments, once it is release. The system benefits from token distribution between the content owner (Music Bands), the content distributer (Online Radio Stations) and the content consumer(Fans) on the system blockchain.
IMPORTANCE OF VERB SUFFIX MAPPING IN DISCOURSE TRANSLATION SYSTEMcscpconf
This paper discusses the importance of verb suffix mapping in Discourse translation system. In
discourse translation, the crucial step is Anaphora resolution and generation. In Anaphora
resolution, cohesion links like pronouns are identified between portions of text. These binders
make the text cohesive by referring to nouns appearing in the previous sentences or nouns
appearing in sentences after them. In Machine Translation systems, to convert the source
language sentences into meaningful target language sentences the verb suffixes should be
changed as per the cohesion links identified. This step of translation process is emphasized in
the present paper. Specifically, the discussion is on how the verbs change according to the
subjects and anaphors. To explain the concept, English is used as the source language (SL) and
an Indian language Telugu is used as Target language (TL)
EXACT SOLUTIONS OF A FAMILY OF HIGHER-DIMENSIONAL SPACE-TIME FRACTIONAL KDV-T...cscpconf
In this paper, based on the definition of conformable fractional derivative, the functional
variable method (FVM) is proposed to seek the exact traveling wave solutions of two higherdimensional
space-time fractional KdV-type equations in mathematical physics, namely the
(3+1)-dimensional space–time fractional Zakharov-Kuznetsov (ZK) equation and the (2+1)-
dimensional space–time fractional Generalized Zakharov-Kuznetsov-Benjamin-Bona-Mahony
(GZK-BBM) equation. Some new solutions are procured and depicted. These solutions, which
contain kink-shaped, singular kink, bell-shaped soliton, singular soliton and periodic wave
solutions, have many potential applications in mathematical physics and engineering. The
simplicity and reliability of the proposed method is verified.
AUTOMATED PENETRATION TESTING: AN OVERVIEWcscpconf
The using of information technology resources is rapidly increasing in organizations,
businesses, and even governments, that led to arise various attacks, and vulnerabilities in the
field. All resources make it a must to do frequently a penetration test (PT) for the environment
and see what can the attacker gain and what is the current environment's vulnerabilities. This
paper reviews some of the automated penetration testing techniques and presents its
enhancement over the traditional manual approaches. To the best of our knowledge, it is the
first research that takes into consideration the concept of penetration testing and the standards
in the area.This research tackles the comparison between the manual and automated
penetration testing, the main tools used in penetration testing. Additionally, compares between
some methodologies used to build an automated penetration testing platform.
CLASSIFICATION OF ALZHEIMER USING fMRI DATA AND BRAIN NETWORKcscpconf
Since the mid of 1990s, functional connectivity study using fMRI (fcMRI) has drawn increasing
attention of neuroscientists and computer scientists, since it opens a new window to explore
functional network of human brain with relatively high resolution. BOLD technique provides
almost accurate state of brain. Past researches prove that neuro diseases damage the brain
network interaction, protein- protein interaction and gene-gene interaction. A number of
neurological research paper also analyse the relationship among damaged part. By
computational method especially machine learning technique we can show such classifications.
In this paper we used OASIS fMRI dataset affected with Alzheimer’s disease and normal
patient’s dataset. After proper processing the fMRI data we use the processed data to form
classifier models using SVM (Support Vector Machine), KNN (K- nearest neighbour) & Naïve
Bayes. We also compare the accuracy of our proposed method with existing methods. In future,
we will other combinations of methods for better accuracy.
VALIDATION METHOD OF FUZZY ASSOCIATION RULES BASED ON FUZZY FORMAL CONCEPT AN...cscpconf
In order to treat and analyze real datasets, fuzzy association rules have been proposed. Several
algorithms have been introduced to extract these rules. However, these algorithms suffer from
the problems of utility, redundancy and large number of extracted fuzzy association rules. The
expert will then be confronted with this huge amount of fuzzy association rules. The task of
validation becomes fastidious. In order to solve these problems, we propose a new validation
method. Our method is based on three steps. (i) We extract a generic base of non redundant
fuzzy association rules by applying EFAR-PN algorithm based on fuzzy formal concept analysis.
(ii) we categorize extracted rules into groups and (iii) we evaluate the relevance of these rules
using structural equation model.
PROBABILITY BASED CLUSTER EXPANSION OVERSAMPLING TECHNIQUE FOR IMBALANCED DATAcscpconf
In many applications of data mining, class imbalance is noticed when examples in one class are
overrepresented. Traditional classifiers result in poor accuracy of the minority class due to the
class imbalance. Further, the presence of within class imbalance where classes are composed of
multiple sub-concepts with different number of examples also affect the performance of
classifier. In this paper, we propose an oversampling technique that handles between class and
within class imbalance simultaneously and also takes into consideration the generalization
ability in data space. The proposed method is based on two steps- performing Model Based
Clustering with respect to classes to identify the sub-concepts; and then computing the
separating hyperplane based on equal posterior probability between the classes. The proposed
method is tested on 10 publicly available data sets and the result shows that the proposed
method is statistically superior to other existing oversampling methods.
CHARACTER AND IMAGE RECOGNITION FOR DATA CATALOGING IN ECOLOGICAL RESEARCHcscpconf
Data collection is an essential, but manpower intensive procedure in ecological research. An
algorithm was developed by the author which incorporated two important computer vision
techniques to automate data cataloging for butterfly measurements. Optical Character
Recognition is used for character recognition and Contour Detection is used for imageprocessing.
Proper pre-processing is first done on the images to improve accuracy. Although
there are limitations to Tesseract’s detection of certain fonts, overall, it can successfully identify
words of basic fonts. Contour detection is an advanced technique that can be utilized to
measure an image. Shapes and mathematical calculations are crucial in determining the precise
location of the points on which to draw the body and forewing lines of the butterfly. Overall,
92% accuracy were achieved by the program for the set of butterflies measured.
