DNA damage repair Neil3 gene Knockout in MOLT-4iosrjce
RNAi is superannuated cellular mechanism that protect organism against viruses that replicate
through double- stranded RNA. RNAi can be used to diminish gene expression from plasmid expressing and
inserted sequence repeat. A stable harpin would be expressed after the vector was integrated into the genome.
In this paper a shiRNA expressing vector for Neil3 was designed and developed which is capable of replication
in MOLT-4. This shiRNA vector had the ability to arose the RNAi pathway, and reduce the gene expression of
Neil3. This was assessed by using pSilence 4.1CMV as a vector, and Gapdh as positive control.
Presentation made by Dr. Paul Taylor on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
Over the past 10 years, research systems have evolved from systems that focused on how to structure and record information on research, to systems capable of allowing significant insights to be derived based upon years of high quality information. In 2015, the maturity of the information now collected within many Current Research Information Systems, and the insights that this can provide is of equal or greater value than the insights that could be gleaned from established externally provided research metrics platforms alone. The ability to intersect these external and internal worlds provides new levels of strategic insight not previously available. With the addition of platforms that track altmetrics, and their ability to connect university publications data with a constant flow of real time attention level metrics, an image of a dynamic network of systems emerges, connected together by ever turning ‘cogs’ pushing and translating information. Add to this, the success of ORCID as pervasive researcher identifier infrastructure, and CASRAI as the emerging social contract for information exchange, and it becomes possible to extend this network back from the systems that track and record research information, through to the platforms through which research knowledge is created. The ‘Mechanics’ of this network of systems is more than just getting the ‘plumbing’ right. As research information moves through the network, its audience and purpose changes, the requirements for contextual metadata can also change. This presentation will explore the lived experience of Research Data Mechanics at Digital Science though illustrating how connections between Figshare, Altmetric, Symplectic Elements, and Dimensions can both enhance research system capability and reduce the burden on researchers, and research administration.
DNA damage repair Neil3 gene Knockout in MOLT-4iosrjce
RNAi is superannuated cellular mechanism that protect organism against viruses that replicate
through double- stranded RNA. RNAi can be used to diminish gene expression from plasmid expressing and
inserted sequence repeat. A stable harpin would be expressed after the vector was integrated into the genome.
In this paper a shiRNA expressing vector for Neil3 was designed and developed which is capable of replication
in MOLT-4. This shiRNA vector had the ability to arose the RNAi pathway, and reduce the gene expression of
Neil3. This was assessed by using pSilence 4.1CMV as a vector, and Gapdh as positive control.
Presentation made by Dr. Paul Taylor on October 30, 2015 at the Alzforum-hosted live webinar titled "Fluid Business: Could “Liquid” Protein Herald Neurodegeneration?"
More information and the recording of the session available at http://www.alzforum.org/webinars/fluid-business-could-liquid-protein-herald-neurodegeneration
Over the past 10 years, research systems have evolved from systems that focused on how to structure and record information on research, to systems capable of allowing significant insights to be derived based upon years of high quality information. In 2015, the maturity of the information now collected within many Current Research Information Systems, and the insights that this can provide is of equal or greater value than the insights that could be gleaned from established externally provided research metrics platforms alone. The ability to intersect these external and internal worlds provides new levels of strategic insight not previously available. With the addition of platforms that track altmetrics, and their ability to connect university publications data with a constant flow of real time attention level metrics, an image of a dynamic network of systems emerges, connected together by ever turning ‘cogs’ pushing and translating information. Add to this, the success of ORCID as pervasive researcher identifier infrastructure, and CASRAI as the emerging social contract for information exchange, and it becomes possible to extend this network back from the systems that track and record research information, through to the platforms through which research knowledge is created. The ‘Mechanics’ of this network of systems is more than just getting the ‘plumbing’ right. As research information moves through the network, its audience and purpose changes, the requirements for contextual metadata can also change. This presentation will explore the lived experience of Research Data Mechanics at Digital Science though illustrating how connections between Figshare, Altmetric, Symplectic Elements, and Dimensions can both enhance research system capability and reduce the burden on researchers, and research administration.
The religion of Islam is completely based upon five different pillars which guide Muslims throughout their lifetime to perform only good deeds which are good for humanity. These five pillars must be followed by every individual for inner peace.
Transcription factors of the nuclear factor κ B family are the paradigm for signaling dependent nuclear translocation and are ideally suited to analysis through image-based chemical genetic screening. The authors describe combining high-content image analysis with a compound screen to identify compounds affecting either nuclear import or export. Validation in silico and in vitro determined an EC50 for the nuclear export blocker leptomycin B of 2.4 ng/mL (4.4 nM). The method demonstrated high selectivity (Z′ >0.95), speed, and robustness in a screen of a compound collection. It identified the IκB protein kinase inhibitor BAY 11 7082 as an import inhibitor, the p38 mitogen-activated protein (MAP) kinase inhibitor PD98509 as an import enhancer, and phorbol ester as an export inhibitor. The results establish a robust method for identifying compounds regulating nucleocy- toplasmic import or export and also implicate MAP kinases in nuclear import of nuclear factor κ B
2. 2
Abstract25
Infectious spleen and kidney necrosis virus (ISKNV) is the type species of the26
Megalocytivirus genus, Iridoviridae family, causing a severe systemic disease with high27
mortality to mandarin fish (Siniperca chuatsi) in China and South-East Asia. Up to now,28
the pathogenesis of ISKNV infection is still not fully understood. Based on a genome-wide29
bioinformatics analysis of ISKNV-encoded proteins, we found that ISKNV open reading30
frame 119L (ORF119L) is predicted to encode a three ankyrin-repeats (3ANK)31
domain-containing protein, which shows high similarity to the dominant-negative form of32
integrin-linked kinase (ILK), i.e., viral ORF119L lacks the ILK kinase domain. Thus, we33
speculated that viral ORF119L might affect the host ILK complex. Here, we demonstrated34
that viral ORF119L directly interacts with particularly interesting Cys-His-rich protein35
(PINCH) and affects the host ILK-PINCH interaction in vitro in Fathead minnow (FHM)36
cells. In vivo ORF119L overexpression in zebrafish (Danio rerio) embryos resulted in37
myocardial dysfunctions with disintegration of sarcomeric Z-disk. Importantly, ORF119L38
overexpression in zebrafish highly resembles the phenotype of endogenous ILK inhibition,39
either by over-expressing a dominant-negative form of ILK or by injecting an ILK40
antisense morpholino. Intriguingly, ISKNV-infected mandarin fish develop disorganized41
sarcomeric Z-disk in cardiomyocytes. Furthermore, phosphorylation of AKT, a42
downstream effector of ILK, was remarkably decreased in ORF119L overexpressing43
zebrafish embryos. As such, we show that ISKNV ORF119L acts as a domain-negative44
