RNAi is superannuated cellular mechanism that protect organism against viruses that replicate
through double- stranded RNA. RNAi can be used to diminish gene expression from plasmid expressing and
inserted sequence repeat. A stable harpin would be expressed after the vector was integrated into the genome.
In this paper a shiRNA expressing vector for Neil3 was designed and developed which is capable of replication
in MOLT-4. This shiRNA vector had the ability to arose the RNAi pathway, and reduce the gene expression of
Neil3. This was assessed by using pSilence 4.1CMV as a vector, and Gapdh as positive control.
This document describes the expression and purification of the DNARR1 protein, which is involved in DNA double-strand break repair. Researchers cloned the DNARR1 gene with and without a FLAG tag into an expression vector and expressed the recombinant proteins in E. coli. They found that DNARR1 expression was highest at 37°C. Purification using nickel affinity chromatography and anti-FLAG affinity gel yielded purified DNARR1 protein. Future studies will use this purified protein to investigate its specific role in double-strand break repair through biochemical assays.
This document summarizes a presentation on the role of antisense and RNA interference (RNAi) gene silencing in crop improvement. It discusses the discovery of RNAi as a mechanism of gene silencing triggered by double-stranded RNA, and how this natural process can be harnessed through genetic engineering to modify traits in crops. Examples are given of crops where RNAi has been used to develop tolerance to herbicides, modify starch composition, or reduce virus susceptibility. The document concludes that transgenic RNA silencing avoids risks associated with foreign proteins and can be easily introduced into hybrid crops.
This document discusses luciferase and green fluorescent protein (GFP) as reporter genes. Luciferase is derived from fireflies and catalyzes a reaction producing light that can be used to study gene expression. GFP comes from jellyfish and produces green fluorescence without needing other proteins or substrates. Both have been widely used as reporters of gene expression and protein localization in cells. The document also covers other common reporter genes like beta-galactosidase and their assay methods.
This study aims to analyze conserved amino acids in GAPDH proteins from tropical plants Oxalis corniculata and Plectranthus amboinicus. GAPDH is important for energy production. Previous work cloned GAPDH genes from these plants and Myrtaceae psidium. Psidium showed no cloning and was eliminated. The current work will sequence the cloned GAPDH inserts and analyze conserved amino acids related to catalytic function through bioinformatics. This adds to knowledge of important plant genes and their evolution.
This laboratory report summarizes an experiment exploring RNA splicing in Drosophila melanogaster. Genomic DNA and total RNA were extracted from fruit flies and used to study the rngo gene. PCR and RT-PCR were performed on the genomic DNA and cDNA samples. The genomic PCR product was cloned and sequenced. Bioinformatics analysis showed the genomic sequence was longer, containing introns absent from the cDNA, indicating splicing of the rngo pre-mRNA. Future work could investigate other splicing sites and homology to human genes.
This study aims to clone and analyze GAPDH genes from various plant species to compare amino acid sequences related to catalytic function. Previous work successfully cloned GAPDH from Oxalis corniculata and Plectranthus amboinicus but not Myrtaceae psidium. The current study will continue work on the cloned samples through midipreps, restriction enzyme digestion and sequencing. Sequence data will undergo bioinformatics analysis to compare conserved amino acids of the GAPDH protein between plant species. Results could provide new genetic information published in GenBank and further the understanding of energy production pathways in plants.
Gene subtraction is a technique used to inactivate existing genes in plants using antisense RNA. Antisense RNA is produced by cloning a gene in the reverse orientation, which produces RNA complementary to the target gene's mRNA. This antisense RNA binds to the target mRNA and prevents its translation, effectively blocking the expression of the target gene. Some applications of antisense technology include producing slow ripening tomatoes by inactivating the polygalacturonase gene involved in fruit softening, and delaying ethylene production in tomatoes by targeting the ACC synthase gene involved in ethylene synthesis. Gene subtraction allows for directed modification of plant traits and characteristics.
This document describes the expression and purification of the DNARR1 protein, which is involved in DNA double-strand break repair. Researchers cloned the DNARR1 gene with and without a FLAG tag into an expression vector and expressed the recombinant proteins in E. coli. They found that DNARR1 expression was highest at 37°C. Purification using nickel affinity chromatography and anti-FLAG affinity gel yielded purified DNARR1 protein. Future studies will use this purified protein to investigate its specific role in double-strand break repair through biochemical assays.
This document summarizes a presentation on the role of antisense and RNA interference (RNAi) gene silencing in crop improvement. It discusses the discovery of RNAi as a mechanism of gene silencing triggered by double-stranded RNA, and how this natural process can be harnessed through genetic engineering to modify traits in crops. Examples are given of crops where RNAi has been used to develop tolerance to herbicides, modify starch composition, or reduce virus susceptibility. The document concludes that transgenic RNA silencing avoids risks associated with foreign proteins and can be easily introduced into hybrid crops.
This document discusses luciferase and green fluorescent protein (GFP) as reporter genes. Luciferase is derived from fireflies and catalyzes a reaction producing light that can be used to study gene expression. GFP comes from jellyfish and produces green fluorescence without needing other proteins or substrates. Both have been widely used as reporters of gene expression and protein localization in cells. The document also covers other common reporter genes like beta-galactosidase and their assay methods.