SOCIAL MEDIA ANALYTICS FOR SENTIMENT ANALYSIS AND EVENT DETECTION IN SMART CI...cscpconf
Smart cities utilize Internet of Things (IoT) devices and sensors to enhance the quality of the city
services including energy, transportation, health, and much more. They generate massive
volumes of structured and unstructured data on a daily basis. Also, social networks, such as
Twitter, Facebook, and Google+, are becoming a new source of real-time information in smart
cities. Social network users are acting as social sensors. These datasets so large and complex
are difficult to manage with conventional data management tools and methods. To become
valuable, this massive amount of data, known as 'big data,' needs to be processed and
comprehended to hold the promise of supporting a broad range of urban and smart cities
functions, including among others transportation, water, and energy consumption, pollution
surveillance, and smart city governance. In this work, we investigate how social media analytics
help to analyze smart city data collected from various social media sources, such as Twitter and
Facebook, to detect various events taking place in a smart city and identify the importance of
events and concerns of citizens regarding some events. A case scenario analyses the opinions of
users concerning the traffic in three largest cities in the UAE
SOCIAL NETWORK HATE SPEECH DETECTION FOR AMHARIC LANGUAGEcscpconf
The anonymity of social networks makes it attractive for hate speech to mask their criminal
activities online posing a challenge to the world and in particular Ethiopia. With this everincreasing
volume of social media data, hate speech identification becomes a challenge in
aggravating conflict between citizens of nations. The high rate of production, has become
difficult to collect, store and analyze such big data using traditional detection methods. This
paper proposed the application of apache spark in hate speech detection to reduce the
challenges. Authors developed an apache spark based model to classify Amharic Facebook
posts and comments into hate and not hate. Authors employed Random forest and Naïve Bayes
for learning and Word2Vec and TF-IDF for feature selection. Tested by 10-fold crossvalidation,
the model based on word2vec embedding performed best with 79.83%accuracy. The
proposed method achieve a promising result with unique feature of spark for big data.
GENERAL REGRESSION NEURAL NETWORK BASED POS TAGGING FOR NEPALI TEXTcscpconf
This article presents Part of Speech tagging for Nepali text using General Regression Neural
Network (GRNN). The corpus is divided into two parts viz. training and testing. The network is
trained and validated on both training and testing data. It is observed that 96.13% words are
correctly being tagged on training set whereas 74.38% words are tagged correctly on testing
data set using GRNN. The result is compared with the traditional Viterbi algorithm based on
Hidden Markov Model. Viterbi algorithm yields 97.2% and 40% classification accuracies on
training and testing data sets respectively. GRNN based POS Tagger is more consistent than the
traditional Viterbi decoding technique.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
2. 162 Computer Science & Information Technology (CS & IT)
determined by one or more keys. Depending on the type of keys used, cryptographic systems may
be classified in:
a) Symmetric systems : use the same key to encrypt and decrypt data symmetric key
encryption algorithms (also called ciphers) process plain text with the secret key to create
encrypted data called cipher text are extremely fast and well suited for encrypting large quantities
of data. They are vulnerable when transmitting the key examples: DES, RC2, 3DES PBE
(password based encryption) algorithms are derived from symmetric algorithms; such algorithms
use a salt (random bytes) and a number of iterations to generate a key.
b) Asymmetric systems :Overcome symmetric encryption's most significant disability the
transmission of the symmetric key rely on key pairs (contains a public and a private key) the
public key can be freely shared because it cannot be easily abused,even by an attacker messages
encrypted with the public key can be decrypted only with the private key so, anyone can send
encrypted messages, but they can be decrypted by only 1 person are not as fast, but are much
more difficult to break common use: encrypt and transfer a symmetric key (used by HTTPS and
SSL) .
Symmetrical algorithms use the same key to encrypt and decrypt the data, while asymmetric
algorithms use a public key to encrypt the data and a private key to decrypt it. By keeping the
private key safe, you can assure that the data remains safe. The disadvantage of asymmetric
algorithms is that they are computationally intensive. Therefore, in security a combination of
asymmetric and symmetric algorithms is used. Another way of ensuring the security of a system
is to use a digitalsignature. The signature is applied to the whole document, so if the signature is
altered, the document becomes unreadable. In the future it is most likely that the computer
architecture and power will evolve. Such systems might drastically reduce the time needed to
compute a cryptographic key. As a result, security systems need to find new techniques to
transmit the data securely without relying on the existing pure mathematical methods. We
therefore use alternative security concepts. The major algorithms which are accepted as
alternative security are the elliptic, vocal, quantum and DNA encryption algorithms. Elliptic
algorithms are used for portable devices which have a limited processing power, use a simple
algebra and relatively small ciphers. The quantum cryptography is not a quantum encryption
algorithm but rather a method of creating and distributing private keys. It is based on the fact that
photons send towards a receiver changing irreversibly their state if they are intercepted. Quantum
cryptography was developed starting with the 70s in Universities from Geneva, Baltimore and
Los Alamos. In two protocols are described, BB84 and BB92, that, instead of using general
encryption and decryption techniques, verify if the key was intercepted. This is possible because
once a photon is duplicated, the others are immediately noticed. However, these techniques are
still vulnerable to the Man-in-the-Middle and DoS attack. DNA Cryptography is a new field
based on the researches in DNA computation and new technologies like: PCR (Polymerase Chain
Reaction), Microarray, etc. DNA computing has a high level computational ability and is capable
of storing huge amounts of data. A gram of DNA contains 1021 DNA bases, equivalent to 108
terabytes of data. In DNA cryptography we use existing biological information from DNA public
databases to encode the plaintext. The cryptographic process can make use of different methods.
In the one-time pads (OTP) algorithms are described, which is one of the most efficient security
algorithms, while in a method based on the DNA splicing technique is detailed. In the case of the
one-time pad algorithms, the plaintext is combined with a secret random key or pad which is used
only once. The pad is combined with the plaintext using a typical modular addition or an XOR
3. Computer Science & Information Technology (CS & IT) 163
operation, or another technique. In the case of the start codes and the pattern codes specify the
position of the introns, so they are no longer easy to find. However, to transmit the spliced key,
they make use of public-key secured channel. Additionally, we will describe an algorithm which
makes use of asymmetric cryptographic principles. The main idea is to avoid the usage of both
purely mathematical symmetric and asymmetric algorithms and to use an advanced asymmetric
algorithm based on DNA. The speed of the algorithm should be quite high because we make use
of the powerful parallel computing possibilities of the DNA. Also, the original asymmetric keys
are generated starting from a user password to avoid their storage.
Biological background
DNA is the abbreviation for deoxyribonucleic acid which is the germ plasma of all life styles.
DNA is a kind of biological macromolecule and is made of nucleotides. Each nucleotide contains
a single base and there are four kinds of bases, which are adenine (A) and thymine (T) or cytosine
(C) and guanine (G), corresponding to four kinds of nucleotides.