inhibitor of the host ILK, providing a novel mechanism for the megalocytivirus45
pathogenesis.46
47
3. 3
IMPORTANCE: Our work is the first to show the role of a dominant-negative inhibitor of48
the host ILK from ISKNV (an Iridovirus). Mechanistically, the viral ORF119L directly49
binds to the host PINCH, attenuates the host PINCH-ILK interaction, and thus impairs the50
ILK signalling. Intriguingly, ORF119L-overexpressing zebrafish embryos and51
ISKNV-infected mandarin fish develop similar disordered sarcomeric Z-disk in52
cadiomyocytes. These findings provide a novel mechanism for megalocytivirus53
pathogenesis.54
55
4. 4
Introduction56
Infectious spleen and kidney necrosis virus (ISKNV) is the type species of the57
Megalocytivirus genus, Iridoviridae family. ISKNV and closely related isolates infect a58
wide range of marine and freshwater fish species, including mandarin fish (Siniperca59
chuatsi) (1), orange-spotted grouper (Epinephelus coioides) (2), large yellow croaker60
(Larimichthys crocea) (3), Aplocheilichthys normani (4), turbot (Scophthalmus maximus),61
zebrafish (Danio rerio) (5), and more than 50 species of marine fish (6). In China, ISKNV62
causes a serious disease with high mortality in mandarin fish, leading to economic loss and63
ecological problems. To control the virus, we started the viral pathogenesis study by64
sequencing ISKNV genome.65
66
In this study, we found that ISKNV open reading frame 119L (ORF119L) is predicted to67
encode an ankyrin-repeat-containing protein but without the kinase domain. The68
NH2-terminal three ankyrin-repeats (3ANK)-containing domain of ORF119L is highly69
similar to that of integrin-linked kinase (ILK). The myxoma virus M-T5 (7, 8), myxoma70
nuclear factor (MNF) (9), poxvirus ankyrin-repeats proteins (10, 11), vaccinia virus K1L71
protein (12), and ISKNV ORF124L (13) have this ankyrin-repeat-containing domain. All72
of these proteins have been reported to be involved in viral pathogenesis.73
74
In the host ILK signalling, ILK complexes with particularly interesting Cys-His-rich75
protein (PINCH) and Parvin, and plays a crucial role in the cell-adhesion and intracellular76
signal transduction (14, 15). Structurally, the NH2-terminus of ILK is a 3ANK-containing77
domain capable of binding to the LIM1 domain of PINCH (16-19), while the78
5. 5
COOH-terminus of ILK contains a kinase domain responsible for interacting with Parvin.79
Functionally, ILK phosphorylates protein kinase B (PKB, also known as AKT) and80
glycogen synthase kinase 3 (GSK-3) for intracellular signal transduction (18). Mice with81
the germ line mutated ILK in which Val(386) and Thr(387) in the kinase domain are82
substituted with glycine residues (ILK-VT/GG) dies of vasculogenesis defects at83
embryonic day 12.5 due to the fact that VT/GG substitutions decrease ILK protein stability84
leading to decreased ILK levels and reduced binding to paxillin and α-parvin (20). Heart85
failure and pericardial edema phenotypes are found in zebrafish expressing ILKL308P
86
(kinase-dead mutant) during early embryogenesis (21). In mammalian cells,87
overexpression of the 3ANK domain of ILK without its kinase domain disrupts the88
assembly of the PINCH-ILK-Parvin complex, exerting its dominant-negative inhibitory89
(DNI) effect on ILK-mediated signalling (22, 23).90
91
All of these prompted us to hypothesize that ORF119L may play a role in the host ILK92
signalling. We studied the function of ORF119L in vivo by using the zebrafish model93
because we could observe the rapid embryonic development of zebrafish and manipulate94
its embryos outside of the parental animal (24-26). Furthermore, zebrafish have been used95
to study the viral gene function and pathogenesis of ISKNV as previously described96
(27-31). Here, we demonstrated that ORF119L interacts with PINCH and affects the97
binding of ILK to PINCH, which leads to cardiovascular defects in zebrafish likely derived98
from its ability to reduce ILK-mediated AKT phosphorylation. Consistent with this,99
inhibiting the endogenous zebrafish ILK effectively mimics ORF119L-induced abnormal100
phenotype. Taken together, our data suggest that ISKNV ORF119L may function as a novel101
6. 6
DNI-like factor of ILK.102
103
Materials and Methods104
Collection of ISKNV-infected fish and isolation of viral DNA105
The moribund mandarin fish showing the common symptom of ISKNV infection were106
collected and kept at -80°C. ISKNV infection in mandarin fish, virus purification, and viral107
DNA extraction (Universal Genomic DNA Extraction Kit Ver.3.0, TaKaRa, Dalian, China)108
were performed as described previously (5, 27).109
110
Zebrafish maintenance, plasmid construction and micro-injection111
A zebrafish transgenic line, Tg (flk1:GFP) expressing an green fluorescence protein (GFP)112
that is driven by the zebrafish flk1(also known as vascular endothelial growth factor113
receptor) promoter was used with the Wild-type zebrafish as the control group. All114
zebrafish were maintained at 28°C as previously described (31). Zebrafish embryos were115
kept in E3 zebrafish water containing 5.0 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33116
mM MgSO4, pH=7.4 at 28.5°C and their developmental stages were defined as hour117
post-fertilization (hpf) or day post-fertilization (dpf) (27, 32). To construct the plasmids for118
micro-injection in zebrafish embryos, the full-length of ISKNV ORF119L was PCR119
amplified (Primers in Table. 1) using the ISKNV genomic DNA. The PCR products were120
subcloned into the pDsRed2-C1 (Takara Bio Company, Clontech; Mountain View, CA) to121
generate the RFP-ORF119L expressing plasmid pRFP-ORF119L. Similarly, the ORF119L122
PCR products were subcloned into the pEGFP-N3 vector (Clontech; Mountain View, CA)123
to generate the ORF119L-EGFP expressing plasmid pORF119L-EGFP. The124
7. 7
RFP-ORF119L or ORF119L-EGFP overexpressing embryos were simply named as125
ORF119L embryos hereafter. To over-express the ORF119L mutant lacking the126
3ANK-containing domain (119LΔ3ANK), the 119LΔ3ANK sequence was PCR amplified127
and subcloned into the pEGFP-N3 plasmid to generate the 119LΔ3ANK-EGFP expressing128
plasmid p119LΔ3ANK-EGFP. The zebrafish first strand cDNA was synthesized as129
previously described (31). To over-express the 3ANK domain of ILK (ILK3ANK),130
zebrafish ILK3ANK sequence (without the ILK kinase domain) was PCR amplified from131
zebrafish cDNA, and then subcloned into the pEGFP-N3 vector to generate the132
ILK3ANK-EGFP expressing plasmid pILK3ANK-EGFP. All plasmids and inserts were133
confirmed by bi-direction sequencing. The protocol of plasmids micro-injection and image134
capture was described previously (31). Briefly, the plasmids were linearized and purified135
(QIAquick PCR Purification Kit, USA), and resuspended in water at 100 ng/ul. Plasmids136
were micro-injected (IM300 Microinjector, Narishige, Japan) into one-cell stage zebrafish137
embryos at 1 nl per embryo. Embryos were captured at different developmental stages138
using an OlympusDP71 digital camera mounted onto an OLYMPUS MVX10 fluorescence139
stereomicroscope.140
141
Bioinformatics analysis142
A BLAST (Basic Local Alignment Search Tool) (33) search was performed to compare the143
ISKNV ORF119L protein sequence to the NCBI (National Center for Biotechnology144
Information) zebrafish protein database (39495 reference sequence). Phylogenetic tree145
analysis was performed using the Fast Minimum Evolution method (34). Domains feature146
from different proteins were analyzed by SMART program147
8. 8
(http://smart.embl-heidelberg.de/) (35). The model structure of the proteins were generated148
using the SWISS-MODEL Workspace (http://swissmodel.expasy.org/workspace/) (36).149
Multiple sequence alignments were performed as described previously150
(http://www.ebi.ac.uk/Tools/clustalw) (37).151
152
Immunofluorescence staining153
To examine the intracellular distribution of PINCH in the presence or absence of ORF119L,154
MYC-ORF119L, MYC-ILK, and FLAG-PINCH fusion protein expressing plasmids were155
constructed. The full-length of ORF119L and 119LΔ3ANK was PCR amplified (Primers in156
Table. 1) by using the ISKNV genomic DNA, and subcloned into pc-Myc-CMV-2 vector157
(SIGMA; Ronkonkoma, NY, USA) to generate the MYC-ORF119L and158