This study aims to analyze conserved amino acids in GAPDH proteins from tropical plants Oxalis corniculata and Plectranthus amboinicus. GAPDH is important for energy production. Previous work cloned GAPDH genes from these plants and Myrtaceae psidium. Psidium showed no cloning and was eliminated. The current work will sequence the cloned GAPDH inserts and analyze conserved amino acids related to catalytic function through bioinformatics. This adds to knowledge of important plant genes and their evolution.
This laboratory report summarizes an experiment exploring RNA splicing in Drosophila melanogaster. Genomic DNA and total RNA were extracted from fruit flies and used to study the rngo gene. PCR and RT-PCR were performed on the genomic DNA and cDNA samples. The genomic PCR product was cloned and sequenced. Bioinformatics analysis showed the genomic sequence was longer, containing introns absent from the cDNA, indicating splicing of the rngo pre-mRNA. Future work could investigate other splicing sites and homology to human genes.
This study aims to clone and analyze GAPDH genes from various plant species to compare amino acid sequences related to catalytic function. Previous work successfully cloned GAPDH from Oxalis corniculata and Plectranthus amboinicus but not Myrtaceae psidium. The current study will continue work on the cloned samples through midipreps, restriction enzyme digestion and sequencing. Sequence data will undergo bioinformatics analysis to compare conserved amino acids of the GAPDH protein between plant species. Results could provide new genetic information published in GenBank and further the understanding of energy production pathways in plants.
Gene subtraction is a technique used to inactivate existing genes in plants using antisense RNA. Antisense RNA is produced by cloning a gene in the reverse orientation, which produces RNA complementary to the target gene's mRNA. This antisense RNA binds to the target mRNA and prevents its translation, effectively blocking the expression of the target gene. Some applications of antisense technology include producing slow ripening tomatoes by inactivating the polygalacturonase gene involved in fruit softening, and delaying ethylene production in tomatoes by targeting the ACC synthase gene involved in ethylene synthesis. Gene subtraction allows for directed modification of plant traits and characteristics.
This document summarizes an experiment that aimed to change both the expression level and color of the fluorescent protein mCherry. The experiment involved:
1) Using restriction digestion and ligation to swap the promoter of mCherry from low to high expression, resulting in more mCherry colonies.
2) Attempting site-directed mutagenesis to change mCherry to mOrange but this was unsuccessful, as no orange colonies were observed.
3) Characterizing the fluorescence of mCherry, mOrange from a partner, and a negative control colony, finding mOrange emitted better at 500nm.
This document discusses advances in HLA typing technologies over the past 25 years. It begins by outlining the evolution from low to high resolution typing methods like PCR-SSO, Sanger sequencing, and next generation sequencing using Illumina and PacBio platforms. Whole gene and long-range sequencing is now being done on over 80,000 samples using PacBio to type HLA Class I and II at high resolution without ambiguity. This has revealed over 5,000 novel variants, including insertions, deletions and nonsense mutations across exons and introns. Whole gene sequencing provides a more comprehensive view of variation than targeting only antigen recognition sites.
This document summarizes a study on the heterologous expression and characterization of the c1 dioxygenase enzyme from Tetranychus urticae. Key points:
- The c1 dioxygenase gene was inserted into a plasmid and transformed into E. coli cells for expression. However, initial expression attempts did not show overexpression of the protein.
- Additional expression trials were conducted by varying culture conditions and bacterial clones. SDS-PAGE analysis showed some potential overexpression in new clones induced overnight at 37°C, though further optimization is still needed.
- Once expression is optimized, the goal is to purify the recombinant protein using its His-tag and proceed with structural characterization through crystallization,
Antisense RNA technology & its role in crop improvement ppt surendra singhDrSurendraSingh2
This document discusses antisense RNA technology and its role in crop improvement. It begins by introducing antisense RNA as a method for inhibiting gene expression through complementary base pairing. It then discusses various applications of antisense RNA technology in crop improvement, including delaying fruit ripening in tomato and flower senescence in carnation, producing male sterility in petunia, and reducing neurotoxins in crops like khesari. The document concludes by noting that antisense RNA technology is an efficient gene knockdown method that could be useful for genetic improvement in many plant species.
The document describes the identification, cloning, sequencing, and characterization of the a-L-arabinofuranosidase B (abfB) gene from the phytopathogenic fungus Fusarium oxysporum f. sp. dianthi (Fod). The gene was identified using random amplified polymorphic DNA and encodes a protein of 499 amino acids. The recombinant protein expressed in E. coli had arabinofuranosidase activity and optimal activity at pH 4.0 and 50°C. Reverse transcription PCR showed that the abfB gene is actively transcribed in carnation plants infected with Fod, suggesting it plays a role in the fungus's pathogenicity.
Plant epigenetic memory in plant growth behavior and stress response. Sally M...CIAT
Speaker: Sally Mackenzie, Lloyd and Dottie Huck Chair for Functional Genomics, Department of Biology, Pennsylvania State University. Fellow in the American Society of Plant Biologists and the American Association for the Advancement of Science (AAAS).