A single-stranded DNA is constructed with orientation: one end is called 5′, and the other end is
called 3′. Usually DNA exists as double-stranded molecules in nature. The two complementary
DNA strands are held together to form a doblehelix structure by hydrogen bonds between the
complementary bases of A and T (or C and G). The double-helix structure was discovered by
Watson and Crick; thus the complementary structure is called Watson Crick complementarity.
Their discovery is one of the greatest scientific discoveries of the 20th century and reduced
genetics to chemistry and laid the foundations for the next half century of biology.
DNA computing
The development of DNA cryptography benefits from the progress of DNA computing (also
called molecular computing or biological computing). On the one hand, cryptography always has
some relationship with the corresponding computing model more or less. On the other hand, some
biological technologies used in DNA computation are also used in DNA cryptography. For these
reasons, DNA computing is briefly introduced here.
4. 164 Computer Science & Information Technology (CS & IT)
In 1994, Adleman demonstrated the first DNA computing, which marked the beginning of a new
stage in the era of information. In the following researches, scientists find that the vast
parallelism, exceptional energy efficiency and extraordinary information density are inherent in
DNA molecules. In 2002, a team led by Adleman solved a 3-SAT problem with more than 1
million possibilities on a simple DNA computer after an exhaustive searching. In 2005,it is
declared that a team led by Ehud Keinan invented a bimolecular computer that used little more
than DNA and enzymes could perform a billion operations simultaneously. Adleman reviewed
DNA computing as follows: “For thousands of years, humans have tried to enhance their inherent
computational abilities using manufactured devices. Mechanical devices such as the abacus, the
adding machine, and the tabulating machine were important advances. But it was only with the
ad-vent of electronic devices and, in particular, the electronic computer some 60 years ago that a
qualitative threshold seems to have been passed and problems of considerable difficulty could be
solved. It appears that a molecular device has now been used to pass this qualitative threshold for
a second time. ”Scientists have also made progress in the theory of DNA computing and explored
several feasible computing models, such as the model used by Adleman in 1994. Here it is called
Hamiltonian path model, and the model based on DNA chipand the sticker model proposed by
Adleman.
2. USED TECHNOLOGIES
2.1. The Java Cryptography Architecture
The Security API (Application Programming Interface) is a core API of the Java programming
language, built around the java.securitypackage. This API is designed to allow developers to
incorporate both low-level and high-level security functionality into their programs. The Java
Cryptography Extension (JCE) extends the JCA API to include APIs for encryption, key
exchange, and Message Authentication Code (MAC). Together, the JCE and the cryptography
aspects of the SDK provide a complete, platform-independent cryptography API. JCE was
previously an optional package (extension) to the Java 2 SDK, Standard Edition, versions 1.2.x
and 1.3.x. JCE has been integrated into the Java 2 SDK, v 1.4. The Java Cryptography
Architecture (JCA) was designed around these principles: implementation independence and
interoperability; algorithm independence and extensibility. Implementation independence and
algorithm independence are complementary; when complete algorithm-independence is not
possible, the JCA provides standardized, algorithm-specific APIs. When implementation-
independence is not desirable, the JCA lets developers indicate a specific implementation. The
Java Cryptography Architecture introduced the notion of a Cryptographic Service Provider, or
simply provider. This term refers to a package (or a set of packages) that supply a concrete
implementation of a subset of the cryptography aspects of the Security API. It has methods for
accessing the provider name, version number, and other information. For each engine class in the
API (an engine class provides the interface to the functionality of a specific type of cryptographic
service, independent of a particular cryptographic algorithm), a particular implementation is
requested and instantiated by calling a getInstance() method on the engine class, specifying the
name of the desired algorithm and, optionally, the name of the provider (or the Provider class)
whose implementation is desired. If no provider is specified, getInstance() searches the registered
providers for an implementation of the requested cryptographic service associated with the named
algorithm. In any given Java Virtual Machine (JVM), providers are installed in a given preference
order, the order in which the provider list is searched if a specific provider is not requested. For
5. Computer Science & Information Technology (CS & IT) 165
example, suppose there are two providers installed in a JVM, PROVIDER_1 and PROVIDER_2.
From the core classes specified by the JCA a special attention will be drawn to the following
classes: The Security, Key Generator and the Cipher class.
a) The Security Class
The Security class manages installed providers and security-wide properties. It only contains
static methods and is never instantiated. The methods for adding or removing providers, and for
setting Security properties, can only be executed by a trusted program. Currently, a "trusted
program" is either a local application not running under a security manager, or an applet or
application with permission to execute the specified method (see below). The determination that
code is considered trusted to perform an attempted action (such as adding a provider) requires
that the applet is granted permission for that particular action.
b) The Key Generator Class
This class is used to generate secret keys for symmetric algorithms, necessary to encrypt the
plaintext. Key Generator objects are created using the getInstance() factory method of the Key
Generator class. getInstance() takes as its argument the name of the symmetric algorithm for
which the key was generated. Optionally, a package provider name may be specified: public static
KeyGeneratorgetInstance(String alg, String provider); There are two ways to generate a key:
algorithm-independent manner and algorithm-specific manner. In the algorithm-independent
manner, all key generators share the concepts of a key size and a source of randomness. In the
algorithm-specific manner, for situations where a set of algorithm specific parameters already
exists, there are two initmethods that have an AlgorithmParameterSpecargument: public void ini
(AlgorithmParameterSpecparams); public void init (AlgorithmParameterSpecparams,
SecureRandom random); In case the client does not explicitly initialize the KeyGenerator each
provider must supply a default initialization Wrapping a key enables secure transfer of the key
from one place to another, fact which can be used if one needs to send data over a media available
to more people like a network.
c) The Cipher Class
This class forms the core of the JCE framework. It establishes a link between the data, the
algorithm and the key used whether it is for encoding, decoding or wrapping. Cipher objects are
created using the getInstance() factory method of the Cipher class. public static Cipher
getInstance(String transformation,String provider); A Cipher object obtained via getInstance()
must be initialized for one of four modes: ENCRYPT_MODE = Encryption of data,
DECRYPT_MODE = Decryption of data, WRAP_MODE = Wrapping a Key into bytes so that
the key can be securely transported, UNWRAP_MODE = Unwrapping of a previously wrapped
key into a java.securityKey object.
2.2. General Aspects about Genetic Code
There are 4 nitrogenous bases used in making a strand of DNA. These are adenine (A), thymine
(T), cytosine (C) and guanine (G). These 4 bases (A, T, C and G) are used in a similar way to the
letters of an alphabet. The sequence of these DNA bases will code specific genetic information.