MYC-119LΔ3ANK expressing plasmid pMYC-ORF119L and pMYC-119LΔ3ANK,159
respectively. The full-length of zebrafish ILK and PINCH was PCR amplified (Primers in160
Table. 1) by using the zebrafish cDNA, subcloned into pc-Myc-CMV-2 and161
pFLAG-CMV-2 vector (SIGMA; Ronkonkoma, NY, USA) to generate the MYC-ILK162
expressing plasmid pMYC-ILK and FLAG-PINCH expressing plasmid pFLAG-PINCH,163
respectively. Fathead minnow (FHM) cells were cultured on coverslips, and transfected164
with pMYC-ORF119L, pMYC-ILK, and pFLAG-PINCH (as specified in each165
experiment). One day post-transfection, the samples were fixed by methanol for 30166
minutes at 4°C. After washing in three changes of PBS and blocking (PBS with 10%167
normal blocking serum), samples were incubated with 1:500 diluted primary antibodies168
(rabbit anti-FLAG antibody and mouse anti-MYC antibody, Sigma) overnight at 4°C.169
After washing for 3 times, the cells were incubated in 1:500 diluted secondary antibodies170
9. 9
[Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) antibody, and Alexa Fluor 555 Goat171
Anti-Rabbit IgG (H+L) antibody, Life technologies] for 1 hour at room temperature in the172
dark. Heochst 33342 was then applied for nucleus staining. After rinsing for 5 times in PBS,173
cells were examined under ZEISS LSM7 DUO NLO confocal microscope.174
175
GST pull-down assay176
The full-length of zebrafish ILK, and ISKNV ORF119L were PCR amplified (Primers in177
Table. 1) and subcloned into pGEX-4T-1 vector (GE Healthcare) to generate the GST-ILK178
expressing plasmid pGST-ILK, and GST-ORF119L expressing plasmid pGST-ORF119L,179
respectively. Plasmid pGEX-4T-1, pGST-ILK, and pGST-ORF119L were transformed into180
Escherichia coli (E. coli) BL21 cells to express GST, GST-ILK, and GST-ORF119L,181
respectively. Human embryonic kidney 293T (HEK293T) cells were cultured in182
Dulbecco’s Modified Eagle’ Medium with 10% fetal bovine serum at 5% CO2. Plasmid183
pFLAG-PINCH was transfected (Lipofectamine 2000, Life Technologies) into HEK293T184
cells (cultured in 10 cm plate) to express the FLAG-PINCH fusion proteins. GST185
pull-down assays were performed as described previously (31), according to the186
manufacturer's instructions (MagneGSTTM
Pull-Down System, Promega, Madison, WI,187
USA). Briefly, 1 ml GST, GST-ILK, and GST-ORF119L expressing BL21 bacterial cells188
were harvested, lysed by 200 μl of MagneGSTTM
Cell Lysis Reagent, incubated for 30189
minutes on a rotating platform, and then precleared lysats were added into the tube190
containing the pre-equilibrated MagneGSTTM
Glutathione particles (20 μl for each sample).191
After incubating for 30 minutes at room temperature, the GST control, GST-ILK, and192
GST-ORF119L immobilized particles were captured by a magnet stand; the particles were193
10. 10
then washed by MagneGSTTM
Binding/Wash Buffer for 5 minutes at three times, and194
resuspended in 20 μl MagneGSTTM
Binding/Wash Buffer. Aliquots of 5 μl of particles195
bound to the GST control, GST-ILK, GST-ORF119L fusion protein, respectively, were196
saved for analysis of the specificity and efficiency of immobilization by Coomassie197
staining of SDS-PAGE. The FLAG-PINCH expressing HEK293T cells were lysed by 1 ml198
cell lysis buffer (Beyotime, Jiangsu, China) containing the phosphatase/protease inhibitor199
cocktail. 100 μl cell lysate was saved at -20°C for loading control, and the other 800 μl was200
added into the GST control, GST-ILK, and GST-ORF119L pre-immobilized particles,201
respectively, and incubated for 1hour at room temperature on a rotating platform.202
Non-specific binding was removed by washing in 400 μl MagneGSTTM
Binding/Wash203
Buffer for 5 minutes at five times. Finally, the FLAG-PINCH bound to particles were204
released by boiling in 20 μl 1X SDS loading buffer for 5 minutes. The samples were205
analyzed by Western blotting (rabbit anti-FLAG antibody, Life technologies).206
207
Co-immunoprecipitation (CO-IP) assay208
HEK293T cells were cultured in complete medium in 10 cm culture plates. Transfected209
cells (as specified in each experiment) were rinsed twice with cold PBS, and directly lysed210
on the plate by 1 ml cell lysis buffer (Beyotime, Jiangsu, China) containing the211
phosphatase/protease inhibitor cocktail. Co-IP was performed according to the212
manufacturer’s instructions (Dynabeads® Protein G Immunoprecipitation Kit, Life213
technologies). Briefly, aliquots of 100-μl cell lysate were saved at -20°C for loading214
control, and the other 800-μl lysate was added into mouse anti-MYC antibody (Sigma)215
pre-immobilized on protein G beads and incubated for 1 hour at room temperature. The216
11. 11
beads were washed three times with PBS containing 0.1% Tween-20. Proteins bound to the217
beads were released by boiling in 20 μl 1X SDS loading buffer for 5 minutes. The samples218
were analyzed by Western blotting (rabbit anti-FLAG antibody, Life technologies). For219
CO-IP analysis with ORF119L-GFP co-expression, the 800-μl cell lysate was added to the220
pre-washed ANTI-FLAG M2 affinity gel (FLAG-Tagged Protein Immunoptrcipitation Kit;221
Sigma, Ronkonkoma, USA). The mixture of cell lysate and ANTI-FLAG resin was222
incubated for 4 hours (hrs) at 4°C on a rotating platform. The beads were washed for three223
times by 0.5 ml of 1x Wash Buffer (0.5 M Tris HCl, pH 7.4, with 1.5 M NaCl). Proteins224
bound to the beads were released by boiling for 5 minutes in 20 μl 1X SDS loading buffer.225
The samples were analyzed by Western blotting (mouse anti-MYC antibody, Sigma).226
227
Whole mount alkaline phosphatise (AP) staining228
Zebrafish embryos at 3 dpf were fixed in 4% para-formaldehyde (PFA) in PBS for 2 hrs at229
room temperature. Fixed embryos were dehydrated in methanol and stored overnight at230
-20°C. After permeabilization in acetone at -20°C for 30 mins, embryos were washed in231
PBS and were incubated in staining buffer for 45 mins as described (38, 39). Briefly, the232
staining reaction was started by adding 5 μL nitro blue233
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche: Basel,234
Switzerland) per milliliter of staining buffer, and stopped by washing in PBST buffer, 5235
mins for three times. The stained embryos were mounted in 70% glycerol and all images236
were captured using an OlympusDP71 digital camera mounted to an OLYMPUS MVX10237
fluorescence stereomicroscope (Olympus, Tokyo, Japan).238
239
12. 12
Hematoxylin-eosin (H&E) and transmission electron microscopy (TEM) analysis240
For H&E staining, samples were collected and treated as described (40). Samples were241
paraffin sectioned at 5 μm using a Leica RM2145 microtome, and then H&E staining was242
performed using standard protocol. For TEM, samples were dechorionated and fixed in243
Karnofsky’s fixative (2% paraformaldehyde, 2.5% glutaraldehyde, 5% sucrose, 0.1%244
CaCl2, in 0.2 M cacodylate buffer pH 7.2) overnight at 4°C. Samples were then washed245
three times with 0.1 M phosphate buffer for 1 h at 4°C, dehydrated in graduated ethanol246
series and embedded in Spurr’s resin. The blocks were sectioned and double-stained with247
uranyl acetate and lead citrate (41). The samples were examined under a Philips CM10248
electron microscope (Philips, Eindhoven, Netherlands).249
250
Whole mount RNA in situ hybridization251
Atrial natriuretic factor (anf) is a cardiac stretch-responsive gene, and used as a maker for252
development of zebrafish ventricle and atrium during early embryogenesis (21). Partial253
cDNA sequences of zebrafish anf were amplified by PCR and cloned into pGEM-T easy254
vector (Promega, Madison, WI, USA) as templates to generate an antisense riboprobe255
(DIG RNA Labelling Kit, Roche Applied Science, Germany) for in situ hybridization in256
the embryos (31). Briefly, embryos were incubated in 0.003% 1-phenyl-2-thiourea (PTU,257
Sigma, USA) to block pigmentation. Embryos were fixed at 4% PFA at room temperature258
for 4 hrs, and dehydrated in methanol at -20°C overnight. After pre-hybridization at 65°C259
for 6hrs, embryos were incubated with the anf antisense RNA probe (0.25 ng/μl) buffer at260
65°C overnight. After washing and blocking, the embryos were incubated in alkaline261
phosphatise conjugated sheep anti-digoxigenin Fab antibody at 4°C overnight. After262