Event: Robert D. Havener Seminar on “Innovations for Crop Productivity”.
http://ciat.cgiar.org/event/robert-d-havener-seminar-on-innovations-for-crop-productivity/
The document summarizes a study that analyzed the expression of the At1g17950 gene in diploid and tetraploid Arabidopsis thaliana plants under salt stress conditions. The study found that the At1g17950 gene, which encodes a MYB transcription factor involved in abscisic acid production and response to salt stress, was expressed more highly in diploid plants than in tetraploid plants. This suggests that tetraploid A. thaliana have greater resistance to salt stress due to lower expression of the At1g17950 gene, while diploid plants are more sensitive to salt stress due to higher expression of this gene.
Gene silencing is a technique that aims to reduce or eliminate protein production from a gene. It occurs through mechanisms other than genetic modification and describes switching a gene "off" through cellular machinery. There are two main types: transcriptional gene silencing, which occurs at the DNA or chromatin level, and post-transcriptional gene silencing, which acts at the RNA level through mechanisms like RNA interference. RNAi has applications in biotechnology and crop improvement by modulating gene expression and inducing viral resistance.
1) The document discusses molecular genetic techniques for isolating and characterizing genes, including the study of mutations, DNA cloning, and recombinant DNA methods.
2) Key terms are defined for genetic analysis, such as alleles, mutants, genotypes, and phenotypes. Methods are described for identifying dominant and recessive mutations through genetic crosses and complementation analysis.
3) Techniques like conditional mutations, suppressor mutations, and synthetic lethal analysis are explained for studying essential genes and protein interactions. DNA cloning is introduced, involving restriction enzymes to cut DNA and ligases to join DNA fragments into vectors.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
This document summarizes work done on culturing crocodile cell lines and cloning the parc gene from Pseudomonas keratitis. Primary crocodile cell lines were established from various organs and immortalized using hTERT. The parc gene was cloned from mutant and wild-type Pseudomonas strains and will be expressed and crystallized to study its role in quinolone antibiotic resistance.
The role of DNA methylation in mediating the effects of estrogens in oystersmgavery
The document summarizes a study that investigated the effects of 17α ethinylestradiol (EE2), a synthetic estrogen, on DNA methylation patterns in oysters. The study found that while EE2 treatment did not affect sex ratios in oysters, it did lead to larger female oysters. Additionally, differentially methylated regions were identified within genes related to growth, immunity, and reproduction after one week of EE2 exposure. The results suggest that DNA methylation may mediate responses to endocrine disrupting chemicals in bivalves and could provide early indicators of chemical exposure in aquatic species.
1) The document summarizes antisense RNA technology, which involves producing RNA sequences that are complementary to target mRNAs to inhibit gene expression.
2) Two case studies are described where antisense RNA was used to suppress ethylene biosynthesis genes (ACC oxidase) in orchids and carnations, extending their vase life.
3) The technology has potential applications in crop improvement by extending shelf life and improving traits like fruit ripening and flower longevity.
The project aimed to clone, express, and purify E. coli Ddlb enzyme to use in further experiments exploring its potential as an antibiotic target. Key steps included:
1. Amplifying the Ddlb gene from E. coli via PCR and cloning it into a pET-15b expression vector.
2. Transforming E. coli with the expression construct and inducing expression, which successfully produced the Ddlb protein.
3. Purifying the expressed Ddlb protein via native batch purification using Talon resin, which isolated Ddlb with only one contaminant.
4. Removing the His-tag from the purified protein to prepare it for future inhibitor assays and crystall
Generation of MRP2 Efflux Transporter Knock-Out in HepaRG Cell Linemdmitc
The document describes experiments characterizing a HepaRG cell line with MRP2 (an efflux transporter) knocked out using zinc finger nuclease technology. Western blot and immunostaining showed loss of MRP2 protein expression in knockout cells. Assays found control cells accumulated the fluorescent MRP2 substrate CDCF in bile canaliculi, while knockout cells did not, demonstrating functional loss of MRP2. The MRP2 knockout cell line allows investigation of MRP2-associated drug toxicity without its protective efflux.
RNAi is a highly specific post-transcriptional gene silencing process, a powerful tool for functional genomics. This guide includes protocol reviews, handy tips and troubleshooting help.
Gene regulation, History and Evolution , Traditional Methods:
Northern blot
quantitative reverse transcription PCR (qRTPCR)
serial analysis of gene expression(SAGE) and
DNA microarrays.
DNA Chip
Inhibition of ζ carotene desaturase gene in chiliVaibhav Maurya
This document outlines a research project aiming to inhibit the expression of the ζ-carotene desaturase gene in capsicum annuum (chili peppers). The objectives are to study the functional role of this gene in chili and its effects on other genes in the carotenoid biosynthesis pathway. The project involves three phases: 1) transforming chili plants to insert an antisense version of the target gene, 2) analyzing gene expression levels using real-time PCR, and 3) profiling metabolites using GC-MS to compare levels in transgenic versus wild-type plants. The goal is to better understand the role of the ζ-carotene desaturase gene and effects of its inhibition on carotenoid biosynthesis in
This document describes the materials and methods used in a dissertation analyzing the in vivo functions of Glycine transporter 1 (GlyT1) through transgenic approaches. It provides details on mouse strains, cell lines, bacterial strains, chemicals, enzymes, kits, culture media, buffers and solutions used for experiments involving molecular biology techniques, cell culture, protein biochemistry, and transgenic mouse models. The goal was to generate and characterize GlyT1 transgenic mouse lines to study the role of GlyT1 in inhibitory neurotransmission.
