Lecture 3 Genes And Proteins 10212009
•Download as PPT, PDF•
0 likes•225 views
This document summarizes an online biology course lecture about genes and proteins. The lecture discusses that genes are discrete units of heritable information that typically code for proteins. Many genes encode the amino acid sequence of proteins. Genes are regulated by interactions between regulatory factors and DNA sequences that turn genes on and off. The proteins encoded by genes shape the cell and perform its functions according to their three-dimensional structures.
Report
Share
Report
Share
![Class mechanics… ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
Lecture 7 Anatomy Physiology
This document outlines the structure and content of an online bioscience course for grades 6-12. The course will cover anatomy and physiology through weekly video lectures and online discussions. Topic areas include the cellular basis of anatomy and physiology, the organ systems of the body, homeostasis, and integration of body systems. Students are expected to view video lectures, participate in online discussions, and take a final exam in December.
Lecture 1 Molecular And Cellular Biology Overview
This document summarizes the key concepts covered in a lecture on molecular and cellular biology:
1. The basic unit of life on Earth is the cell. There are two main types of cells - prokaryotes and eukaryotes - which differ in their structure and complexity.
2. All organisms on Earth evolved from a common ancestor that lived 3.5-4 billion years ago. Molecular evidence from comparative genetics supports the theory of evolution.
3. Cellular properties and behaviors can be understood through the lens of chemistry. Key biomolecules like DNA, RNA and proteins have digital sequences that can be analyzed using bioinformatics.
Lecture 6 Organs Tissues And Organisms
This document outlines the course structure and content for an online bioscience course for grades 6-12. The course covers topics like multicellularity, organs and tissues, differentiation and development, and organisms. Example lecture topics include Dictyostelium as a model for multicellularity, the worm Caenorhabditis elegans and its 700 cells, and gene expression determining muscle structure and composition. Students are assigned take-home questions corresponding to each lecture and provided online resources like videos and websites for further study.
Lecture 5 Higher Cells
This document summarizes an online bioscience course for grades 6-12 that covers topics about higher or eukaryotic cells. The course includes weekly video lectures emailed on Wednesdays to be discussed the following Tuesday. It covers topics such as the complex structures of plant and animal cells, including their DNA packaged into chromosomes, cytoskeleton, organelles, movement via cytoskeleton, and cell communication through molecules and proteins. The course aims to explain how single higher cells carry out specialized functions and interact to form tissues, organs and whole organisms.
Lecture 4 The Bacterial World
This document summarizes an online bioscience course for grades 6-12 that took place in Fall 2009. The course covered various topics related to bacteria over weekly video lectures and discussions. Topic 4 discussed the bacterial world, including the highly organized structures of bacteria, their genomes, cell movement, growth and metabolism, and their ability to form biofilms and symbiotic relationships as microbiomes. Students were assigned take-home questions to summarize key points after each topic.
Lecture 10 Computers In Biology
This document outlines the structure and content of an online bioscience course for grades 6-12. Students are expected to view weekly video lectures, participate in online discussions, and take a final exam. The last lecture discusses the fields of computational biology, bioinformatics, biological databases, programming for biology, modeling and simulation, and synthetic biology. Students are assigned take-home projects on each of these topics requiring online research.
BITS: Overview of important biological databases beyond sequences
Module 4 Other relevant biological data sources beyond sequences
Part of training session "Basic Bioinformatics concepts, databases and tools" - http://www.bits.vib.be/training
Biopython programming workshop at UGA
A workshop on bioinformatics programming using Biopython and the Python programming language, held at the University of Georgia in Spring 2010 and 2012. These workshops are part of a series for the Institute of Bioinformatics (IoB) and Bioinformatics Grad Student Association (BIGSA) at UGA.
Recommended
Lecture 7 Anatomy Physiology
This document outlines the structure and content of an online bioscience course for grades 6-12. The course will cover anatomy and physiology through weekly video lectures and online discussions. Topic areas include the cellular basis of anatomy and physiology, the organ systems of the body, homeostasis, and integration of body systems. Students are expected to view video lectures, participate in online discussions, and take a final exam in December.
Lecture 1 Molecular And Cellular Biology Overview
This document summarizes the key concepts covered in a lecture on molecular and cellular biology:
1. The basic unit of life on Earth is the cell. There are two main types of cells - prokaryotes and eukaryotes - which differ in their structure and complexity.
2. All organisms on Earth evolved from a common ancestor that lived 3.5-4 billion years ago. Molecular evidence from comparative genetics supports the theory of evolution.
3. Cellular properties and behaviors can be understood through the lens of chemistry. Key biomolecules like DNA, RNA and proteins have digital sequences that can be analyzed using bioinformatics.