13. 13
30mins washing for 4 times in PBS with 0.1% tween-20, the anf expression signal was263
detected by incubating in the NBT/BCIP substrates.264
265
Antisense morpholino oligonucleotides-mediated gene knockdown266
Morpholino oligonucleotides (MO) (Gene Tools, LLC, USA), an antisense technology267
used as a research tool for reverse genetics to knock down gene expression, have been268
successfully applied in zebrafish model (42, 43). Sequence of antisense MO targeting the269
translation initiation site (ATG) of zebrafish ILK (ILK-MO,270
3’-TACCTACTGTAGAAGTGAGTCACGG-5’) was injected into one-cell stage embryos271
(21, 44, 45). A standard control MO (Ctrl-MO) antisense oligonucleotide was injected at272
the same concentrations (27). Embryos were maintained in E3 medium at 28 °C until273
analyzed.274
275
Quantitative real-time PCR (qRT-PCR) assay276
Total RNA was extracted from thirty embryos of different treatments, and reverse277
transcribed into first strand cDNA as described previously (31, 46). The anf, nkx2.5, and278
cmlc2 specific primers (Table S1) were used to analyze their transcription quantitatively in279
different groups of embryos by a LightCycler480 System (Roche, Germany). The280
transcription of anf, nkx2.5, and cmlc2 were assayed in triplicate. The zebrafish GAPDH281
was used as house-keeping gene to normalize the starting RNA quantity. The fold change282
of gene transcription levels were calculated using the 2-ΔΔCt
relative quantification method.283
284
Statistical analysis285
14. 14
The data were presented as means ± standard error of the mean (SEM). Student’s t-test was286
used to calculate the comparisons between groups of numerical data. Statistically287
significance were represented with asterisk (*, p<0.05, or **, p<0.01).288
289
Results290
Sequence of ORF119L resembles the dominant-negative form of ILK291
Through a genome-wide search for viral genes responsible for virus-host interactions that292
are critical to viral pathogenesis, we found several ankyrin-repeats containing genes in293
ISKNV. One of these genes, ISKNV ORF119L, 1371 base pairs (bp) long, is predicted to294
encode a protein of 456-amino acid (aa) residues with a predicted molecular weight of 50.1295
kDa. The BLAST analysis of ISKNV ORF119L revealed 30 highly similar sequences that296
are clustered with gene for ILK (Figure 1A). ISKNV ORF119L contains a three297
ankyrin-repeats domain (3ANK, 59-152aa) which is aligned with ILK of zebrafish, mouse,298
and human (Figure 1B). In zebrafish, mouse, and human ILK, a kinase domain is localised299
at the COOH-terminal end. However, in the COOH-terminus of ORF119L, only three300
separated ankyrin motifs were found without kinase domain (Figure 1B). The model301
structure of the 3ANK domain from ISKNV ORF119L (Figure 1C) shows high similarity to302
the 3ANK domain from human ILK (Figure 1D). The 3ANK of ISKNV ORF119L is 42%303
identical to those of ILK from zebrafish, 43% to mouse, and 43% to human (Figure 1E). In304
addition, ISKNV ORF119L shares an overall identity of 92% by the multiple sequence305
alignment analysis with an orthologous found in red sea bream iridovirus (RSIV), 93% in306
orange-spotted grouper iridovirus (OSGIV), and 92% in turbot reddish body iridovirus307
(TRBIV) (Figure 2A). Thus, ORF119L is evolutionarily conserved among308
15. 15
megalocytiviruses including RSIV, OSGIV and TRBIV. All of these sequence analyses309
suggest that the viral 3ANK homologues might be unique among the megalocytiviruses,310
implying that they play a specific role in megalocytivirus pathogenesis. Specifically, we311
wanted to determine the functional consequence of ISKNV ORF119L expression in312
virus-host interactions.313
314
ORF119L directly interacts with PINCH to affect the PINCH-ILK interaction315
The NH2-terminal 3ANK domain of ILK is critical for its binding to the LIM domain of316
PINCH and the formation of PINCH-ILK-Parvin complex in a host (22). Since we found317
out the high similarity of 3ANK structure between the viral ORF119L and the host ILK, we318
hypothesized that ORF119L might directly bind to PINCH in virus-host interactions. An319
immunefluorescence microscopy analysis showed that zebrafish ILK and PINCH were320
co-localized in the cytoplasm in the absence of ORF119L in fish FHM cells (Figure 2B-2E).321
However, co-expression of viral ORF119L shifted PINCH to be co-localized with322
ORF119L in both cytoplasm and nucleus (Figure 2F-2I), suggesting that ORF119L might323
directly interact with PINCH.324
325
We performed a GST pull-down assay to explore the binding of ORF119L with PINCH326
(Figure 3A). Coomassie blue staining of SDS-PAGE showed the homogeneity of GST,327
GST-ILK, and GST-ORF119L proteins obtained by GST-tag affinity purification (Figure328
3A, panel 3). When GST, GST-ILK, or GST-ORF119L bound magnetic beads were329
respectively incubated with a cellular lysate containing FLAG-tagged PINCH proteins, we330
found that PINCH specifically bound to GST-ILK fusion protein (positive control) (Figure331
16. 16
3A, lane 2, panel 2) or GST-ORF119L fusion protein (Figure 3A, lane 3, panel 2) but not to332
GST alone (negative control) (Figure 3A, lane 1, panel 2), demonstrating that viral333
ORF119L directly bound to the zebrafish PINCH.334
335
We further confirmed the above results with a mammalian expression system. We336
co-expressed the MYC-ORF119L and FLAG-PINCH in HEK293T cells, and then337
performed a CO-IP assay (Figure 3B). When incubating the cell lysates with the anti-MYC338
antibody pre-immobilized on protein G beads, we found that MYC-ORF119L specifically339
co-immunoprecipitated with FLAG-PINCH (Figure 3B, lane 3, panel 3), but not with other340
controls (Figure 3B, lane 1, lane 2, panel 3), confirming the direct binding of ORF119L341
with PINCH. Subsequently, we generated an ORF119L mutant lacking the342
3ANK-containing domain (designated as 119LΔ3ANK) to investigate the binding domain343
of ORF119L to PINCH by the CO-IP assay. Cell lysates containing FLAG-PINCH (Figure344
3C, lane 1), MYC-119LΔ3ANK (Figure 3C, lane 2), FLAG-PINCH + MYC-119LΔ3ANK345
(Figure 3C, lane 3), or FLAG-PINCH + MYC-ILK (Figure 3C, lane 4) fusion proteins346
were separately incubated with the anti-MYC antibody pre-immobilized protein G beads.347
We found that FLAG-PINCH was specifically co-immunoprecipitated with MYC-ILK348
(Figure 3C, lane 4, panel 3, as positive control), but not with the 119LΔ3ANK (Figure 3C,349
lane 3, panel 3), demonstrating that the deletion of 3ANK-containing domain abolished the350
ORF119L-PINCH interaction.351
352
We then tried to test whether ORF119L could affect the PINCH-ILK interaction in cells. A353
CO-IP assay was performed with co-expression of PINCH and ILK in cells in the absence354
17. 17
or presence of ORF119L (Figure 3D). In the absence of ORF119L, cell lysates containing355
FLAG-PINCH, MYC-ILK, or FLAG-PINCH + MYC-ILK fusion proteins were separately356
incubated with anti-FLAG (M2) monoclonal antibody-conjugated agarose beads. After357
three washes to remove non-specific binding and then followed with anti-MYC antibody358
detection, we found that MYC-ILK was co-immunoprecipitated with FLAG-PINCH in the359
sample containing FLAG-PINCH and MYC-ILK (Figure 3D, lane 3, left panel 3), but not360
in the FLAG-PINCH alone (Figure 3D, lane1, left panel 3), or MYC-ILK alone (Figure 3D,361
lane 2, left panel 3), demonstrating that PINCH interacts with ILK. However, in the362
presence of ORF119L in the same system as above, when ORF119L expression was363
increased (Figure 3D, lanes 4-6, right panel 1), the bound MYC-ILK fusion proteins was364
decreased (Figure 3D, lane 4-5, right panel 4) and diminished (Figure 3D, lane 6, right365
panel 4). This suggests that FLAG-PINCH binding to MYC-ILK was attenuated with the366
escalated levels of ORF119L expression, implying that ISKNV ORF119L competed with367
ILK for binding PINCH in a dose-dependent manner. To test the specificity of the368
competitive binding effect of ISKKV ORF119L, we performed the PINCH-ILK CO-IP369
assay in the presence of 119LΔ3ANK mutant. Importantly, when co-expression of370
119LΔ3ANK mutant was increased (Figure 3E, panel 1), the bound FLAG-PINCH fusion371
proteins was not affected (Figure 3E, panel 4), demonstrating that the 3ANK-containing372