Virus-induced gene silencing (VIGS) is described as a method to silence target genes in barley seedling leaves using barley stripe mosaic virus (BSMV) vectors. The procedure involves cloning gene fragments into BSMV RNA vectors, generating in vitro transcripts, and rub inoculating seedling leaves. As a control, a phytoene desaturase (PDS) fragment is used, which results in photobleached leaves. Two non-overlapping fragments of the brassinosteroid-insensitive 1 (BRI1) gene are also cloned and shown to cause dwarfing symptoms when silenced. The method allows for rapid phenotypic analysis of gene function in barley compared to stable transformation.
This document summarizes an experiment that aimed to change both the expression level and color of the fluorescent protein mCherry. The experiment involved:
1) Using restriction digestion and ligation to swap the promoter of mCherry from low to high expression, resulting in more mCherry colonies.
2) Attempting site-directed mutagenesis to change mCherry to mOrange but this was unsuccessful, as no orange colonies were observed.
3) Characterizing the fluorescence of mCherry, mOrange from a partner, and a negative control colony, finding mOrange emitted better at 500nm.
This document discusses advances in HLA typing technologies over the past 25 years. It begins by outlining the evolution from low to high resolution typing methods like PCR-SSO, Sanger sequencing, and next generation sequencing using Illumina and PacBio platforms. Whole gene and long-range sequencing is now being done on over 80,000 samples using PacBio to type HLA Class I and II at high resolution without ambiguity. This has revealed over 5,000 novel variants, including insertions, deletions and nonsense mutations across exons and introns. Whole gene sequencing provides a more comprehensive view of variation than targeting only antigen recognition sites.
This document summarizes a study on the heterologous expression and characterization of the c1 dioxygenase enzyme from Tetranychus urticae. Key points:
- The c1 dioxygenase gene was inserted into a plasmid and transformed into E. coli cells for expression. However, initial expression attempts did not show overexpression of the protein.
- Additional expression trials were conducted by varying culture conditions and bacterial clones. SDS-PAGE analysis showed some potential overexpression in new clones induced overnight at 37°C, though further optimization is still needed.
- Once expression is optimized, the goal is to purify the recombinant protein using its His-tag and proceed with structural characterization through crystallization,
Antisense RNA technology & its role in crop improvement ppt surendra singhDrSurendraSingh2
This document discusses antisense RNA technology and its role in crop improvement. It begins by introducing antisense RNA as a method for inhibiting gene expression through complementary base pairing. It then discusses various applications of antisense RNA technology in crop improvement, including delaying fruit ripening in tomato and flower senescence in carnation, producing male sterility in petunia, and reducing neurotoxins in crops like khesari. The document concludes by noting that antisense RNA technology is an efficient gene knockdown method that could be useful for genetic improvement in many plant species.
The document describes the identification, cloning, sequencing, and characterization of the a-L-arabinofuranosidase B (abfB) gene from the phytopathogenic fungus Fusarium oxysporum f. sp. dianthi (Fod). The gene was identified using random amplified polymorphic DNA and encodes a protein of 499 amino acids. The recombinant protein expressed in E. coli had arabinofuranosidase activity and optimal activity at pH 4.0 and 50°C. Reverse transcription PCR showed that the abfB gene is actively transcribed in carnation plants infected with Fod, suggesting it plays a role in the fungus's pathogenicity.
Plant epigenetic memory in plant growth behavior and stress response. Sally M...CIAT
Speaker: Sally Mackenzie, Lloyd and Dottie Huck Chair for Functional Genomics, Department of Biology, Pennsylvania State University. Fellow in the American Society of Plant Biologists and the American Association for the Advancement of Science (AAAS).
Event: Robert D. Havener Seminar on “Innovations for Crop Productivity”.
http://ciat.cgiar.org/event/robert-d-havener-seminar-on-innovations-for-crop-productivity/
The document summarizes a study that analyzed the expression of the At1g17950 gene in diploid and tetraploid Arabidopsis thaliana plants under salt stress conditions. The study found that the At1g17950 gene, which encodes a MYB transcription factor involved in abscisic acid production and response to salt stress, was expressed more highly in diploid plants than in tetraploid plants. This suggests that tetraploid A. thaliana have greater resistance to salt stress due to lower expression of the At1g17950 gene, while diploid plants are more sensitive to salt stress due to higher expression of this gene.
Gene silencing is a technique that aims to reduce or eliminate protein production from a gene. It occurs through mechanisms other than genetic modification and describes switching a gene "off" through cellular machinery. There are two main types: transcriptional gene silencing, which occurs at the DNA or chromatin level, and post-transcriptional gene silencing, which acts at the RNA level through mechanisms like RNA interference. RNAi has applications in biotechnology and crop improvement by modulating gene expression and inducing viral resistance.
1) The document discusses molecular genetic techniques for isolating and characterizing genes, including the study of mutations, DNA cloning, and recombinant DNA methods.