Lecture 6 Organs Tissues And Organisms
This document outlines the course structure and content for an online bioscience course for grades 6-12. The course covers topics like multicellularity, organs and tissues, differentiation and development, and organisms. Example lecture topics include Dictyostelium as a model for multicellularity, the worm Caenorhabditis elegans and its 700 cells, and gene expression determining muscle structure and composition. Students are assigned take-home questions corresponding to each lecture and provided online resources like videos and websites for further study.
Lecture 5 Higher Cells
This document summarizes an online bioscience course for grades 6-12 that covers topics about higher or eukaryotic cells. The course includes weekly video lectures emailed on Wednesdays to be discussed the following Tuesday. It covers topics such as the complex structures of plant and animal cells, including their DNA packaged into chromosomes, cytoskeleton, organelles, movement via cytoskeleton, and cell communication through molecules and proteins. The course aims to explain how single higher cells carry out specialized functions and interact to form tissues, organs and whole organisms.
Lecture 4 The Bacterial World
This document summarizes an online bioscience course for grades 6-12 that took place in Fall 2009. The course covered various topics related to bacteria over weekly video lectures and discussions. Topic 4 discussed the bacterial world, including the highly organized structures of bacteria, their genomes, cell movement, growth and metabolism, and their ability to form biofilms and symbiotic relationships as microbiomes. Students were assigned take-home questions to summarize key points after each topic.
Lecture 10 Computers In Biology
This document outlines the structure and content of an online bioscience course for grades 6-12. Students are expected to view weekly video lectures, participate in online discussions, and take a final exam. The last lecture discusses the fields of computational biology, bioinformatics, biological databases, programming for biology, modeling and simulation, and synthetic biology. Students are assigned take-home projects on each of these topics requiring online research.
BITS: Overview of important biological databases beyond sequences
Module 4 Other relevant biological data sources beyond sequences
Part of training session "Basic Bioinformatics concepts, databases and tools" - http://www.bits.vib.be/training
Biopython programming workshop at UGA
A workshop on bioinformatics programming using Biopython and the Python programming language, held at the University of Georgia in Spring 2010 and 2012. These workshops are part of a series for the Institute of Bioinformatics (IoB) and Bioinformatics Grad Student Association (BIGSA) at UGA.
Bio4j
Bio4j is a graph database for integrating biological big data. It stores data from sources like Uniprot, Gene Ontology, NCBI Taxonomy, and Enzyme Database in a graph structure, with nodes for entities and edges for relationships. This allows for more flexible querying and analysis of interconnected biological data compared to traditional relational databases. Bio4j uses the Neo4j graph database and is open source.
Synthetic Biology
Synthetic biology builds on nanotechnology and biotechnology by adding information technology to model and modify biological systems at the genetic level. It aims to program cells by reengineering genomes and integrating biology with nanotechnology. Researchers can model gene networks, validate circuits, and alter genes to design new cellular functions. The next frontier is bringing such innovations to higher organisms using stem cells. The overall goal is to understand and reprogram biology as an information processing system at the molecular scale.
簡報1
This document discusses the process of creating transgenic tomatoes through gene transfer. It describes the key steps needed: 1) Obtaining the target gene segment through identifying its location in the genome using restriction enzymes or PCR. 2) Preparing the proper gene insertion agent depending on the recipient cell type. 3) Checking if genetic modification was successful using various validation methods depending on the experiment. The overall goal is to elongate the tomato ripening process by transferring a specific gene segment into tomato seeds.
Annotated biology technology resources
The document describes 19 webpages related to biology standards on various topics including cell biology, genetics, development, DNA, and genetic alteration. Each entry provides the standard, website URL, and a brief 1-2 sentence annotation summarizing what is covered on the site. The sites provide resources such as animations, lessons, activities, and virtual labs covering topics like cell structures and functions, mitosis, meiosis, mutation, development from zygote, gene expression, DNA extraction, and bacterial transformation.
Biopharma VS Small Molecules Therapeutic
Biopharmaceutical include vast range of proteins which can be modified at a molecular level and used in artificial vaccines, nutraceutical products and various product on a large scale.
Lecture 1 bioscience overview 592010 post without videos
This online course covers bioscience topics for IT professionals. Over 10 weeks, students will learn about the definition of life, cellular structure and function, evolution, and molecular biology. Key concepts include:
1) All life on Earth shares a common ancestor and can be traced back to the same origins.
2) The basic unit of life is the cell, which exists in two forms - prokaryotic and eukaryotic cells.
3) Molecular biology is understood through the central dogma of DNA->RNA->Protein.
Lecture 1 bioscience overview 592010 post
This online course covers bioscience topics for IT professionals. Over 10 weeks, students will learn about the definition and characteristics of life, the central role of the cell, and molecular biology concepts like the central dogma. Lectures are given online with opportunities for discussion and questions. The course aims to explain all biological phenomena in chemical terms and establish that all life on Earth evolved from a common ancestor based on DNA, RNA and proteins.