domain is critical for the competitive binding activity of ORF119L to PINCH.373
374
ORF119L overexpression affects zebrafish embryogenesis375
To explore the functions of ORF119L in vivo, we microinjected a recombinant plasmid376
expressing ORF119L-EGFP into wild-type zebrafish embryos while using an empty vector377
18. 18
as a control. While the mock vector-injected embryos did not show any phenotypic378
abnormality from 4 hpf (hours post fertilization) to 4 dpf (days post fertilization) (Figure379
4A-4F), the ORF119L-EGFP-injected embryos developed normally at 4 hpf (Figure 4G),380
12 hpf (Figure 4H), and 1 dpf (Figure 4I). However, pericardial edema (Figure 4J, arrow)381
and opaque yolk sac phenotype (Figure 4K, asterisk) were evident at 2 dpf and 3 dpf,382
respectively, in the ORF119L-EGFP-injected embryos. These embryos became less active383
at 4 dpf (Figure 4L), and most of them were dead at 5 dpf (data not shown). In contrast,384
embryos overexpressing the 119LΔ3ANK mutant were relatively normal from 4 hpf to 4385
dpf (Figure 4M-4R). We observed GFP expression among the mock vector control,386
ORF119L-EGFP and 119LΔ3ANK-EGFP expressing embryos at 12 hpf (Figure 4S-4U),387
indicating that ORF119L expression contributed to the abnormal embryogenesis. In388
ORF119L expressing embryos at 3 dpf, we found statistically significant developmental389
defects of cardiac edema (Figure 4V, mock, 4.58% ± 2.18%; ORF119L, 79.79% ± 6.93%;390
p=0.005), opaque yolk (Figure 4W, mock, 4.80% ± 1.79%; ORF119L, 83.12% ± 3.51%;391
p=7E-04), and slow blood cells circulation (Figure 4X, mock, 3.56% ± 0.37%; ORF119L,392
81.65% ± 3.76%; p=9E-04). In contrast, these defects were significantly reduced in393
119LΔ3ANK-expressing embryos (Figure 4V-4X).394
395
ORF119L overexpression disturbs embryonic angiogenesis in zebrafish396
Previous reports show that ILK is crucial for the vascular basement membrane397
development during certain angiogenic sprouting (47, 48). Thus, we tested whether398
ORF119L could affect the embryonic angiogenesis. An RFP-ORF119L (Red Fluorescent399
Protein-tagged ORF119L) expressing plasmid was microinjected into Tg (flk1:GFP)400
19. 19
transgenic zebrafish embryos (GFP expression is driven by the vascular endothelium cells401
specific promoter flk1). Compared to the normal conformation of intersegmental vessel402
(ISV) in mock vector-injected embryos at 3 dpf (Figure 5A), ISV was severely disrupted in403
ORF119L expressing embryos (Figure 5B). In a whole mount AP staining assay,404
pronephric duct (PD), subintestinal vessels (SIV), and posterior cardinal veins (PCV) were405
normal in the control embryos (Figure 5C-D, and 5G-H). However, overexpressing406
ORF119L led to the absence of SIV and PCV but no effects on PD (Figure 5E-F, and 5I-J).407
In contrast, embryos expressing 119LΔ3ANK mutant did not show any ISV defects408
(Figure 5K and 5L).409
410
ORF119L overexpression induces cardiac defects in zebrafish411
ORF119L over-expressing embryos make evident pericardial edema and stretched heart,412
which are highly similar to the abnormal phenotype of zebrafish ILKL308P
kinase-dead413
mutant (21, 49). This led us to perform the histological and ultra-cellular analysis to414
delineate the detailed cardiac defects in ORF119L embryos. In an H&E staining assay, the415
structure of ventricle and atrium were normal in mock vector control embryos (Figure 6A416
and 6C). However, a stretched heart (Figure 6B), an enlarged pericardial cavity (Figure 6D,417
PC) and a thinner ventricular wall (Figure 6D, arrowheads) were clearly observed in418
ORF119L expressing embryos. In a TEM analysis of the embryonic ventricle, sarcomeric419
structure was clearly found in mock control embryos (Figure 6E, S*), whereas it became420
sparse and immature in ORF119L expressing embryos (Figure 6F, S*). Distinct Z-disk, A421
band, and I band in the sarcomere were shown in the mock control embryos (Figure 6G). In422
contrast, sarcomeric Z-disk was disappeared in ORF119L expressing embryos (Figure 6H).423
20. 20
Intriguingly, similar disruption of sarcomeric Z-disk was also found in the mandarin fish424
cardiomyocytes after 5 days (Figure 7E-F) and 7 days (Figure 7G-H) post ISKNV425
infection.426
427
ORF119L overexpression resembles the effect of ILK inhibition428
All of above results prompted us to speculate a mechanism by which the ISKNV429
ORF119L-induced abnormal phenotype might ascribe to dysfunctional ILK signaling. We430
blockaded the endogenous ILK expression, either by expressing the dominant-negative431
form of ILK (ILK-DN) or by injecting ILK antisense morpholino oligo (ILK-MO). While432
the heart development in the standard control MO (Ctrl-MO)-injected embryos (Figure433
8A), as well as the mock vector-injected and 119LΔ3ANK-overexpressing embryos (as434
shown in Figure 4A-4F and 4M-4R) were relatively normal at 3 dpf, However; inhibition435
of endogenous ILK by either ILK-DN overexpression (Figure 8G, arrowhead), or by436
ILK-MO injection (Figure 8J, arrowhead), resulted in evident pericardial edema similar to437
the pattern found in ORF119L-expressing embryos (Figure 8D, arrowhead, and 8M).438
Because the heart beating rate was hard to quantify by using our experimental device, here439
we used atrial natriuretic factor (anf) (21) as a marker of heart development in the whole440
mount in situ hybridization analysis. While anf transcription was normal in ventricle (v)441
and atrium (a) in Ctrl-MO-injected embryos at 2 dpf (Figure 8B) and 3 dpf (Figure 8C), anf442
transcription was impaired in ORF119L expressing embryos (Figure 8E-F), ILK-DN443
expressing embryos (Figure 8H-I), and ILK-MO expressing embryos (Figure 8K-L),444
respectively. Besides, the percentage of the cardiac edema was similar among the445
ORF119L-overexpressing, ILK-DN-overexpressing, and ILK-MO-injected embryos at 3446
21. 21
dpf (Figure 8M). Furthermore, phosphorylation of AKT, a downstream effector of ILK,447
was decreased in ORF119L expressing embryos (Figure 8N). Compared with the448
Ctrl-MO-injected embryos, ORF119L-overexpressing, ILK-DN-overexpressing, and449
ILK-MO-injected embryos showed decreased transcription of the cardiac markers anf450
(Figure 8O), as well as nkx2.5 (Figure 8P), and cmlc2 (Figure 8Q) by the qRT-PCR assay,451
demonstrating that ORF119L may affect the cardiac function.452
453
Discussion454
In this study, we identified a three ankyrin-repeats domain-containing protein (ISKNV455
ORF119L) from a megalocytivirus. In vitro studies show that ORF119L directly interacts456
with zebrafish PINCH and affects the binding of PINCH to ILK. In vivo studies show that457
overexpression of ORF119L in zebrafish predominantly affect angiogenic and cardiac458
system. Phosphorylation of AKT, a downstream effector of ILK, was decreased in459
ORF119L overexpressing embryos. Intriguingly, ISKNV infection alters the cardiac460
sarcomeric structure of mandarin fish. Besides, ORF119L-induced phenotypes are similar461
to the abnormality derived from the expression of dominant-negative ILK kinase-dead462
mutant in zebrafish.463
464
When a mutant subunit of a multi-subunit complex is co-expressed with a functionally465
related wild-type protein, a dysfunctional complex is formed due to the dominant-negative466
inhibitory (DNI) effect (50, 51). The DNI phenomenon has been reported in mammals,467
such as the wild-type p53 inhibited by ΔNp73 (52), NF-κB inhibited by IκBm (53), C/EBP468
inhibited by CHOP (54), and promyelocytic leukemia zinc finger protein (PLZF) inhibited469
22. 22
by AML-1/ETO fusion protein (34). Viral DNI factors also have been reported, such as the470
human cytomegalovirus-derived truncated unique short 3 (US3) isoform (55),471
Epstein-Barr virus EBNA-1 (56). In this study, we demonstrate that escalated expression of472
ISKNV ORF119L attenuates the PINCH-ILK interaction, affects the cardiomyocytes473
development in zebrafish and decreases the AKT phosphorylation. In fact, we further show474
that the 119LΔ3ANK mutant did not bind to PINCH and the escalated expression of475
119LΔ3ANK mutant did not show the competitive binding effect on the PINCH-ILK476
interaction. Moreover, overexpression of the 119LΔ3ANK mutant in vivo did not affect the477