In our previous work we used a onetime pad, symmetric key cryptosystem. In the OTP algorithm,
6. 166 Computer Science & Information Technology (CS & IT)
each key is used just once, hence the name of OTP. The encryption process uses a large non-
repeating set of truly random key letters. Each pad is used exactly once, for exactly one message.
The sender encrypts the message and then destroys the used pad. As it is a symmetric key
cryptosystem, the receiver has an identical pad and uses it for decryption. The receiver destroys
the corresponding pad after decrypting the message. New message means new key letters. A
cipher text message is equally likely to correspond to any possible plaintext message.
Cryptosystems which use a secret random OTP are known to be perfectly secure. By using DNA
with common symmetric key cryptography, we can use the inherent massively-parallel computing
properties and storage capacity of DNA, in order to perform the encryption and decryption using
OTP keys. The resulting encryption algorithm which uses DNA medium is much more complex
than the one used by conventional encryption methods. To implement and exemplify the OTP
algorithm, we downloaded a chromosome from the open source NCBI GenBank. As stated, in
this algorithm the chromosomes are used as cryptographic keys. They have a small dimension
and a huge storage capability. There is a whole set of chromosomes, from different organisms
which can be used to create a unique set of cryptographic keys. In order to splice the genome, we
must know the order in which the bases are placed in the DNA string. The chosen chromosome
was “Homo sapiens FOSMID clone ABC24-1954N7 from chromosome 1”. Its length is high
enough for our purposes (37983 bases). GenBank offers different formats in which the
chromosomal sequences can be downloaded:
• GenBank,
• GenBank Full,
• FASTA,
• ASN.1.
We chose the FASTA format because it’s easier to handle and manipulate. To manipulate the
chromosomal sequences we used BioJava API methods, a framework for processing DNA
sequences. Another API which can be used for managing DNA sequences is offered by MatLab.
Using this API, a dedicated application has been implemented. In MatLab, the plaintext message
was first transformed in a bit array. An encryption unit was transformed into an 8 bit length
ASCII code. After that, using functions from the Bioinformatics Toolbox, each message was
transformed from binary to DNA alphabet. Each character was converted to a 4-letter DNA
sequence and then searched in the chromosomal sequence used as OTP.
2.3. BioJava API
The core of BioJava is actually a symbolic alphabet API. Here, sequences are represented as a list
of references to singleton symbol objects that are derived from an alphabet. The symbol list is
stored as often as possible. The list is compressed and uses up to four symbols per byte. Besides
the fundamental symbols of the alphabet (A, C, G and T as mentioned earlier), the BioJava
alphabets also contain extra symbol objects which represent all possible combinations of the four
fundamental symbols. The structure of the BioJava architecture together with its most important
APIs is presented below:
7. Computer Science & Information Technology (CS & IT) 167
Figure 1.The BioJava Architecture
By using the symbol approach, we can create higher order alphabets and symbols. This is
achieved by multiplying existing alphabets. In this way, a codon can be treated as nothing more
than just a higher level alphabet, which is very convenient in our case. With this alphabet, one can
create views over sequences without modifying the underlying sequence. In BioJava a typical
program starts by using the sequence input/output API and the sequence/feature object model.
These mechanisms allow the sequences to be loaded from a various number of file formats,
among which is FASTA, the one we used. The obtained results can be once more saved or
converted into a different format.
3. DNA CRYPTOGRAPHY IMPLEMENTATIONS
In this chapter we will start by presenting the initial Java implementation of the symmetric OTP
encryption algorithm. We will then continue by describing the corresponding BioJava (and
Matlab) implementation and some drawbacks of this symmetric algorithm.
3.1. Java Implementation
One approach of the DNA Cryptography is a DNA-based symmetric cryptographic algorithm.
This algorithm involves three steps: key generation, encryption and decryption. In fact,
theencryption process makes use of two classic cryptographic algorithms: the one-time pad, and
the substitution cipher. Due to the restrictions that limit the use of JCE, the algorithm was
developed using OpenJDK, which is based on the JDK 7.0 version of the Java platform and does
not enforce certificate verification. In order to generate random data we use the class
SecureRandomhousedin the java.securitypackage, class which is designed to generate
cryptographically secure random numbers. The next step is translating this key in DNA language
by limiting the range of numbers to [0, 3] and associating a letter to each number as following:
8. 168 Computer Science & Information Technology (CS & IT)
Table 1.Translation table
Number Corresponding letter
0 A
1 C
3 G
4 T
At this time is very important to know that the length of the key must be exactly the same as the
length of the plaintext. In this case, the plaintext is the secret message, translated according to the
substitution alphabet. Therefore, the length of the key is three times the length of the secret
message. The user may choose the length of the key, the only restriction being that this must be a
multiple of three. Because the key must have three times the length of the messages, when trying
to send very long messages, the length of the key would be huge. For this reason, the message is
broken into fixed-size blocks of data. The cipher encrypts or decrypts one block at a time, using a
key that has the same length as the block. The implementation of block ciphers raises an
interesting problem: the message we wish to encrypt will not always be a multiple of the block
size. To compensate for the last incomplete block, padding is needed. A padding scheme specifies
exactly how the last block of plaintext is filled with data before it is encrypted. A corresponding
procedure on the decryption side removes the padding and restores the plaintext's original length.
However, this DNA Cipher will not use a padding scheme but a shorter version (a fraction) of the
original key. The only mode of operation implemented by the DNA Cipher is ECB (Electronic
Code Book). This is the simplest mode, in which each block of plaintext encrypts to a block of
cipher text. ECB mode has the disadvantage that the same plaintext will always encrypt to the
same cipher text, when using the same key. As we mentioned, the DNA Cipher applies a double
encryption in order to secure the message we want to keep secret. The first encryption step uses a
substitution cipher. For applying the substitution cipher it was used a HashMap Object. HashMap
is a java.utilclass that implements the Map interface. These objects associate a specified value to
a specified unique key in the map. One possible approach is representing each character of the
secret message by a combination of 3 bases on DNA, as shown in the table below:
Table 2.The substitution alphabet
a-cga l - tgc w-ccg 3-gac
b-cca m –tcc x-cta 4-gag
c-gtt n - tct y-aaa 5-aga
d-ttg o-gga z-ctt 6-tta
e-ggc p-gtg _-ata 7-aca
f-ggt q-aac ,-tcg 8-agg
g-ttt r-tca .-gct 9-gcg
h-cgc s-acg :-gct Space-
ccc
i-atg t-ttc 0-act
j-agt u-ctg 1-acc
k-aag v-cct 2-tag
9. Computer Science & Information Technology (CS & IT) 169
Given the fact that this cipher replaces only lowercase characters with their corresponding triplet
and that in most messages we encounter also upper case letters, the algorithm first transforms all
the letters of the given secret message into lowercase letters. The result after applying the
substitution cipher is a string containing characters from the DNA alphabet (a, c, g, t). This will
further be transformed into a byte array, together with the key. The exclusive or operation (XOR)
is then applied to the key and the message in order to produce the encrypted message. When
decrypting an encrypted message, it is essential to have the key and the substitution alphabet.