Lecture 1 bioscience overview 592010 post
This online course covers the fundamentals of bioscience for IT professionals. Students are expected to watch weekly video lectures and participate in online discussions. The first lecture provides an overview of key concepts, including that all life on Earth shares a common ancestor and can be understood through molecular biology. Specifically, life is defined as carbon-based systems that use water, self-replicate through nucleic acids and proteins, and adapt to their environments over time. The basic unit of life is the cell, which exists in prokaryotic and eukaryotic forms. Subsequent lectures will examine these concepts and biomolecules like DNA, RNA and proteins in more detail.
Introduction to NCBI
This presentation will tells about the Introduction and working of NCBI database and is informative for the beginners.
Lecture 1 bioscience overview 592010 post with videos
This document summarizes an online bioscience course for IT professionals. The course covers the basics of life through a molecular biology lens over several video lectures. It discusses that life can be defined by growth, metabolism, reproduction and adaptation. The basic unit of life is the cell, which comes in two types - prokaryotic and eukaryotic. All life on Earth is related through evolution from a common ancestor over 3.5 billion years ago. Life functions according to the central dogma of DNA to RNA to protein, with proteins acting as enzymes and molecular machines.
Protein Analysis
This document provides instructions for a lab exercise on protein analysis using various bioinformatics databases and tools. It includes steps to retrieve protein sequences from UniProtKB and protein structures from RCSB PDB for specified proteins. It also describes using the MolStar viewer to view protein structures and the Swiss-Model tool to build homology models for proteins based on their sequences. Students are asked to complete exercises retrieving sequence and structure data and generating models for several human proteins to analyze and visualize.
ED 205 IPP
This document outlines a learning unit on protein synthesis. It begins with an introduction by the instructor and their teaching philosophy. It then states the purpose is to guide students through studying protein synthesis using various resources. The lesson outline includes two sections - the central dogma and the genetic code. It provides learning objectives, readings, and videos for each section. It concludes with an assignment, webquest project, and list of additional resources for students.
Biopharmaceutical
Biopharmaceutical include vast range of proteins which can be modified at a molecular level and used in artificial preparation of vaccines, nutraceutical products and various products on a scale. Biopharmaceuticals are usually derivatives of natural human proteins, which make them ideal for targeted cellular therapy. Unlike small molecule drugs, which penetrate cell membranes including healthy cells, Biopharmaceuticals act through external cellular binding to induce the desired cellular response.
Neo4j and bioinformatics
This document discusses Neo4j and its applications in bioinformatics. It describes Bio4j, an open source bioinformatics graph database built using Neo4j that integrates data from sources like Uniprot, NCBI taxonomy, Gene Ontology, and more. Bio4j models biological data as nodes and relationships in a graph structure rather than tables. This allows for more flexible querying and knowledge integration. The document provides examples of how Bio4j can be accessed through its Java API, Cypher query language, Gremlin traversal language, and REST API. It also describes some tools and visualizations for exploring and analyzing Bio4j data.
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
We all must do whatever is in our hands to prevent all kinds of cancer, which is the cause of millions of deaths every year. Work on your health-related presentations with the help of these editable Google Slides and PowerPoint templates.
B.sc biochem i bobi u 2 database
Biological databases are collections of experimental and theoretical biological data that are organized so their contents can be easily accessed, managed, updated, and retrieved. The activity of preparing a database can be divided into collecting data in an accessible form and making it available to a multi-user system. Two important biological databases are GenBank, which contains publicly available nucleotide and protein sequences, and the Protein Data Bank, which houses 3D structures of proteins, nucleic acids, and carbohydrates.
What Synthetic Biology Can Do For You
The document discusses synthetic biology and its potential applications. It explains foundational concepts like DNA, mRNA and proteins. It describes how DNA parts can be standardized and assembled to program bacteria. Examples are given of applications like biochemical sensors, genetic oscillators, and biological computation. The document conveys that synthetic biology makes biotechnology more accessible and could impact areas like healthcare, energy and education. It promotes synthetic biology as an exciting field that enables problem-based learning.
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
This document discusses the development of the video game Immune Defense to teach molecular biology concepts. It describes keeping learning objectives associated with winning gameplay to motivate players. Various game mechanics are designed to teach concepts like random molecular diffusion and specificity of ligand-receptor interactions while avoiding potential misconceptions. Levels increase in complexity and can be replayed to reinforce learning.
Collaboratively Creating the Knowledge Graph of Life
The document discusses collaboratively building a knowledge graph of life by connecting existing biological ontologies. It describes how ontologies can standardize and organize biological data by representing entities and their relationships in a graph. The challenges of integrating different ontology projects are addressed through initiatives like the Open Biological and Biomedical Ontologies (OBO) Foundry. The document outlines how ontologies can be formalized using OWL and connected using tools like the Ontology Development Kit to enable discovery across domains. Current efforts like the Gene Ontology, Biolink Model, and National Microbiome Data Collaborative are leveraging these techniques to create unified, semantically queryable knowledge graphs.