embryonic morphology and their cardiovascular system, consolidating that the ILK-like478
dominant-negative inhibiting effect of ISKNV ORF119L is due to the 3ANK-containing479
domain. Therefore, we propose that ISKNV ORF119L as a novel ILK-like480
dominant-negative inhibitor most likely due to the fact that ISKNV ORF119L contains a481
3ANK-containig domain and lacks the kinase domain of ILK.482
483
ILK-mediated PINCH/AKT signal transduction functions as the cardiac mechanical stretch484
sensor machinery and plays a crucial role for contractility in the zebrafish heart (21, 57). In485
an ethylnitros-urea (ENU) mutagenesis screening, Garnet Bendig and colleagues identified486
a main squeeze (msq) zebrafish mutant, which contains a point mutation (L308P) in the487
kinase domain of ILK. The msq ILKL308P
mutation leads to reduced ILK kinase activity and488
cardiac defects in zebrafish embryos (21). In line with these findings, we show that489
ORF119L is a three ankyrin-repeats domain-containing protein without kinase domain.490
Overexpression of ORF119L induces a stretched heart in zebrafish. In addition, we showed491
reduced expression of cardiac marker anf by WISH and qRT-PCR assay (not significant in492
23. 23
qRT-PCR assay because of the variation of the triplicate experiments) in493
ORF119L-overexpressing embryos. Likewise, additional cardiac markers such as nkx2.5494
and cmlc2 were consistently and significantly reduced after ORF119L overexpression,495
providing the evidence that ORF119L may affect the cardiac function. We hypothesized496
that the cardiac defects may result from disrupting the ILK-PINCH interaction thereby497
decreasing the phosphorylation of AKT. In fact, both ILK and PINCH localise at the498
sarcomeric Z-disk in the zebrafish heart and skeletal muscle (21, 57), and are pivotal for the499
sarcomeric cytoarchitecture and Z-disk integrity (58). In keeping with these, we also show500
the disorganized sarcomere and disintegrated Z-disk of cardiomyocytes in501
ORF119L-expressing embryos. Intriguingly, ISKNV infection leads to the disordered502
sarcomere and Z-disk in the mandarin fish cardiomyocyte, providing a potential503
explanation for low vitality in mandarin fish showing accelerated breathing and dyspnea as504
shown previously (59). Taken together, our studies on ORF119L might provide novel505
insights into the pathogenesis of ISKNV infection.506
507
The complex formed by PINCH-ILK-Parvin provides crucial physical linkages between508
integrins and the actin cytoskeleton for transducing diverse signals from extracellular509
matrix to intracellular effectors (60). In this study, we demonstrated that ORF119L510
attenuates the binding of PINCH to ILK and induces cardiomyocytes defects in zebrafish.511
However, it remains to be determined for the effects of ORF119L on the function of Parvin512
and on the function of spleen or kidney necrosis.513
514
Acknowledgement515
24. 24
We sincerely thank Dr. Zi-Liang Wang, Dr. Xiao-Peng Xu, Dr. Jun-Feng Xie, Dr. Jing516
Wang for technical assistance; Dr. Chuan-Fu Dong for providing the ISKNV virus and fish517
cell lines, Ms. Qiu-Ling Liang for help in cell culture, and Mr. Hai-Bin Liu for careful518
zebrafish maintenance. We wish to thank Prof. Wen-qing Zhang (Southern Medical519
University, Guangzhou, China) for providing the zebrafish line. This work was supported520
by the National Natural Science Foundation of China under Grant (No.31330080,521
No.31322056, and No.31370048), the National Basic Research Program of China522
(973Program) (No.2012CB114402), the Guangdong Natural Science Foundation523
(No.S2013010012161), the Pearl River Nova Program of Guangzhou (No.2014J2200055),524
the Foundation for Yong Teacher (No.20130171220009), and the Doctoral student525
innovative talent training projects of the Sun Yat-sen University.526
527
25. 25
Reference528
1. He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX, Wang XZ, Chan SM. 2001.529
Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis530
iridovirus. Virology 291:126-139.531
2. Lu L, Zhou SY, Chen C, Weng SP, Chan SM, He JG. 2005. Complete genome532
sequence analysis of an iridovirus isolated from the orange-spotted grouper, Epinephelus533
coioides. Virology 339:81-100.534
3. Chen XH, Lin KB, Wang XW. 2003. Outbreaks of an iridovirus disease in maricultured535
large yellow croaker, Larimichthys crocea (Richardson), in China. J Fish Dis 26:615-619.536
4. Sudthongkong C, Miyata M, Miyazaki T. 2002. Iridovirus disease in two ornamental537
tropical freshwater fishes: African lampeye and dwarf gourami. Dis Aquat Organ538
48:163-173.539
5. Dong C, Weng S, Shi X, Xu X, Shi N, He J. 2008. Development of a mandarin fish540
Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis541
virus (ISKNV). Virus Res 135:273-281.542
6. Wang YQ, Lu L, Weng SP, Huang JN, Chan SM, He JG. 2007. Molecular543
epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney544
necrosis virus-like (ISKNV-like) virus. Arch Virol 152:763-773.545
7. Werden SJ, Lanchbury J, Shattuck D, Neff C, Dufford M, McFadden G. 2009. The546
myxoma virus m-t5 ankyrin repeat host range protein is a novel adaptor that coordinately547
links the cellular signaling pathways mediated by Akt and Skp1 in virus-infected cells. J548
Virol 83:12068-12083.549
8. Werden SJ, Barrett JW, Wang G, Stanford MM, McFadden G. 2007. M-T5, the550
ankyrin repeat, host range protein of myxoma virus, activates Akt and can be functionally551
replaced by cellular PIKE-A. J Virol 81:2340-2348.552
26. 26
9. Blanie S, Gelfi J, Bertagnoli S, Camus-Bouclainville C. 2010. MNF, an ankyrin repeat553
protein of myxoma virus, is part of a native cellular SCF complex during viral infection.554
Virol J 7:56.555
10. Sonnberg S, Fleming SB, Mercer AA. 2011. Phylogenetic analysis of the large family of556
poxvirus ankyrin-repeat proteins reveals orthologue groups within and across557
chordopoxvirus genera. J Gen Virol 92:2596-2607.558
11. Sonnberg S, Seet BT, Pawson T, Fleming SB, Mercer AA. 2008. Poxvirus ankyrin559
repeat proteins are a unique class of F-box proteins that associate with cellular SCF1560
ubiquitin ligase complexes. Proc Natl Acad Sci U S A 105:10955-10960.561
12. Meng X, Xiang Y. 2006. Vaccinia virus K1L protein supports viral replication in human562
and rabbit cells through a cell-type-specific set of its ankyrin repeat residues that are563
distinct from its binding site for ACAP2. Virology 353:220-233.564
13. Guo CJ, Chen WJ, Yuan LQ, Yang LS, Weng SP, Yu XQ, He JG. 2011. The viral565
ankyrin repeat protein (ORF124L) from infectious spleen and kidney necrosis virus566
attenuates nuclear factor-kappaB activation and interacts with IkappaB kinase beta. J Gen567
Virol 92:1561-1570.568
14. Wickstrom SA, Lange A, Montanez E, Fassler R. 2010. The ILK/PINCH/parvin569
complex: the kinase is dead, long live the pseudokinase! EMBO J 29:281-291.570
15. Legate KR, Montanez E, Kudlacek O, Fassler R. 2006. ILK, PINCH and parvin: the571
tIPP of integrin signalling. Nat Rev Mol Cell Biol 7:20-31.572
16. Chiswell BP, Zhang R, Murphy JW, Boggon TJ, Calderwood DA. 2008. The structural573
basis of integrin-linked kinase-PINCH interactions. Proc Natl Acad Sci U S A574
105:20677-20682.575
17. Yang Y, Wang X, Hawkins CA, Chen K, Vaynberg J, Mao X, Tu Y, Zuo X, Wang J,576
Wang YX, Wu C, Tjandra N, Qin J. 2009. Structural basis of focal adhesion localization577
of LIM-only adaptor PINCH by integrin-linked kinase. J Biol Chem 284:5836-5844.578
27. 27
18. Wu C. 1999. Integrin-linked kinase and PINCH: partners in regulation of cell-extracellular579
matrix interaction and signal transduction. J Cell Sci 112 ( Pt 24):4485-4489.580
19. Velyvis A, Yang Y, Wu C, Qin J. 2001. Solution structure of the focal adhesion adaptor581
PINCH LIM1 domain and characterization of its interaction with the integrin-linked kinase582
ankyrin repeat domain. J Biol Chem 276:4932-4939.583
20. Moik D, Bottcher A, Makhina T, Grashoff C, Bulus N, Zent R, Fassler R. 2013.584
Mutations in the paxillin-binding site of integrin-linked kinase (ILK) destabilize the585
pseudokinase domain and cause embryonic lethality in mice. J Biol Chem586
288:18863-18871.587
21. Bendig G, Grimmler M, Huttner IG, Wessels G, Dahme T, Just S, Trano N, Katus588