While the substitution alphabet is known, being public, the key is kept secret and is given only to
the addressee. Any malicious third party won’t be able to decrypt the message without the
original key. The received message is XOR-ed with the secret key resulting a text in DNA
alphabet. This text is then broken into groups of three characters and with the help of the reverse
map each group will be replaced with the corresponding letter. The reverse map is the inverse of
the one used for translating the original message into a DNA message. This way the receiver is
able to read the original secret message.
3.2 BioJava Implementation
In this approach, we use more steps to obtain the DNA code starting from the plaintext. For each
character from the message we wish to encode, we first apply the get_bytes() method which
returns an 8bit ASCII string of the character we wish to encode. Further, we apply the
get_DNA_code() method which converts the obtained 8 bit string, corresponding to an ASCII
character, into DNA alphabet. The function returns a string which contains the DNA encoded
message. The get_DNA_code() method is the main method for converting the plaintext to DNA
encoded text. For each 2 bits from the initial 8 bit sequence, corresponding to an ASCII character,
a specific DNA character is assigned: 00 – A, 01 – C, 10 – G and 11 – T. Based on this process
we obtain a raw DNA message.
Table 3.DNA encryption test sequence
Plaintext message: „test”
ASCII message: 116 101 115
116
Raw DNA message:
„TCACGCCCTATCTCA”
The coded characters are searched in the chromosome chosen as session key at the beginning of
the communication. The raw DNA message is split into groups of 4 bases. When such a group is
found in the chromosome, its base index is stored in a vector. The search is made between the
first characters of the chromosome up to the 37983th. At each new iteration, a 4 base segment is
compared with the corresponding 4 base segment from the raw DNA message. So, each character
from the original string will have an index vector associated, where the chromosome locations of
that character are found. The get_index() method effectuates the parsing the comparison of the
chromosomal sequences and creates for each character an index vector. To parse the sequences in
the FASTA format specific BioJava API methods were used. BioJava offers us the possibility of
reading the FASTA sequences by using a FASTA stream which is obtained with the help of the
SeqIOTools class. We can pass through each of the sequences by using a SequenceIteratorobject.
These sequences are then loaded into an Sequence list of objects, from where they can be
accessed using the SequneceAt() method. In the last phase of the encryption, for each character of
10. 170 Computer Science & Information Technology (CS & IT)
the message, a random index from the vector index is chosen. We use the get_random() method
for this purpose. In this way, even if we would use the same key to encrypt a message, we would
obtain a different result because of the random indexes. Since the algorithm is a symmetric one,
for the decryption we use the same key as for encryption. Each index received from the encoded
message is actually pointing to a 4 base sequence, which is the equivalent of an ASCII character.
So, the decode() method realizes following operations: It will first extract the DNA 4 base
sequences from the received indexes. Then, it will convert the obtained raw DNA message into
the equivalent ASCII-coded message. From the ASCII coded message we finally obtain the
original plaintext. And with this, the decryption step is completed. The main vulnerability of this
algorithm is that, if the attacker intercepts the message, he can decode the message himself if he
knows the coding chromosomal sequence used as session key.
4. BIOJAVA ASYMMETRIC ALGORITHM DESCRIPTION
In this chapter we will present in detail an advanced method of obtaining DNAencoded messages.
It relies on the use of an asymmetric algorithm and on key generation starting from a user
password. We will also present a pseudo-code description of the algorithm.
4.1 Asymmetric Key Generation
Our first concern when it comes to asymmetric key algorithms was to develop a way in which the
user was no longer supposed to deal with key management authorities or with the safe storage of
keys. The reason behind this decision is fairly simple: both methods can be attacked. Fake
authorities can pretend to be real key-management authorities and intruders may breach the key
storage security. By intruders we mean both persons who have access to the computer and
hackers, which illegally accessed the computer. To address this problem, we designed an
asymmetric key generation algorithm starting from a password. The method has some similarities
with the RFC2898 symmetric key derivation algorithm. The key derivation algorithm is based on
a combination of hashes and the RSA algorithm. Below we present the basic steps of this
algorithm:
Step 1:First, the password string is converted to a byte array, hashed using SHA256 and then
transformed to BigInteger number. This number is transformed in an odd number, tmp, which is
further used to apply the RSA algorithm for key generation.
Step 2: Starting from tmpwe search for 2 random pseudo-prime number p and q. The relation
between tmp, p and q is simple: p <tmp<q. To spare the computational power of the device, we do
not compute traditionally if p and q are prime but make primarily tests. A primarily test
determines the probability according to which a number is prime. The sequence of the primarily
test is the following: First, trial divisions are carried out using prime numbers below 2000. If any
of the primes divides this Big Integer, then it is not prime.Second, we perform base 2 strong
pseudo-prime test. If this Big Integer is a base 2 strong pseudo-prime, we proceed on to the next
step. Last, we perform the strong Lucas pseudo-prime test. If everything goes well, it returns true
and we declare the number as being pseudo prime.
Step 3: Next, we determine Euler totient: phi = (p - 1) * (q - 1) ; and n = p*q;
11. Computer Science & Information Technology (CS & IT) 171
Step 4: Next, we determine the public exponent, e. The condition imposed to e is to be coprime
with phi.
Step 5: Next, we compute the private exponential, d and the CRT (Chinese Reminder Theorem)
factors: dp, dq and qInv.
Step 6: Finally, all computed values are written to a suitable structure, waiting further
processing.
• The public key is released as the public exponent, e together with n.
• The private key is released as the private exponent, d together with n and the CRT
factors. The scheme of this algorithm is presented below.
Figure 2. Asymmetric RSA compatible key generation
In comparison with the RFC2898 implementation, here we no longer use several iterations to
derive the key. This process has been shown to be time consuming and provide only little
extrasecurity. We therefore considered it safe to disregard it. The strength of the key-
generatoralgorithm is given by the large pseudoprime numbers it is using and of course, by the
asymmetric algorithm. Byusing primarily tests one can determine with a precision of 97 – 99%
that a number is prime. But most importantly, the primarily tests save time. So, the
averagecomputation time, including appropriate key export, for the whole algorithm is 143 ms.