Biotechnology Chapter Five Lecture- Proteins (part b)
This document provides an overview of protein synthesis and function. It discusses how proteins are produced through transcription and translation. Transcription involves copying DNA into mRNA, which is then translated into a polypeptide chain through the genetic code on ribosomes. The document also covers the structure and function of antibodies, which recognize antigens, and enzymes, which act as catalysts in cells. Key aspects like the production of monoclonal antibodies and how various factors influence enzyme activity are also summarized.
Programming Foundation Models with DSPy - Meetup Slides
Prompting language models is hard, while programming language models is easy. In this talk, I will discuss the state-of-the-art framework DSPy for programming foundation models with its powerful optimizers and runtime constraint system.
More Related Content
Similar to Lecture 3 Genes And Proteins 10212009
Bio4j
Bio4j is a graph database for integrating biological big data. It stores data from sources like Uniprot, Gene Ontology, NCBI Taxonomy, and Enzyme Database in a graph structure, with nodes for entities and edges for relationships. This allows for more flexible querying and analysis of interconnected biological data compared to traditional relational databases. Bio4j uses the Neo4j graph database and is open source.
Synthetic Biology
Synthetic biology builds on nanotechnology and biotechnology by adding information technology to model and modify biological systems at the genetic level. It aims to program cells by reengineering genomes and integrating biology with nanotechnology. Researchers can model gene networks, validate circuits, and alter genes to design new cellular functions. The next frontier is bringing such innovations to higher organisms using stem cells. The overall goal is to understand and reprogram biology as an information processing system at the molecular scale.
簡報1
This document discusses the process of creating transgenic tomatoes through gene transfer. It describes the key steps needed: 1) Obtaining the target gene segment through identifying its location in the genome using restriction enzymes or PCR. 2) Preparing the proper gene insertion agent depending on the recipient cell type. 3) Checking if genetic modification was successful using various validation methods depending on the experiment. The overall goal is to elongate the tomato ripening process by transferring a specific gene segment into tomato seeds.
Annotated biology technology resources
The document describes 19 webpages related to biology standards on various topics including cell biology, genetics, development, DNA, and genetic alteration. Each entry provides the standard, website URL, and a brief 1-2 sentence annotation summarizing what is covered on the site. The sites provide resources such as animations, lessons, activities, and virtual labs covering topics like cell structures and functions, mitosis, meiosis, mutation, development from zygote, gene expression, DNA extraction, and bacterial transformation.
Biopharma VS Small Molecules Therapeutic
Biopharmaceutical include vast range of proteins which can be modified at a molecular level and used in artificial vaccines, nutraceutical products and various product on a large scale.
Lecture 1 bioscience overview 592010 post without videos
This online course covers bioscience topics for IT professionals. Over 10 weeks, students will learn about the definition of life, cellular structure and function, evolution, and molecular biology. Key concepts include:
1) All life on Earth shares a common ancestor and can be traced back to the same origins.
2) The basic unit of life is the cell, which exists in two forms - prokaryotic and eukaryotic cells.
3) Molecular biology is understood through the central dogma of DNA->RNA->Protein.
Lecture 1 bioscience overview 592010 post
This online course covers bioscience topics for IT professionals. Over 10 weeks, students will learn about the definition and characteristics of life, the central role of the cell, and molecular biology concepts like the central dogma. Lectures are given online with opportunities for discussion and questions. The course aims to explain all biological phenomena in chemical terms and establish that all life on Earth evolved from a common ancestor based on DNA, RNA and proteins.
Lecture 1 bioscience overview 592010 post
This online course covers the fundamentals of bioscience for IT professionals. Students are expected to watch weekly video lectures and participate in online discussions. The first lecture provides an overview of key concepts, including that all life on Earth shares a common ancestor and can be understood through molecular biology. Specifically, life is defined as carbon-based systems that use water, self-replicate through nucleic acids and proteins, and adapt to their environments over time. The basic unit of life is the cell, which exists in prokaryotic and eukaryotic forms. Subsequent lectures will examine these concepts and biomolecules like DNA, RNA and proteins in more detail.
Introduction to NCBI
This presentation will tells about the Introduction and working of NCBI database and is informative for the beginners.
Lecture 1 bioscience overview 592010 post with videos
This document summarizes an online bioscience course for IT professionals. The course covers the basics of life through a molecular biology lens over several video lectures. It discusses that life can be defined by growth, metabolism, reproduction and adaptation. The basic unit of life is the cell, which comes in two types - prokaryotic and eukaryotic. All life on Earth is related through evolution from a common ancestor over 3.5 billion years ago. Life functions according to the central dogma of DNA to RNA to protein, with proteins acting as enzymes and molecular machines.