HA, Fishman MC, Rottbauer W. 2006. Integrin-linked kinase, a novel component of the589
cardiac mechanical stretch sensor, controls contractility in the zebrafish heart. Genes Dev590
20:2361-2372.591
22. Zhang Y, Guo L, Chen K, Wu C. 2002. A critical role of the PINCH-integrin-linked592
kinase interaction in the regulation of cell shape change and migration. J Biol Chem593
277:318-326.594
23. Guo L, Wu C. 2002. Regulation of fibronectin matrix deposition and cell proliferation by595
the PINCH-ILK-CH-ILKBP complex. FASEB J 16:1298-1300.596
24. Ellett F, Lieschke GJ. 2010. Zebrafish as a model for vertebrate hematopoiesis. Curr Opin597
Pharmacol 10:563-570.598
25. Eimon PM, Ashkenazi A. 2010. The zebrafish as a model organism for the study of599
apoptosis. Apoptosis 15:331-349.600
26. Ma AC, Chung MI, Liang R, Leung AY. 2010. A DEAB-sensitive aldehyde601
dehydrogenase regulates hematopoietic stem and progenitor cells development during602
primitive hematopoiesis in zebrafish embryos. Leukemia.603
27. Wang ZL, Xu XP, He BL, Weng SP, Xiao J, Wang L, Lin T, Liu X, Wang Q, Yu XQ,604
28. 28
He JG. 2008. Infectious spleen and kidney necrosis virus ORF48R functions as a new viral605
vascular endothelial growth factor. J Virol 82:4371-4383.606
28. Xiang Z, Dong C, Qi L, Chen W, Huang L, Li Z, Xia Q, Liu D, Huang M, Weng S, He607
J. 2010. Characteristics of the interferon regulatory factor pairs zfIRF5/7 and their608
stimulation expression by ISKNV Infection in zebrafish (Danio rerio). Dev Comp609
Immunol 34:1263-1273.610
29. Li Z, Xu X, Huang L, Wu J, Lu Q, Xiang Z, Liao J, Weng S, Yu X, He J. 2010.611
Administration of recombinant IFN1 protects zebrafish (Danio rerio) from ISKNV612
infection. Fish Shellfish Immunol 29:399-406.613
30. Xu X, Zhang L, Weng S, Huang Z, Lu J, Lan D, Zhong X, Yu X, Xu A, He J. 2008. A614
zebrafish (Danio rerio) model of infectious spleen and kidney necrosis virus (ISKNV)615
infection. Virology 376:1-12.616
31. He BL, Yuan JM, Yang LY, Xie JF, Weng SP, Yu XQ, He JG. 2012. The viral TRAF617
protein (ORF111L) from infectious spleen and kidney necrosis virus interacts with618
TRADD and induces caspase 8-mediated apoptosis. PLoS One 7:e37001.619
32. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of620
embryonic development of the zebrafish. Dev Dyn 203:253-310.621
33. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment622
search tool. J Mol Biol 215:403-410.623
34. Desper R, Gascuel O. 2002. Fast and accurate phylogeny reconstruction algorithms based624
on the minimum-evolution principle. J Comput Biol 9:687-705.625
35. Letunic I, Goodstadt L, Dickens NJ, Doerks T, Schultz J, Mott R, Ciccarelli F,626
Copley RR, Ponting CP, Bork P. 2002. Recent improvements to the SMART627
domain-based sequence annotation resource. Nucleic Acids Res 30:242-244.628
36. Bordoli L, Kiefer F, Arnold K, Benkert P, Battey J, Schwede T. 2009. Protein structure629
homology modeling using SWISS-MODEL workspace. Nat Protoc 4:1-13.630
29. 29
37. Fukami-Kobayashi K, Saito N. 2002. [How to make good use of CLUSTALW].631
Tanpakushitsu Kakusan Koso 47:1237-1239.632
38. Habeck H, Odenthal J, Walderich B, Maischein H, Schulte-Merker S. 2002. Analysis633
of a zebrafish VEGF receptor mutant reveals specific disruption of angiogenesis. Curr Biol634
12:1405-1412.635
39. Serbedzija GN, Flynn E, Willett CE. 1999. Zebrafish angiogenesis: a new model for636
drug screening. Angiogenesis 3:353-359.637
40. Kishi S, Bayliss PE, Uchiyama J, Koshimizu E, Qi J, Nanjappa P, Imamura S, Islam638
A, Neuberg D, Amsterdam A, Roberts TM. 2008. The identification of zebrafish639
mutants showing alterations in senescence-associated biomarkers. PLoS Genet640
4:e1000152.641
41. Luo Y, Weng S, Wang Q, Shi X, Dong C, Lu Q, Yu X, He J. 2009. Tiger frog virus can642
infect zebrafish cells for studying up- or down-regulated genes by proteomics approach.643
Virus Res 144:171-179.644
42. Yuan S, Sun Z. 2009. Microinjection of mRNA and morpholino antisense645
oligonucleotides in zebrafish embryos. J Vis Exp.646
43. Bill BR, Petzold AM, Clark KJ, Schimmenti LA, Ekker SC. 2009. A primer for647
morpholino use in zebrafish. Zebrafish 6:69-77.648
44. Vogel B, Meder B, Just S, Laufer C, Berger I, Weber S, Katus HA, Rottbauer W.649
2009. In-vivo characterization of human dilated cardiomyopathy genes in zebrafish.650
Biochem Biophys Res Commun 390:516-522.651
45. Zhang R, Yang J, Zhu J, Xu X. 2009. Depletion of zebrafish Tcap leads to muscular652
dystrophy via disrupting sarcomere-membrane interaction, not sarcomere assembly. Hum653
Mol Genet 18:4130-4140.654
46. Tang R, Dodd A, Lai D, McNabb WC, Love DR. 2007. Validation of zebrafish (Danio655
rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim656
30. 30
Biophys Sin (Shanghai) 39:384-390.657
47. Wani AA, Jafarnejad SM, Zhou J, Li G. 2011. Integrin-linked kinase regulates658
melanoma angiogenesis by activating NF-kappaB/interleukin-6 signaling pathway.659
Oncogene 30:2778-2788.660
48. Hynes RO, Lively JC, McCarty JH, Taverna D, Francis SE, Hodivala-Dilke K, Xiao661
Q. 2002. The diverse roles of integrins and their ligands in angiogenesis. Cold Spring Harb662
Symp Quant Biol 67:143-153.663
49. Postel R, Vakeel P, Topczewski J, Knoll R, Bakkers J. 2008. Zebrafish integrin-linked664
kinase is required in skeletal muscles for strengthening the integrin-ECM adhesion665
complex. Dev Biol 318:92-101.666
50. Michaels JE, Schimmel P, Shiba K, Miller WT. 1996. Dominant negative inhibition by667
fragments of a monomeric enzyme. Proc Natl Acad Sci U S A 93:14452-14455.668
51. Melnick A, Carlile GW, McConnell MJ, Polinger A, Hiebert SW, Licht JD. 2000.669
AML-1/ETO fusion protein is a dominant negative inhibitor of transcriptional repression670
by the promyelocytic leukemia zinc finger protein. Blood 96:3939-3947.671
52. Zaika AI, Slade N, Erster SH, Sansome C, Joseph TW, Pearl M, Chalas E, Moll UM.672
2002. DeltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is673
up-regulated in human tumors. J Exp Med 196:765-780.674
53. Zhou M, Gu L, Zhu N, Woods WG, Findley HW. 2003. Transfection of a675
dominant-negative mutant NF-kB inhibitor (IkBm) represses p53-dependent apoptosis in676
acute lymphoblastic leukemia cells: interaction of IkBm and p53. Oncogene677
22:8137-8144.678
54. Ron D, Habener JF. 1992. CHOP, a novel developmentally regulated nuclear protein that679
dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative680
inhibitor of gene transcription. Genes Dev 6:439-453.681
55. Shin J, Park B, Lee S, Kim Y, Biegalke BJ, Kang S, Ahn K. 2006. A short isoform of682
31. 31
human cytomegalovirus US3 functions as a dominant negative inhibitor of the full-length683
form. J Virol 80:5397-5404.684
56. Kirchmaier AL, Sugden B. 1997. Dominant-negative inhibitors of EBNA-1 of685
Epstein-Barr virus. J Virol 71:1766-1775.686
57. Meder B, Huttner IG, Sedaghat-Hamedani F, Just S, Dahme T, Frese KS, Vogel B,687
Kohler D, Kloos W, Rudloff J, Marquart S, Katus HA, Rottbauer W. 2011. PINCH688
proteins regulate cardiac contractility by modulating integrin-linked kinase-protein kinase689
B signaling. Mol Cell Biol 31:3424-3435.690
58. Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G. 2010.691
Integrin-mediated adhesion maintains sarcomeric integrity. Dev Biol 338:15-27.692
59. He J, Zeng K, Weng S, Chan S-M. 2002. Experimental transmission, pathogenicity and693
physical–chemical properties of infectious spleen and kidney necrosis virus (ISKNV).694
Aquaculture 204:11-24.695
60. Wu C. 2004. The PINCH-ILK-parvin complexes: assembly, functions and regulation.696
Biochim Biophys Acta 1692:55-62.697
698
699
700
33. 33
Note: * Underlining letters are the cleavage site of restriction endonuclease.702
703
pGEM-T-anf-F GACAGTCTTAATCAGGGGGCCGGTA
pGEM-T-anf-R TGGGAGCCAACGTTGAGATTTTTTCCAATC
qRT-PCR
anf-QF GACGGATGTACAAGCGCACACGTTGAG
anf-QR CGGTGTTGCTGTCTTCATAATCTACGGCTC
nkx2.5-QF TTCACCTACAACACCTACCCTGCGTTTAGT
nkx2.5-QR TGGATGCTGGACATGCTCGACGGATAG
cmlc2-QF GCAGCATATCTCAAGAGCCAAGGACCAG
cmlc2-QR CTCAGCACCCATCACTGTTCCGTTTCC
34. 34
Figure legends704
Figure 1. Sequence similarity alignment of ORF119L with dominant-negative form of705
ILK. (A) Phylogenetic tree analysis of ORF119L orthologues (top 30 identical) from706
NCBI zebrafish protein database. Genebank accession numbers of proteins (based on the707