After the generation process was completed, the public or private key can be retrieved using the
staticToXmlStringmethod.Next, we will illustrate the algorithm through a short example.Suppose
the user password is “DNACryptography”. Starting from this password, we compute its hash with
SHA256. The result is shown below. This hashed password is converted into the BigInteger
number tmp. Starting from it, and according to the algorithm described above, we generate the
public exponent e and the private exponent d.
12. 172 Computer Science & Information Technology (CS & IT)
Table 4.Asymmetric DNA encryption test sequence
We conducted several tests and the generated keys match the PKCS #5 specifications. Objects
could be instantiated with the generated keys and used with the normal system-build RSA.
4.2 Asymmetric DNA Algorithm
The asymmetric DNA algorithm proposes a mechanism which makes use of three encryption
technologies. In short, at the program initialization, both the initiator and its partner generate a
pair of asymmetric keys. Further, the initiator and its partner negotiate which symmetric
algorithms to use, its specifications and of course, the codon sequence where the indexes of the
DNA bases will be looked up. After this initial negotiation is completed, the communication
continues with normal message transfer. The normal message transfer supposes that the data is
symmetrically encoded, and that the key with which the data was encoded is asymmetrically
encoded and attached to the data. This approach was first presented in. Next, we will describe the
algorithm in more detail and also provide a pseudo-code description for a better understanding.
Step 1:At the startup of the program, the user is asked to provide a password phrase. The
password phrase can be as long or as complicated as the user sees fit. The password phrase will
be further hashed with SHA256.
Step 2:According to the algorithm described in section 4.1, the public and private asymmetric
keys will be generated. Since the pseudo-prime numbers p and q are randomly chosen, even if the
user provides the same password for more sessions, the asymmetric keys will be different.
user password: “DNACryptography”
hashed password:
“ed38f5aa72c3843883c26c701dfce03
e0d5d6a8d”
tmp=
84597941392863984558746916592571
6582498797231629929694
46756202517881375676359726620829
8952112229
e =
1063
d =
62209727183718300693145403344094
08504766864571798543078
20679318486461619300337870725234
79660987299191525204542
43274292026224722073876853783177
36890998257538720690765
466158123868118572427782935
13. Computer Science & Information Technology (CS & IT) 173
Step 3:The initiator selects which symmetric algorithms will be used in the case of normal
message transfer. He can choose between 3DES, AES and IDEA. Further, he selects the time
after which the symmetric keys will be renewed and the symmetric key length. Next, he will
Choose the cod on sequence where the indexes will be searched. For all this options appropriate
visual selection tools are provided.
Step4: The negotiation phase begins. The initiator sends to its partner its public keyThe partner
responds by encrypting his own public key with the initiators public key. After the initiator
receives the partner's public key, he will encrypt with it the chosen parameters. Upon receiving
the parameters of the algorithms, the partner may accept or propose his own parameters. In case
the initiators parameters are rejected, the parties will chose the parameters which provide the
maximum available security.
Step 5: The negotiation phase is completed with the sending of a test message which is
encrypted like any regular message would be encrypted. If the test message is not received
correctly by any of the two parties or if the message transfer takes too much time, the negotiation
phase is restarted. In this way, we protect the messages from tampering and interception
Step 6:The transmission of a normal message. In this case, the actual data will be symmetrically
encoded, according to the specifications negotiated before. The symmetric key is randomly
generated at a time interval t. The symmetric key is encrypted with the partner's public key and
then attached to the message. So, the message consists in the data, encrypted with a symmetric
key and the symmetric key itself, encrypted with the partner's public key. We chose to adopt this
mechanism because symmetric algorithms are faster than asymmetric ones. Still, in this scenario,
the strength of the algorithm is equivalent to a fully asymmetric one because the symmetric key is
encrypted asymmetrically. The procedure is illustrated below:
Figure 3.Encryption scheme
Next, the obtained key will be converted into a byte array. The obtained array will be converted
to a raw DNA message, by using a substitution alphabet. Finally, the raw DNA message is
converted to a string of indexes and then transmitted. The decryption process is fairly similar. The
user converts the index array back to raw DNA array and extracts the ASCII data. From this data
he will decipher the symmetric key used for that encryption, by using its private key. Finally the
user will obtain the data by using the retrieved symmetric key. At the end of the communication,
all negotiated data is disregarded (symmetric keys used, the Asymmetric key pair and the codon
sequence used).
14. 174 Computer Science & Information Technology (CS & IT)
5. CONCLUSIONS AND COMPARED RESULTS
In this chapter we will present the results we obtained for the symmetric algorithm
implementation along with the conclusions of our present work. The symmetric OTP DNA
algorithm based on Java Cryptography Architecture was first tested. The purpose is to compare
the time required to complete the encryption/ decryption in the case of the DNA Cipher with the
time required by other classical encryption algorithms. The secret message used with all five
ciphers was:
„TAACAGATTGATGATGCATG
AAATGGGCCCATGAGTGGCTCCT
AAAGCAGCTGCTtACAGATTGATG
ATGCATGAAATGGGgggtggccaggggt
ggggggtgagactgcagagaaaggcagggctggttc
ataacaagctttgtgcgtcccaatatgacagctgaagttt
tccaggggctgatggtgagccagtgagggtaagtaca
cagaacatcctagagaaaccctcattccttaaagattaa
aaataaagacttgctgtctgtaagggattggattatcctat
ttgagaaattctgttatccagaatggcttaccccacaatg
ctgaaaagtgtgtaccgtaatctcaaagcaagctcctcc
tcagacagagaaacaccagccgtcacaggaagcaaa
gaaattggcttcacttttaaggtgaatccagaacccagat
gtcagagctccaagcactttgctctcagctccacGCA
GCTGCTTTAGGAGCCACTCATGaG
The tests ran on a system with the following specifications:
Intel Pentium 4 CPU, 3.00 GHz,
RAM: 1,5GB, OS: Ubuntu 9.04
Figure 4.Encryption/Decryption time for DNA and classical ciphers.