Protein Analysis
This document provides instructions for a lab exercise on protein analysis using various bioinformatics databases and tools. It includes steps to retrieve protein sequences from UniProtKB and protein structures from RCSB PDB for specified proteins. It also describes using the MolStar viewer to view protein structures and the Swiss-Model tool to build homology models for proteins based on their sequences. Students are asked to complete exercises retrieving sequence and structure data and generating models for several human proteins to analyze and visualize.
ED 205 IPP
This document outlines a learning unit on protein synthesis. It begins with an introduction by the instructor and their teaching philosophy. It then states the purpose is to guide students through studying protein synthesis using various resources. The lesson outline includes two sections - the central dogma and the genetic code. It provides learning objectives, readings, and videos for each section. It concludes with an assignment, webquest project, and list of additional resources for students.
Biopharmaceutical
Biopharmaceutical include vast range of proteins which can be modified at a molecular level and used in artificial preparation of vaccines, nutraceutical products and various products on a scale. Biopharmaceuticals are usually derivatives of natural human proteins, which make them ideal for targeted cellular therapy. Unlike small molecule drugs, which penetrate cell membranes including healthy cells, Biopharmaceuticals act through external cellular binding to induce the desired cellular response.
Neo4j and bioinformatics
This document discusses Neo4j and its applications in bioinformatics. It describes Bio4j, an open source bioinformatics graph database built using Neo4j that integrates data from sources like Uniprot, NCBI taxonomy, Gene Ontology, and more. Bio4j models biological data as nodes and relationships in a graph structure rather than tables. This allows for more flexible querying and knowledge integration. The document provides examples of how Bio4j can be accessed through its Java API, Cypher query language, Gremlin traversal language, and REST API. It also describes some tools and visualizations for exploring and analyzing Bio4j data.
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
We all must do whatever is in our hands to prevent all kinds of cancer, which is the cause of millions of deaths every year. Work on your health-related presentations with the help of these editable Google Slides and PowerPoint templates.
B.sc biochem i bobi u 2 database
Biological databases are collections of experimental and theoretical biological data that are organized so their contents can be easily accessed, managed, updated, and retrieved. The activity of preparing a database can be divided into collecting data in an accessible form and making it available to a multi-user system. Two important biological databases are GenBank, which contains publicly available nucleotide and protein sequences, and the Protein Data Bank, which houses 3D structures of proteins, nucleic acids, and carbohydrates.
What Synthetic Biology Can Do For You
The document discusses synthetic biology and its potential applications. It explains foundational concepts like DNA, mRNA and proteins. It describes how DNA parts can be standardized and assembled to program bacteria. Examples are given of applications like biochemical sensors, genetic oscillators, and biological computation. The document conveys that synthetic biology makes biotechnology more accessible and could impact areas like healthcare, energy and education. It promotes synthetic biology as an exciting field that enables problem-based learning.
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
This document discusses the development of the video game Immune Defense to teach molecular biology concepts. It describes keeping learning objectives associated with winning gameplay to motivate players. Various game mechanics are designed to teach concepts like random molecular diffusion and specificity of ligand-receptor interactions while avoiding potential misconceptions. Levels increase in complexity and can be replayed to reinforce learning.
Collaboratively Creating the Knowledge Graph of Life
The document discusses collaboratively building a knowledge graph of life by connecting existing biological ontologies. It describes how ontologies can standardize and organize biological data by representing entities and their relationships in a graph. The challenges of integrating different ontology projects are addressed through initiatives like the Open Biological and Biomedical Ontologies (OBO) Foundry. The document outlines how ontologies can be formalized using OWL and connected using tools like the Ontology Development Kit to enable discovery across domains. Current efforts like the Gene Ontology, Biolink Model, and National Microbiome Data Collaborative are leveraging these techniques to create unified, semantically queryable knowledge graphs.
Biotechnology Chapter Five Lecture- Proteins (part b)
This document provides an overview of protein synthesis and function. It discusses how proteins are produced through transcription and translation. Transcription involves copying DNA into mRNA, which is then translated into a polypeptide chain through the genetic code on ribosomes. The document also covers the structure and function of antibodies, which recognize antigens, and enzymes, which act as catalysts in cells. Key aspects like the production of monoclonal antibodies and how various factors influence enzyme activity are also summarized.
Similar to Lecture 3 Genes And Proteins 10212009 (20)
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videos
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of Life
Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)
Recently uploaded
Programming Foundation Models with DSPy - Meetup Slides
Prompting language models is hard, while programming language models is easy. In this talk, I will discuss the state-of-the-art framework DSPy for programming foundation models with its powerful optimizers and runtime constraint system.
Artificial Intelligence for XMLDevelopment
In the rapidly evolving landscape of technologies, XML continues to play a vital role in structuring, storing, and transporting data across diverse systems. The recent advancements in artificial intelligence (AI) present new methodologies for enhancing XML development workflows, introducing efficiency, automation, and intelligent capabilities. This presentation will outline the scope and perspective of utilizing AI in XML development. The potential benefits and the possible pitfalls will be highlighted, providing a balanced view of the subject.