order) are as follow: XP_005157118.1; NP_001186697.1; XP_005161412.1;708
XP_697378.6; XP_001920876.2; XP_003199303.2; XP_005158347.1; XP_001920092.1;709
NP_899192.1; XP_689875.3; XP_005167841.1; XP_005167842.1; XP_005167840.1;710
XP_003200555.2; NP_001018164.1; XP_689244.2; XP_005166638.1; XP_005156096.1;711
NP_001093460.1; XP_002663935.3; XP_001920231.2; XP_005165903.1;712
XP_005165902.1; XP_005160666.1; XP_696390.3; NP_001020714.1; NP_991159.1;713
XP_002666119.1; XP_001923751.2; AAL98843, and NP_956865.1. (B) Analysis of the714
three ankyrin-repeats-containing domain of ISKNV ORF119L and ILK proteins from715
zebrafish (zILK, GenBank accession AAH56593), mouse (mILK, GenBank accession716
NP_001155196) and human (hILK, GenBank accession CAG28601) by SMART program717
(http://smart.embl-heidelberg.de). Compared to zILK, mILK, and hILK, the718
COOH-terminus of ISKNV ORF119L lacks a kinase domain. The numbers indicate the719
position of amino acid residues. (C-D) The model structures of 119L3ANK (C) and720
hILK3ANK (D) domain were generated using the SWISS-MODEL Workspace. (E)721
Multiple sequence alignment of the three ankyrin-repeats-containing domain of ISKNV722
ORF119L, zebrafish, mouse, and human was performed by using the ClustalW program723
with default setting. Abbreviation: 3ANK, the three ankyrin-repeats domain.724
725
Figure 2. Conservation of ORF119L among megalocytiviruses, and alteration of726
35. 35
cellular distribution of PINCH by co-expression of ORF119L. (A) ISKNV ORF119L727
(GenBank accession AAL98843) and the three ankyrin-repeats domain-containing728
proteins from orange-spotted grouper iridovirus (OSGIV) (GenBank accession729
AAX82423), turbot reddish body iridovirus (TRBIV) (GenBank accession ADE34453),730
red sea bream iridovirus (RSIV) (GenBank accession BAK14289) and rock bream731
iridovirus (RBIV) (GenBank accession AFR68193) were used for a multiple sequence732
alignment analysis with default setting (http://www.ebi.ac.uk/Tools/msa/clustalw2/). (B-I)733
Immunofluorescent microscopy for co-transfection of MYC-ILK + FLAG-PINCH (B-E),734
and MYC-ORF119L + FLAG-PINCH (F-I) plasmids in FHM fish cells for735
immunofluorescence analysis. Alexa fluor 555- (ILK and ORF119L in red colour) or 488-736
(PINCH in green colour) conjugated secondary antibodies were applied for the detection.737
Abbreviation: ANKP, predicted three ankyrin-repeats domain-containing protein.738
739
Figure 3. ORF119 interacts with PINCH to affect the PINCH-ILK interaction. (A) In740
GST pull-down assay, the expression of FLAG-PINCH fusion proteins from transfected741
HEK293T cells were detected by anti-FLAG antibody Western blotting. After incubating742
with the GST, GST-ILK, and GST-ORF119L bound beads, the associated FLAG-PINCH743
fusion proteins were detected by anti-FLAG antibody Western blotting. The purity of GST,744
GST-ILK, and GST-ORF119L was examined by Coomassie blue staining of SDS-PAGE.745
(B-C) In co-immunoprecipitation assay, plasmids [B: (pFLAG-PINCH + pc-Myc-CMV-2;746
pFLAG-CMV-2 + pMYC-ORF119L; and pFLAG-PINCH + pMYC-ORF119L,747
respectively); C: (pFLAG-PINCH + pc-Myc-CMV-2; pFLAG-CMV-2 +748
pMYC-119LΔ3ANK; pFLAG-PINCH + pMYC-119LΔ3ANK; and pFLAG-PINCH +749
36. 36
pMYC-ILK, respectively)] were co-transfected into HEK293T cells. The expression of750
MYC-ORF119L, MYC-ILK and FLAG-PINCH fusion proteins was examined by751
anti-MYC and anti-FLAG antibodies Western blotting respectively. After incubating with752
the anti-MYC antibody bound protein G beads, the associated FLAG-PINCH fusion753
proteins were examined by anti-FLAG antibody Western blotting. GAPDH was used as the754
loading control. (D-E) In the co-immunoprecipitation assay, plasmids (pFLAG-PINCH +755
pc-Myc-CMV-2; pFLAG-CMV-2 + pMYC-ILK; and pFLAG-PINCH + pMYC-ILK) was756
co-transfected with pORF119L-EGFP (D, right panel 4-6) or p119LΔ3ANK-EGFP (E,757
panel 1-3), respectively. The expression of ORF119L-GFP, 119LΔ3ANK-GFP,758
FLAG-PINCH, and MYC-ILK were detected by anti-GFP, anti-PINCH, and anti-MYC759
antibodies respectively. After incubating with the ANTI-FLAG M2 affinity gel (D) or760
anti-MYC antibody bound protein G beads (E), the associated MYC-ILK (D) or761
FLAG-PINCH (E) fusion proteins were examined by anti-MYC (D) or anti-FLAG (E)762
antibody Western blotting, respectively. β-actin (D) and GAPDH (E) was used as the763
loading control, respectively.764
765
Figure 4. ORF119L overexpression perturbs zebrafish embryogenesis. Morphology of766
mock vector-injected (A-F), ORF119L-overexpressing (G-L) and767
119LΔ3ANK-overexpressing (M-R) embryos from 4 hpf (hours post fertilization) to 4 dpf768
(days post fertilization). Abnormal phenotypes were found in ISKNV769
ORF119L-overexpressing embryos (G-L). A black arrow indicates pericardial edema and a770
white asterisk is for opaque yolk sac abnormality. (S-U) GFP expression in mock vector-,771
pORF119L-EGFP-, or p119LΔ3ANK-EGFP-injected embryos at 12 hpf. (V-X).772
37. 37
Percentage of embryos showing cardiac edema (V), opaque yolk sas (W), and slow blood773
circulation (X) phenotype at 3 dpf. Scale bars=500 μm.774
775
Figure 5. ORF119L overexpression affects angiogenesis in zebrafish embryos. (A-B)776
The ISV structure was examined in the Tg(flk1:GFP) transgenic embryos. The ISV777
development was normal in mock vector-injected embryos (A), whereas disorganized ISV778
was found after ORF119L over-expression (B) at 3 dpf. (C-J) Whole mount AP staining779
showing the vessels development in mock control (C, D, G and H) and780
ORF119L-overexpressing (E, F, I and J) embryos at 3 dpf. SIV was impaired after781
ORF119L over-expression. (K-L) ISV structure was normal in 119LΔ3ANK-expressing782
embryos at 3 dpf. Abbreviation: ISV, intersegmental vessel; PCV, posterior cardinal vein;783
DA, dorsal aorta; PD, pronephric duct; SIV, subintestinal vessel. Scale bars=500 μm in784
A-F. Scale bars=200 μm in c-f.785
786
Figure 6. ORF119L overexpression results in cardiac defects in zebrafish. (A-D)787
Paraffin section and H&E staining in mock control (A and C) and788
ORF119L-overexpressing (B and D) embryos at 3 dpf. The arrowheads indicate the789
ventricular wall. (E-H) TEM assay detecting the ultra-cellular structure of ventricle muscle790
in mock control (E and G) and ORF119L-overexpressing embryos (F and H) at 3 dpf.791
Images in C, D, G and H showed higher magnifications of the boxed areas in A, B, E and F,792
respectively. Abbreviation: PC, pericardial cavity; v, ventricle; a, atrium; S*, sarcomeric793
structure. Bars=500 μm in A-B, 100 μm in C-D, 2 μm in E-F, and 500 nm in G-H.794
795
38. 38
Figure 7. ISKNV infection disrupted the sarcomeric Z-disk of cardiomyocyte in796
mandarin fish. The structure of sarcomere and Z-disk of cardiac muscle in PBS-injected797
control (A-B), and ISKNV-infected mandarin fish at 3 (C-D), 5 (E-F), and 7 (G-H) days798
post infection. Images of B, D, F, and H are higher magnifications of the boxed areas in A,799
C, E, and G. Abbreviation: S*, sarcomeric structure.800
801
Figure 8. ORF119L overexpression resembles the effect of ILK inhibition. (A-L)802
Developmental morphology and whole mount in situ hybridization of anf in Ctrl-MO803
control embryos (A-C), ORF119L-overexpressing embryos (D-F), ILK-DN-expressing804
embryos (G-I), and ILK-MO-injected embryos (J-L). Arrowheads indicate the pericardial805
edema. (M) Percentage of embryos showing pericardial edema in806
ORF119L-overexpressing, ILK-DN-overexpressing, and ILK-MO-injected embryos at 3807
dpf. (N) Fifty old embryos were collected and lysed by using RIPA lysis buffer containing808
the phosphatase/protease inhibitor cocktail (Merck). Western blotting was performed to809
examine the phosphorylation of AKT (Ser473) and total AKT in mock control and810
ORF119L-overexpressing embryos at 3dpf. The relative level of p-AKT and total AKT811
were calculated by normalizing to their corresponding GAPDH (Quantity One 4.6.2812
software program). (O-Q) Quantitative RT-PCR showing the fold change of anf (O),813
nkx2.5 (P), and cmlc2 (Q) transcription in Ctrl-MO-injected, ORF119L-overexpressing,814
ILK-DN-overexpressing, and ILK-MO-injected embryos at 3 dpf. Abbreviation: v,815
ventricle; a, atrium. Scale bars=500 μm for A, D, G, and J, and 100 μm for B, C, E, F, H, I,816
K, and L.817
818