2) Key terms are defined for genetic analysis, such as alleles, mutants, genotypes, and phenotypes. Methods are described for identifying dominant and recessive mutations through genetic crosses and complementation analysis.
3) Techniques like conditional mutations, suppressor mutations, and synthetic lethal analysis are explained for studying essential genes and protein interactions. DNA cloning is introduced, involving restriction enzymes to cut DNA and ligases to join DNA fragments into vectors.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
This document summarizes work done on culturing crocodile cell lines and cloning the parc gene from Pseudomonas keratitis. Primary crocodile cell lines were established from various organs and immortalized using hTERT. The parc gene was cloned from mutant and wild-type Pseudomonas strains and will be expressed and crystallized to study its role in quinolone antibiotic resistance.
The role of DNA methylation in mediating the effects of estrogens in oystersmgavery
The document summarizes a study that investigated the effects of 17α ethinylestradiol (EE2), a synthetic estrogen, on DNA methylation patterns in oysters. The study found that while EE2 treatment did not affect sex ratios in oysters, it did lead to larger female oysters. Additionally, differentially methylated regions were identified within genes related to growth, immunity, and reproduction after one week of EE2 exposure. The results suggest that DNA methylation may mediate responses to endocrine disrupting chemicals in bivalves and could provide early indicators of chemical exposure in aquatic species.
1) The document summarizes antisense RNA technology, which involves producing RNA sequences that are complementary to target mRNAs to inhibit gene expression.
2) Two case studies are described where antisense RNA was used to suppress ethylene biosynthesis genes (ACC oxidase) in orchids and carnations, extending their vase life.
3) The technology has potential applications in crop improvement by extending shelf life and improving traits like fruit ripening and flower longevity.
The project aimed to clone, express, and purify E. coli Ddlb enzyme to use in further experiments exploring its potential as an antibiotic target. Key steps included:
1. Amplifying the Ddlb gene from E. coli via PCR and cloning it into a pET-15b expression vector.
2. Transforming E. coli with the expression construct and inducing expression, which successfully produced the Ddlb protein.
3. Purifying the expressed Ddlb protein via native batch purification using Talon resin, which isolated Ddlb with only one contaminant.
4. Removing the His-tag from the purified protein to prepare it for future inhibitor assays and crystall
Generation of MRP2 Efflux Transporter Knock-Out in HepaRG Cell Linemdmitc
The document describes experiments characterizing a HepaRG cell line with MRP2 (an efflux transporter) knocked out using zinc finger nuclease technology. Western blot and immunostaining showed loss of MRP2 protein expression in knockout cells. Assays found control cells accumulated the fluorescent MRP2 substrate CDCF in bile canaliculi, while knockout cells did not, demonstrating functional loss of MRP2. The MRP2 knockout cell line allows investigation of MRP2-associated drug toxicity without its protective efflux.
RNAi is a highly specific post-transcriptional gene silencing process, a powerful tool for functional genomics. This guide includes protocol reviews, handy tips and troubleshooting help.
Gene regulation, History and Evolution , Traditional Methods:
Northern blot
quantitative reverse transcription PCR (qRTPCR)
serial analysis of gene expression(SAGE) and
DNA microarrays.
DNA Chip
Inhibition of ζ carotene desaturase gene in chiliVaibhav Maurya
This document outlines a research project aiming to inhibit the expression of the ζ-carotene desaturase gene in capsicum annuum (chili peppers). The objectives are to study the functional role of this gene in chili and its effects on other genes in the carotenoid biosynthesis pathway. The project involves three phases: 1) transforming chili plants to insert an antisense version of the target gene, 2) analyzing gene expression levels using real-time PCR, and 3) profiling metabolites using GC-MS to compare levels in transgenic versus wild-type plants. The goal is to better understand the role of the ζ-carotene desaturase gene and effects of its inhibition on carotenoid biosynthesis in
This document describes the materials and methods used in a dissertation analyzing the in vivo functions of Glycine transporter 1 (GlyT1) through transgenic approaches. It provides details on mouse strains, cell lines, bacterial strains, chemicals, enzymes, kits, culture media, buffers and solutions used for experiments involving molecular biology techniques, cell culture, protein biochemistry, and transgenic mouse models. The goal was to generate and characterize GlyT1 transgenic mouse lines to study the role of GlyT1 in inhibitory neurotransmission.
Virus-induced gene silencing (VIGS) is described as a method to silence target genes in barley seedling leaves using barley stripe mosaic virus (BSMV) vectors. The procedure involves cloning gene fragments into BSMV RNA vectors, generating in vitro transcripts, and rub inoculating seedling leaves. As a control, a phytoene desaturase (PDS) fragment is used, which results in photobleached leaves. Two non-overlapping fragments of the brassinosteroid-insensitive 1 (BRI1) gene are also cloned and shown to cause dwarfing symptoms when silenced. The method allows for rapid phenotypic analysis of gene function in barley compared to stable transformation.
An aminopeptidase P (PepP)-encoding gene has been cloned from Streptomyces lividans 66. The gene, pepP, was localized by deletion mapping and its nucleotide sequence was determined. The deduced amino acid sequence was found to display significant similarity to Escherichia coli PepP. The partially purified S. lividans enzyme had a 50-kDa subunit and was present as a homodimer, confirming that pepP encodes the observed intracellular PepP.