We will explore the capabilities of AI in understanding XML markup languages and autonomously creating structured XML content. Additionally, we will examine the capacity of AI to enrich plain text with appropriate XML markup. Practical examples and methodological guidelines will be provided to elucidate how AI can be effectively prompted to interpret and generate accurate XML markup.
Further emphasis will be placed on the role of AI in developing XSLT, or schemas such as XSD and Schematron. We will address the techniques and strategies adopted to create prompts for generating code, explaining code, or refactoring the code, and the results achieved.
The discussion will extend to how AI can be used to transform XML content. In particular, the focus will be on the use of AI XPath extension functions in XSLT, Schematron, Schematron Quick Fixes, or for XML content refactoring.
The presentation aims to deliver a comprehensive overview of AI usage in XML development, providing attendees with the necessary knowledge to make informed decisions. Whether you’re at the early stages of adopting AI or considering integrating it in advanced XML development, this presentation will cover all levels of expertise.
By highlighting the potential advantages and challenges of integrating AI with XML development tools and languages, the presentation seeks to inspire thoughtful conversation around the future of XML development. We’ll not only delve into the technical aspects of AI-powered XML development but also discuss practical implications and possible future directions.
Digital Marketing Trends in 2024 | Guide for Staying Ahead
https://www.wask.co/ebooks/digital-marketing-trends-in-2024
Feeling lost in the digital marketing whirlwind of 2024? Technology is changing, consumer habits are evolving, and staying ahead of the curve feels like a never-ending pursuit. This e-book is your compass. Dive into actionable insights to handle the complexities of modern marketing. From hyper-personalization to the power of user-generated content, learn how to build long-term relationships with your audience and unlock the secrets to success in the ever-shifting digital landscape.
Generating privacy-protected synthetic data using Secludy and Milvus
During this demo, the founders of Secludy will demonstrate how their system utilizes Milvus to store and manipulate embeddings for generating privacy-protected synthetic data. Their approach not only maintains the confidentiality of the original data but also enhances the utility and scalability of LLMs under privacy constraints. Attendees, including machine learning engineers, data scientists, and data managers, will witness first-hand how Secludy's integration with Milvus empowers organizations to harness the power of LLMs securely and efficiently.
Introduction of Cybersecurity with OSS at Code Europe 2024
I develop the Ruby programming language, RubyGems, and Bundler, which are package managers for Ruby. Today, I will introduce how to enhance the security of your application using open-source software (OSS) examples from Ruby and RubyGems.
The first topic is CVE (Common Vulnerabilities and Exposures). I have published CVEs many times. But what exactly is a CVE? I'll provide a basic understanding of CVEs and explain how to detect and handle vulnerabilities in OSS.
Next, let's discuss package managers. Package managers play a critical role in the OSS ecosystem. I'll explain how to manage library dependencies in your application.
I'll share insights into how the Ruby and RubyGems core team works to keep our ecosystem safe. By the end of this talk, you'll have a better understanding of how to safeguard your code.
Nunit vs XUnit vs MSTest Differences Between These Unit Testing Frameworks.pdf
When it comes to unit testing in the .NET ecosystem, developers have a wide range of options available. Among the most popular choices are NUnit, XUnit, and MSTest. These unit testing frameworks provide essential tools and features to help ensure the quality and reliability of code. However, understanding the differences between these frameworks is crucial for selecting the most suitable one for your projects.
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdf
A Mix Chart displays historical data of numbers in a graphical or tabular form. The Kalyan Rajdhani Mix Chart specifically shows the results of a sequence of numbers over different periods.
Ocean lotus Threat actors project by John Sitima 2024 (1).pptx
Ocean Lotus cyber threat actors represent a sophisticated, persistent, and politically motivated group that poses a significant risk to organizations and individuals in the Southeast Asian region. Their continuous evolution and adaptability underscore the need for robust cybersecurity measures and international cooperation to identify and mitigate the threats posed by such advanced persistent threat groups.
5th LF Energy Power Grid Model Meet-up Slides
5th Power Grid Model Meet-up
It is with great pleasure that we extend to you an invitation to the 5th Power Grid Model Meet-up, scheduled for 6th June 2024. This event will adopt a hybrid format, allowing participants to join us either through an online Mircosoft Teams session or in person at TU/e located at Den Dolech 2, Eindhoven, Netherlands. The meet-up will be hosted by Eindhoven University of Technology (TU/e), a research university specializing in engineering science & technology.
Power Grid Model
The global energy transition is placing new and unprecedented demands on Distribution System Operators (DSOs). Alongside upgrades to grid capacity, processes such as digitization, capacity optimization, and congestion management are becoming vital for delivering reliable services.
Power Grid Model is an open source project from Linux Foundation Energy and provides a calculation engine that is increasingly essential for DSOs. It offers a standards-based foundation enabling real-time power systems analysis, simulations of electrical power grids, and sophisticated what-if analysis. In addition, it enables in-depth studies and analysis of the electrical power grid’s behavior and performance. This comprehensive model incorporates essential factors such as power generation capacity, electrical losses, voltage levels, power flows, and system stability.