As seen on Figure 4, the DNA Cipher requires a longer time for encryption and decryption,
comparatively to the other ciphers. We would expect these results because of the platform used
15. Computer Science & Information Technology (CS & IT) 175
for developing this algorithm. JCA contains the classes of the security package Java 2 SDK,
including engine classes. The methods in the classes that implement cryptographic services are
divided into two groups. The first group is represented by the APIs (Application Programming
Interface). It consists of public methods that can be used by the instances of these classes. The
second group is represented by the SPIs (Service Provider Interface)- a set of methods that must
be implemented by the derived classes. Each SPI class is abstract. In order to implement a
specific service, for a specific algorithm, a provider must inherit the corresponding SPI class and
implement all the abstract methods. All these methods process array of bytes while the DNA
Cipher is about strings. The additional conversions from string to array of bytes and back make
this cipher to require more time for encryption and decryption then other classic algorithms. To
emphasize the difference between DNA and classical algorithms a dedicated application (Smart
Cipher) was developed. The user has the possibility to enter the text in plain format in the first
box and then choose a suitable algorithm to encrypt his text. The encrypted text can be visualized
in the second box, while in the third one the user can verify if the decryption process was
successful. An interesting feature of the dedicated application is that it shows the encryption and
decryption time. Based on this criterion and the strength of the cipher, the user can estimate the
efficiency of the used algorithm. In the second case considering the symmetrical BioJava
mechanism, our first goal was to compare the time required to complete the encryption/
decryption process. We compared the execution time of the DNA Symmetric Cipher with the
time required by other classical encryption algorithms. We chose a random text of 360 characters,
in string format which was applied to all tests. The testing sequence is:
Table 5.Testing sequence
k39pc3xygfv(!x|jl+qo|9~7k9why(kt
r6pkiaw|gwnn&aw+be|r|*4u+rz$
wm)(v_e&$dz|hc7^+p6%54vp*g*)kzlx
!%4n4bvb#%vex~7c^qe_d745h40i
$_2j*6t0h$8o!c~9x4^2srn81x*wn9&k
%*oo_co(*~!bfur7tl4udm!m4t+a
|tb%zho6xmv$6k+#1$&axghrh*_3_zz@
0!05u*|an$)5)k+8qf0fozxxw)_u
pryjj7_|+nd_&x+_jeflua^^peb_+%@0
3+36w)$~j715*r)x(*bumozo#s^j
u)6jji@xa3y35^$+#mbyizt*mdst&h|h
bf6o*)r2qrwm10ur+mbezz(1p7$f
To be able to compute the time required for encryption and decryption, we used the public static
nanoTime() method from the System class which gives the current time in nanoseconds. We
called this method twice: once before instantiating the Cipher object, and one after the encryption.
By subtracting the obtained time intervals, we determine the execution time. It is important to
understand that the execution time varies depending on the used OS, the memory load and on the
execution thread management. We therefore measured the execution time on 3 different
machines:
• System 1:Intel Core 2 Duo 2140, 1.6 GHz, 1 Gb RAM, Vista OS
• System 2:Intel Core 2 Duo T6500, 2.1 GHz, 4 Gb RAM, Windows 7 OS
16. 176 Computer Science & Information Technology (CS & IT)
• System 3: Intel Dual Core T4300, 2.1 GHz, 3 Gb RAM, Ubuntu 10.04 OS
Next, we present the execution time which was obtained for various symmetric algorithms in the
case of the first, second and the third system, for different cases:
Table 6.Results obtained for System 1
Analysis results for Vista OS
DES Encryption 50 26 1.03 0.81 0.84 0.84
Decryption 1.63 0.35 0.33 0.32 0.34 0.36
AES Encryption 80 26 0.92 0.95 0.88 0.54
Decryption 27 2.09 0.30 22.26 0 0.14
Blowfish Encryption 65 10.91 25 24 0.15 1.45
Decryption 3 1.87 1.72 29 1.09 1
3DES Encryption 82 24 2.41 25 2.12 1.42
Decryption 1.56 1.42 26 1.23 1.41 0.66
BIO
system
algorithm
Encryption 4091 4871 4875 4969 4880 4932
Decryption 6.29 4.19 4.19 4.19 4.19 4.19
Table 7.Results obtained for System 2
Table 8.Results obtained for System 3
Analysis results for Windows 7
DES Encryption 12.64 0.9 0.61 0.59 0.61 0.56
Decryption 1.24 0.45 0.44 0.45 0.43 0.41
AES Encryption 0.66 0.6 0.63 0.63 0.62 0.63
Decryption 0.66 0.71 0.64 0.64 0.19 0.19
Blowfish Encryption 37.07 32 19 13 15 14
Decryption 0.81 0.77 0.81 0.58 0.74 0.59
3DES Encryption 14 11 17.7 10.21 10.11 13
Analysis results for Windows 7
DES Encryption 34 1.43 1.09 1.2 1.73 1.19
Decryption 0.75 0.37 0.44 0.42 0.38 0.37
AES Encryption 28 1.3 1.16 0.07 1.77 0.82
Decryption 0.12 0.14 2.09 0.9 2.09 0.16
Blowfish Encryption 22 28.4 6.2 4 1.6 2.83
Decryption 2.24 2.21 1.8 1.8 1.8 1.71
3DES Encryption 14 11 17.7 10.21 10.11 13
Decryption 0.77 0.79 0.78 0.6 0.6 0.6
BIO
system
algorithm
Encryption 1896 1848 1857 1846 1850 1850
Decryption 2.62 13.1 1.83 1.31 1.57 2.62
17. Computer Science & Information Technology (CS & IT) 177
Decryption 0.77 0.79 0.78 0.6 0.6 0.6
BIO
system
algorithm
Encryption 1896 1848 1857 1846 1850 1850
Decryption 2.62 13.1 1.83 1.31 1.57 2.62
Figure 5.Encryption time for theSymmetric Bio Algorithm
Figure 6.Decryption time for the Symmetric
Bio Algorithm First of all, we can notice that the systems 1 and 2 (with Windows OS) have larger
time variations for the encryption and decryption processes. The third system, based on the Linux
platform, offers a better stability, since the variation of the execution time is smaller. As seen
from the figures and tables above, the DNA Cipher requires a longer execution time for
encryption and decryption, comparatively to the other ciphers. We would expect these results
because of the type conversions which are needed in the case of the symmetric Bioalgorithm. All
classical encryption algorithms process array of bytes while the DNA Cipher is about strings. The
additional conversions from string to array of bytes and back make this cipher to require more
time for encryption and decryption then other classic algorithms. However, this inconvenience
should be solved with the implementation of full DNA algorithms and the usage of Bio-
processors, which would make use of the parallel processing power of DNA algorithms. In this
paper we proposed an asymmetric DNA mechanism that is more reliable and more powerful than
the OTP DNA symmetric algorithm. As future developments, we would like to make some test
for the asymmetric DNA algorithm and increase its execution time.