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
Plasmids are small, extra-chromosomal DNA molecules capable of replicating independently of chromosomal DNA. They are commonly used as vectors to introduce foreign DNA into host cells. Restriction enzymes cut DNA at specific recognition sequences and are used in molecular cloning. Various techniques like gel electrophoresis, Southern blot, and DNA microarrays can analyze DNA sequences.
The document describes the RheoSwitch Mammalian Inducible Expression System which provides precise control of gene expression in mammalian cells. It contains three plasmids - pNEBR-R1 encodes a nuclear receptor heterodimer for regulating transcription of genes cloned into pNEBR-X1. pNEBR-X1 is used to clone the gene of interest and contains response elements regulated by the receptor. pNEBR-X1GLuc is a control plasmid expressing Gaussia luciferase. The system allows inducible expression of a gene of interest in the presence of a small molecule ligand.
The document discusses developing a DNA vaccine for fish using chitosan nanoparticles to deliver plasmid DNA encoding the OMP38 gene of Vibrio anguillarum. Key points:
- Chitosan nanoparticles were developed to deliver the pVAOMP38 plasmid and protect it from nuclease degradation. Studies showed the nanoparticles maintained plasmid integrity.
- The pVAOMP38 plasmid was transfected into seabass kidney cells in vitro and shown to express.
- Fish were vaccinated by feeding with chitosan-pVAOMP38 nanoparticles, chitosan-empty vector, or chitosan alone. The fish were later challenged with V. anguillarum to evaluate vaccine efficiency.
The document discusses various methods for screening and selecting recombinant cells. Direct selection methods include antibiotic resistance screening and blue-white color screening. Indirect selection methods include screening by nucleic acid hybridization, colony hybridization, immunological assays, and detecting protein/enzyme activity. These screening methods allow identification of recombinant cells that contain the gene of interest from a mixture of transformed cells.
Discover Therapeutic Aptamers For Vegf165 And EgfrJessica Myers
The document discusses discovering therapeutic aptamers for VEGF165 and EGFR through in vitro selection. Aptamers are ssDNA or RNA oligonucleotides that bind targets with high selectivity and specificity due to their well-defined tertiary structures. They have advantages over antibodies such as not requiring animals or cell culture for selection. The author aims to select aptamers for VEGF165 and EGFR to potentially use as therapeutic agents.
The document summarizes the expression and purification of two dengue virus proteins, NS3 helicase and the NS4B loop, for future binding studies. It describes expressing the proteins in E. coli cells, then purifying them using immobilized metal ion affinity chromatography and gel filtration chromatography. This resulted in purified, concentrated samples of both NS3 helicase and the NS4B loop that were verified through SDS-PAGE and stored for later use in nuclear magnetic resonance spectroscopy and isothermal titration calorimetry to study their interaction.
The 5' terminal uracil of let-7a is critical for the recruitment of mRNA to A...David W. Salzman
This document investigates the interaction between let-7a microRNA, Argonaute2 protein, and mRNA targets. It finds that recombinant Argonaute2 is sufficient to direct let-7a-guided cleavage of a fully complementary mRNA target in vitro. Additionally, it determines that the 5' terminal uracil of let-7a is critical for recruitment of the mRNA target to the let-7a-Argonaute2 complex. Mutation of this 5' uracil inhibits formation of the ternary let-7a-Argonaute2-mRNA complex, but does not affect formation of the binary let-7a-Argonaute2 complex. This suggests the 5' urac
Cloning, expression and purification of tRNA intron splicing endonuclease of ...Mayanksisodiya1
The document summarizes research on cloning and expressing the tRNA intron splicing endonuclease gene from Plasmodium falciparum. Key points:
- The gene was amplified from P. falciparum genomic DNA and cloned into the pGEX-4T-1 vector.
- The construct was transformed into E. coli cells and a positive clone containing the insert was identified.
- Expression of the tRNA intron splicing endonuclease protein was induced in E. coli and detected via western blotting.
- The expressed protein was purified using affinity chromatography for future structural and functional studies.
The document discusses the scientific discovery of selective breeding. Selective breeding involves breeding organisms within the same species to increase the frequency of desirable existing traits. It has been practiced for around 10,000 years to benefit humans in agriculture, farming, and medicine. Two main methods are selective breeding and transgenesis, which involves transferring genes between organisms to create new traits. Selective breeding techniques include marker assisted selection and original inbreeding/line breeding.
This document describes several methods for isolating genomic DNA from mammalian cells and tissues. It begins with an introduction to DNA structure and stability. It then discusses four main stages of DNA separation: disruption, lysis, removal of proteins/contaminants, and DNA recovery. Several specific techniques are outlined, including phenol/chloroform extraction and formamide/dialysis methods. The document concludes with a detailed protocol for extracting human nuclear DNA from blood using proteinase K and phenol.
EFFECT OF RESVERETROL ON HUMAN BREAST CANCER (MCF-7) CELL LINEAbhishek Banerjee
This document summarizes a study on the effect of resveratrol on human breast cancer MCF-7 cell lines. The study found that resveratrol inhibited the viability of MCF-7 cells in a dose-dependent manner, with an IC50 value of 125μM. Treatment with resveratrol induced apoptosis in the cells, as shown by DNA fragmentation, phosphatidylserine externalization, and morphological changes observed under electron microscopy. The apoptosis was further confirmed by the activation of apoptotic proteins like t-Bid and cleavage of α-fodrin. The study concludes that resveratrol shows promise as an anti-cancer agent for its ability to induce apoptosis in breast cancer cells.