Power Grid Model is currently being applied in a wide variety of use cases, including grid planning, expansion, reliability, and congestion studies. It can also help in analyzing the impact of renewable energy integration, assessing the effects of disturbances or faults, and developing strategies for grid control and optimization.
What to expect
For the upcoming meetup we are organizing, we have an exciting lineup of activities planned:
-Insightful presentations covering two practical applications of the Power Grid Model.
-An update on the latest advancements in Power Grid -Model technology during the first and second quarters of 2024.
-An interactive brainstorming session to discuss and propose new feature requests.
-An opportunity to connect with fellow Power Grid Model enthusiasts and users.
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Are you ready to revolutionize how you handle data? Join us for a webinar where we’ll bring you up to speed with the latest advancements in Generative AI technology and discover how leveraging FME with tools from giants like Google Gemini, Amazon, and Microsoft OpenAI can supercharge your workflow efficiency.
During the hour, we’ll take you through:
Guest Speaker Segment with Hannah Barrington: Dive into the world of dynamic real estate marketing with Hannah, the Marketing Manager at Workspace Group. Hear firsthand how their team generates engaging descriptions for thousands of office units by integrating diverse data sources—from PDF floorplans to web pages—using FME transformers, like OpenAIVisionConnector and AnthropicVisionConnector. This use case will show you how GenAI can streamline content creation for marketing across the board.
Ollama Use Case: Learn how Scenario Specialist Dmitri Bagh has utilized Ollama within FME to input data, create custom models, and enhance security protocols. This segment will include demos to illustrate the full capabilities of FME in AI-driven processes.
Custom AI Models: Discover how to leverage FME to build personalized AI models using your data. Whether it’s populating a model with local data for added security or integrating public AI tools, find out how FME facilitates a versatile and secure approach to AI.
We’ll wrap up with a live Q&A session where you can engage with our experts on your specific use cases, and learn more about optimizing your data workflows with AI.
This webinar is ideal for professionals seeking to harness the power of AI within their data management systems while ensuring high levels of customization and security. Whether you're a novice or an expert, gain actionable insights and strategies to elevate your data processes. Join us to see how FME and AI can revolutionize how you work with data!
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-und-domino-lizenzkostenreduzierung-in-der-welt-von-dlau/
DLAU und die Lizenzen nach dem CCB- und CCX-Modell sind für viele in der HCL-Community seit letztem Jahr ein heißes Thema. Als Notes- oder Domino-Kunde haben Sie vielleicht mit unerwartet hohen Benutzerzahlen und Lizenzgebühren zu kämpfen. Sie fragen sich vielleicht, wie diese neue Art der Lizenzierung funktioniert und welchen Nutzen sie Ihnen bringt. Vor allem wollen Sie sicherlich Ihr Budget einhalten und Kosten sparen, wo immer möglich. Das verstehen wir und wir möchten Ihnen dabei helfen!
Wir erklären Ihnen, wie Sie häufige Konfigurationsprobleme lösen können, die dazu führen können, dass mehr Benutzer gezählt werden als nötig, und wie Sie überflüssige oder ungenutzte Konten identifizieren und entfernen können, um Geld zu sparen. Es gibt auch einige Ansätze, die zu unnötigen Ausgaben führen können, z. B. wenn ein Personendokument anstelle eines Mail-Ins für geteilte Mailboxen verwendet wird. Wir zeigen Ihnen solche Fälle und deren Lösungen. Und natürlich erklären wir Ihnen das neue Lizenzmodell.
Nehmen Sie an diesem Webinar teil, bei dem HCL-Ambassador Marc Thomas und Gastredner Franz Walder Ihnen diese neue Welt näherbringen. Es vermittelt Ihnen die Tools und das Know-how, um den Überblick zu bewahren. Sie werden in der Lage sein, Ihre Kosten durch eine optimierte Domino-Konfiguration zu reduzieren und auch in Zukunft gering zu halten.
Diese Themen werden behandelt
- Reduzierung der Lizenzkosten durch Auffinden und Beheben von Fehlkonfigurationen und überflüssigen Konten
- Wie funktionieren CCB- und CCX-Lizenzen wirklich?
- Verstehen des DLAU-Tools und wie man es am besten nutzt
- Tipps für häufige Problembereiche, wie z. B. Team-Postfächer, Funktions-/Testbenutzer usw.
- Praxisbeispiele und Best Practices zum sofortigen Umsetzen
Salesforce Integration for Bonterra Impact Management (fka Social Solutions A...
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on integration of Salesforce with Bonterra Impact Management.