18. 178 Computer Science & Information Technology (CS & IT)
REFERENCES
[1] Hook, D., Beginning Cryptography with Java, Wrox Press, (2005)
[2] Kahn, D., The codebrakers McMillan, New York, (1967)
[3] Schneier, B., Description of a New Variable- Length Key, 64-Bit Block Cipher (Blowfish): Springer-
Verlag, and, Fast Software Encryption, Cambridge Security Workshop Proceedings (1993).
[4] Schena, M., Microarray analysis Wiley-Liss, July (2003)
[5] Gehani, A., LaBean, T., Reif, J., DNA-BasedCryptography. s.l.: DIMACS Series in Discrete
Mathematics and Theoretical Computer Science, Vol. 54, and Lecture Notes in Computer
Science,Springer, (2004)
[6] Techateerawat, P., A Review on Quantum Cryptography Technology, International Transaction
Journal of Engineering, Management & Applied Sciences & Technologies, Vol. 1, pp. 35-41, (2010)
[7] Adelman, L. M., Molecular computation of solution to combinatorial problems, Science,266, 1021-
1024, (1994)
[8] Genetics Home Reference. U.S. National Library of Medicine.
http://ghr.nlm.nih.gov/handbook/basics/dna.(2011)
[9] DNA Alphabet. VSNS Biocomputing Division,
http://www.techfak.unibielefeld.de/bcd/Curric/PrwAli/node7.html#SECTION0007100000000000000
0, (2011)
[10] Schneier, B., Applied cryptography: protocols, algorithms, and source code in C, John Wiley & Sons
Inc, (1996)
[11] Amin, S. T., Saeb, M., El-Gindi, S., A DNAbased Implementation of YAEA Encryption Algorithm,
IASTED International Conference on Computational Intelligence, San Francisco, pp. 120-125, (2006)
[12] Java Cryptography Architecture. Sun Microsystems.http://java.sun.com/j2se/1.4.2/docs/guide/securit
y/CryptoSpec.html (2011)
[13] Tornea, O., Borda, M., Hodorogea, T., Vaida, M.F., Encryption System with Indexing DNA
Chromosomes Cryptographic Algorithm, IASTED International Conference on Biomedical
Engineering (BioMed 2010), 15-18Feb., Innsbruck, Austria, paper 680-099, pp. 12- 15, (2010)
[14] Vaida, M.F., Terec, R., Tornea, O.Chiorean, L., Vanea, A., DNA Alternative Security, Advances in
Intelligent Systems and Technologies Proceedings ECIT2010 – 6th European Conference on
Intelligent Systems and Technologies, Iasi, Romania, October 07-09, pp. 1-4, (2010)
[15] Vaida, M.F., Terec, R., Alboaie, L., Alternative DNA Security using BioJava, DICTAP2011,
Conference SDIWC, Univ. de Bourgogne, Dijon, France, 21-23 June, 2011, pp.455-469
[16] Wilson, R. K., The sequence of Homo sapiens FOSMID clone ABC14-50190700J6, submitted to
http://www.ncbi.nlm.nih.gov, (2009)
[17] Holland, R.C.G., Down, T., Pocock, M., Prlić, A., Huen, D., James, K., Foisy, S., Dräger, A., Yates,
A., Heuer, M., Schreiber M.J., “BioJava: an Open-Source Framework for Bioinformatics”,
Bioinformatics (2008)
19. Computer Science & Information Technology (CS & IT) 179
[18] Hodorogea, T., Vaida, M. F., Deriving DNA Public Keys from Blood Analysis, International Journal
of Computers Communications & Control Volume: 1 Pages: 262-267, (2006)
[19] Wagner, N. R., The Laws of Cryptography with Java Code. [PDF], (2003).
[20] BioJavahttp://java.sun.com/developer/technicalArticles/javaopensource/biojava/,(2011)
[21] RSA SecurityInc. Public-Key Cryptography Standards (PKCS) – “PKCS #5 v2.0: Password- Based
Cryptography Standard”, (2000) [22].Nobelis, N.,Boudaoud K., Riveill M., “Une architecture pour le
transfertélectroniquesécurisé de document”, PhDThesis, EquipeRainbow, Laboratories
[22] L. M. Adleman, “Molecular computation of solution to combinatorialproblems”, Science, vol. 266,
pp. 1021-1024, November 1994.
[23] C. Taylor, V. Risca, and C. Bancroft, “Hiding messages in DNAmicrodots”, Nature, vol. 399, pp.
533-534, 1999.
[24] M. Schena, “Microarray Analysis”, Wiley-Liss, July 2003.
[25] Arizona Board of Regents and Center for Image Processing inEducation, “Gel Electrophoresis Notes
What is it and how does it work”, 1999.
[26] B. Schneier, “Applied Cryptography: Protocols, Algorithms, and SourceCode in C”, John Wiley &
Sons, Inc, 1996.
[27] A. Gehani, T. LaBean, and J. Reif, “DNA-Based Cryptography”,Lecture Notes in Computer Science,
Springer. 2004.
[28] H. Wang, “Proving theorems by pattern recognition”, Bell SystemsTechnical Journal 40, pp. 1-42.
1961.
[29] S. Roweis, E. Winfree, R. Burgoyne, etc all, “A sticker based architecture for DNA computation”,
vol. 44 of DIMACS: Series in DiscreteMathematics and Theoretical Computer Science, pp. 1-30.
1996.
[30] M. E. Borda, O. Tornea, T. Hodorogea, “Secret Writing by DNAHybridization”,
ActaTehnicaNapocensis, vol. 50, pp. 21-24, 2009.
[31] S. T. Amin, M. Saeb, S. El-Gindi, “A DNA-based Implementation ofYAEA Encryption Algorithm”,
IASTED, pp. 120-125, 2006.
[32] M. E. Borda, O. Tornea, T. Hodorogea, M. Vaida, “Encryption Systemwith Indexing DNA
Chromosomes Cryptographic Algorithm”, IASTEDProceedings, pp. 12 – 15, 2010.
[33] http://www.ncbi.nlm.nih.gov
[34] O. Tornea, M. E. Borda, „DNA Cryptographic Algorithms”, MediTechCluj-Napoca, vol. 26, pp. 223-
226, 2009.
[35] T. Bajenescu, M. E. Borda, “Securitate in informaticasitelecomunicatii”, Dacia, 2002.