This document summarizes a study on the effect of resveratrol on human breast cancer (MCF-7) cell lines. The study found that resveratrol inhibited the viability of MCF-7 cells in a dose-dependent manner, with an IC50 value of 125μM. Tests showed that resveratrol induced apoptosis in MCF-7 cells, as evidenced by cellular morphology changes, DNA fragmentation, and activation of apoptotic proteins like t-Bid and cleavage of α-fodrin. The study concludes that resveratrol shows potential as a promising drug for cancer treatment based on its ability to selectively induce apoptosis in cancer cells.
1) There are several methods for selecting and screening recombinant transformants, including blue-white screening using X-gal, insertional inactivation of antibiotic resistance genes, and using reporter genes like luciferase or GFP.
2) Gene transfer in animals can be done using viral vectors like retroviruses which incorporate the transgene into their genome, or using non-viral methods like microinjection, gene guns, electroporation, and ultrasound to deliver naked DNA into cells.
3) Stable transfection integrates transferred DNA into the host chromosome for permanent expression, while transient transfection expresses DNA temporarily without integration.
Cloning and expression of the Nodamura virus RNA-dependent RNA polymerase
Poster presentation at Society for the Advancement of Chicanos and Native Americans in Science (SACNAS) National Conference, October 2012, Seatltle, WA
The number of sequenced genes having unknown function continues to climb with the continuing decrease in the cost of genome sequencing. In Reverse Genetics (RG), functions of known genes are investigated with targeted modulation of gene activity, and hypothesis regarding gene function directly tested in vivo. Several RG approaches like insertional mutagenesis, fast neutron mutagenesis, TILLING and RNA interference have led to the identification of mutations in candidate genes and subsequent phenotypic analysis of these mutants.
Okabe et al. (2011) employed TILLING technique to screen six ethylene receptor genes in tomato (SlETR1–SlETR6) and two allelic mutants of SlETR1 (Sletr1-1 and Sletr1-2) with reduced ethylene response were identified. Using fast neutron mutagenesis, Li et al. (2001) obtained arabidopsis deletion mutants for bZIP transcription factor viz. AHBP 1b and OBF 5, a key regulator for systemic acquired resistance but their role were compensated by other regulatory factors in mutants. Terada et al. (2007) successfully blocked the expression of the Adh 2 gene through homologous recombination followed by transgenesis in rice however phenotype could not be determined since no differences were observed between wild and transgenic plants. RNA interference (RNAi) works as sequence-specific gene regulation and has been used in determination of function of many genes. Saurabh et al. (2014) reviewed the impact of RNAi in crop improvement and found its application in improvement of nutritional aspects, biotic and abiotic stresses, morphol¬ogy, crafting male sterility, enhanced secondary metabolite synthesis.
In addition, new advances in technology and reduction in sequencing cost may soon make it practical to use whole genome sequencing or gene targeting like ZFN technology and TAL effectors technology on a routine basis to identify or generate mutations in specific genes. Scholze and Boch (2011) mentioned that TAL effectors technology is more specific and predictable than ZFN. RG techniques have their own advantages and disadvantages depending on the species being targeted and the questions being addressed. Finally, with the continuous development of new technologies, the most efficient RG technique in the future may involve high throughput direct sequencing of part or complete genomes of individual plants followed by efficient novel tools to determine the function for utilization in crop improvement.
This is an internship report on molecular biology techniques, which was performed at PERD center under the guidance of Dr. Anshu Srivastava. This pdf contains all the basic information which is a preliminary requisite to know while approaching the molecular biology experimentally.
Similar to DNA damage repair Neil3 gene Knockout in MOLT-4 (20)
An Examination of Effectuation Dimension as Financing Practice of Small and M...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Does Goods and Services Tax (GST) Leads to Indian Economic Development?iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Childhood Factors that influence success in later lifeiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Emotional Intelligence and Work Performance Relationship: A Study on Sales Pe...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Customer’s Acceptance of Internet Banking in Dubaiiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study of Employee Satisfaction relating to Job Security & Working Hours amo...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Consumer Perspectives on Brand Preference: A Choice Based Model Approachiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Student`S Approach towards Social Network Sitesiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Broadcast Management in Nigeria: The systems approach as an imperativeiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study on Retailer’s Perception on Soya Products with Special Reference to T...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
A Study Factors Influence on Organisation Citizenship Behaviour in Corporate ...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Consumers’ Behaviour on Sony Xperia: A Case Study on Bangladeshiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Design of a Balanced Scorecard on Nonprofit Organizations (Study on Yayasan P...iosrjce
1. The document describes a study that designed a balanced scorecard for a nonprofit organization called Yayasan Pembinaan dan Kesembuhan Batin (YPKB) in Malang, Indonesia.
2. The balanced scorecard translated YPKB's vision and mission into strategic objectives across four perspectives: financial, customer, internal processes, and learning and growth.