Interested in deploying an integration with Salesforce for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
Main news related to the CCS TSI 2023 (2023/1695)
An English 🇬🇧 translation of a presentation to the speech I gave about the main changes brought by CCS TSI 2023 at the biggest Czech conference on Communications and signalling systems on Railways, which was held in Clarion Hotel Olomouc from 7th to 9th November 2023 (konferenceszt.cz). Attended by around 500 participants and 200 on-line followers.
The original Czech 🇨🇿 version of the presentation can be found here: https://www.slideshare.net/slideshow/hlavni-novinky-souvisejici-s-ccs-tsi-2023-2023-1695/269688092 .
The videorecording (in Czech) from the presentation is available here: https://youtu.be/WzjJWm4IyPk?si=SImb06tuXGb30BEH .
Taking AI to the Next Level in Manufacturing.pdf
Read Taking AI to the Next Level in Manufacturing to gain insights on AI adoption in the manufacturing industry, such as:
1. How quickly AI is being implemented in manufacturing.
2. Which barriers stand in the way of AI adoption.
3. How data quality and governance form the backbone of AI.
4. Organizational processes and structures that may inhibit effective AI adoption.
6. Ideas and approaches to help build your organization's AI strategy.
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
Discover how MongoDB Atlas and vector search technology can revolutionize your application's search capabilities. This comprehensive presentation covers:
* What is Vector Search?
* Importance and benefits of vector search
* Practical use cases across various industries
* Step-by-step implementation guide
* Live demos with code snippets
* Enhancing LLM capabilities with vector search
* Best practices and optimization strategies
Perfect for developers, AI enthusiasts, and tech leaders. Learn how to leverage MongoDB Atlas to deliver highly relevant, context-aware search results, transforming your data retrieval process. Stay ahead in tech innovation and maximize the potential of your applications.
#MongoDB #VectorSearch #AI #SemanticSearch #TechInnovation #DataScience #LLM #MachineLearning #SearchTechnology
Letter and Document Automation for Bonterra Impact Management (fka Social Sol...
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on automated letter generation for Bonterra Impact Management using Google Workspace or Microsoft 365.
Interested in deploying letter generation automations for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
GraphRAG for Life Science to increase LLM accuracy
GraphRAG for life science domain, where you retriever information from biomedical knowledge graphs using LLMs to increase the accuracy and performance of generated answers
HCL Notes and Domino License Cost Reduction in the World of DLAU
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
Recently uploaded (20)
Programming Foundation Models with DSPy - Meetup Slides
Programming Foundation Models with DSPy - Meetup Slides
WeTestAthens: Postman's AI & Automation Techniques
WeTestAthens: Postman's AI & Automation Techniques
Digital Marketing Trends in 2024 | Guide for Staying Ahead
Digital Marketing Trends in 2024 | Guide for Staying Ahead
Generating privacy-protected synthetic data using Secludy and Milvus
Generating privacy-protected synthetic data using Secludy and Milvus
Introduction of Cybersecurity with OSS at Code Europe 2024
Introduction of Cybersecurity with OSS at Code Europe 2024
Nunit vs XUnit vs MSTest Differences Between These Unit Testing Frameworks.pdf
Nunit vs XUnit vs MSTest Differences Between These Unit Testing Frameworks.pdf
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdf
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdf
Ocean lotus Threat actors project by John Sitima 2024 (1).pptx
Ocean lotus Threat actors project by John Sitima 2024 (1).pptx
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success Story
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAU
Salesforce Integration for Bonterra Impact Management (fka Social Solutions A...
Salesforce Integration for Bonterra Impact Management (fka Social Solutions A...
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdf
Letter and Document Automation for Bonterra Impact Management (fka Social Sol...
Letter and Document Automation for Bonterra Impact Management (fka Social Sol...
Nordic Marketo Engage User Group_June 13_ 2024.pptx
Nordic Marketo Engage User Group_June 13_ 2024.pptx
GraphRAG for Life Science to increase LLM accuracy
GraphRAG for Life Science to increase LLM accuracy
HCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAU
Lecture 3 Genes And Proteins 10212009
- 1. Online bioscience course for grades 6-12 Fall 2009 bio 1.0
- 3. Lecture 3: Genes and proteins bio 1.0
- 6. Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
- 7. http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
- 8. How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
- 9. How the genetic code works III bio 1.0
- 10. Reading frames bio 1.0
- 11. Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
- 12. Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
- 13. >EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
- 14. So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence… bio 1.0
- 16. Cells “engineered” to express GFP: bio 1.0
- 17. Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
- 18. The lac Operon-an example of how bacterial genes are turned “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
- 19. Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated bio 1.0
- 20. Protein Functions in the Body http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
- 21. Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
- 22. Protein Functions in the Body: An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
- 23. Looking at GFP at the molecular level… bio 1.0
- 24. Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
- 25. A look at GFP structure with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
- 26. Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
- 27. Virtual experiment: making bacteria that glow green by giving them a GFP gene… http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
- 28. Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
- 29. instructor Mark E Minie PhD [email_address] bio 1.0