3. Key strategic objectives included donation growth, budget effectiveness, customer satisfaction, reputation, service quality, innovation, and employee development. Customers perspective had the highest weighting, suggesting a focus on public service over financial growth.
Public Sector Reforms and Outsourcing Services in Nigeria: An Empirical Evalu...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Media Innovations and its Impact on Brand awareness & Considerationiosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Customer experience in supermarkets and hypermarkets – A comparative studyiosrjce
- The document examines customer experience in supermarkets and hypermarkets in India through a survey of 418 customers.
- It finds that in supermarkets, previous experience, atmosphere, price, social environment and experience in other channels most influence customer experience, while in hypermarkets, previous experience, product assortment, social environment and experience in other channels are most influential.
- The study provides insights for retailers on key determinants of customer experience in each format to help them improve strategies and competitive positioning.
Social Media and Small Businesses: A Combinational Strategic Approach under t...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Secretarial Performance and the Gender Question (A Study of Selected Tertiary...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
Implementation of Quality Management principles at Zimbabwe Open University (...iosrjce
This document discusses the implementation of quality management principles at Zimbabwe Open University's Matabeleland North Regional Centre. It begins with background information on ZOU and the importance of quality management in open and distance learning institutions. The study aimed to determine if quality management and its principles were being implemented at the regional centre. Key findings included that the centre prioritized customer focus and staff involvement. Decisions were made based on data analysis. The regional centre implemented a quality system informed by its policy documents. The document recommends ensuring staffing levels match needs and providing sufficient resources to the regional centre.
Organizational Conflicts Management In Selected Organizaions In Lagos State, ...iosrjce
IOSR Journal of Business and Management (IOSR-JBM) is a double blind peer reviewed International Journal that provides rapid publication (within a month) of articles in all areas of business and managemant and its applications. The journal welcomes publications of high quality papers on theoretical developments and practical applications inbusiness and management. Original research papers, state-of-the-art reviews, and high quality technical notes are invited for publications.
The debris of the ‘last major merger’ is dynamically youngSérgio Sacani
The Milky Way’s (MW) inner stellar halo contains an [Fe/H]-rich component with highly eccentric orbits, often referred to as the
‘last major merger.’ Hypotheses for the origin of this component include Gaia-Sausage/Enceladus (GSE), where the progenitor
collided with the MW proto-disc 8–11 Gyr ago, and the Virgo Radial Merger (VRM), where the progenitor collided with the
MW disc within the last 3 Gyr. These two scenarios make different predictions about observable structure in local phase space,
because the morphology of debris depends on how long it has had to phase mix. The recently identified phase-space folds in Gaia
DR3 have positive caustic velocities, making them fundamentally different than the phase-mixed chevrons found in simulations
at late times. Roughly 20 per cent of the stars in the prograde local stellar halo are associated with the observed caustics. Based
on a simple phase-mixing model, the observed number of caustics are consistent with a merger that occurred 1–2 Gyr ago.
We also compare the observed phase-space distribution to FIRE-2 Latte simulations of GSE-like mergers, using a quantitative
measurement of phase mixing (2D causticality). The observed local phase-space distribution best matches the simulated data
1–2 Gyr after collision, and certainly not later than 3 Gyr. This is further evidence that the progenitor of the ‘last major merger’
did not collide with the MW proto-disc at early times, as is thought for the GSE, but instead collided with the MW disc within
the last few Gyr, consistent with the body of work surrounding the VRM.
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
Travis Hills' Endeavors in Minnesota: Fostering Environmental and Economic Pr...Travis Hills MN
Travis Hills of Minnesota developed a method to convert waste into high-value dry fertilizer, significantly enriching soil quality. By providing farmers with a valuable resource derived from waste, Travis Hills helps enhance farm profitability while promoting environmental stewardship. Travis Hills' sustainable practices lead to cost savings and increased revenue for farmers by improving resource efficiency and reducing waste.
Current Ms word generated power point presentation covers major details about the micronuclei test. It's significance and assays to conduct it. It is used to detect the micronuclei formation inside the cells of nearly every multicellular organism. It's formation takes place during chromosomal sepration at metaphase.
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...AbdullaAlAsif1
The pygmy halfbeak Dermogenys colletei, is known for its viviparous nature, this presents an intriguing case of relatively low fecundity, raising questions about potential compensatory reproductive strategies employed by this species. Our study delves into the examination of fecundity and the Gonadosomatic Index (GSI) in the Pygmy Halfbeak, D. colletei (Meisner, 2001), an intriguing viviparous fish indigenous to Sarawak, Borneo. We hypothesize that the Pygmy halfbeak, D. colletei, may exhibit unique reproductive adaptations to offset its low fecundity, thus enhancing its survival and fitness. To address this, we conducted a comprehensive study utilizing 28 mature female specimens of D. colletei, carefully measuring fecundity and GSI to shed light on the reproductive adaptations of this species. Our findings reveal that D. colletei indeed exhibits low fecundity, with a mean of 16.76 ± 2.01, and a mean GSI of 12.83 ± 1.27, providing crucial insights into the reproductive mechanisms at play in this species. These results underscore the existence of unique reproductive strategies in D. colletei, enabling its adaptation and persistence in Borneo's diverse aquatic ecosystems, and call for further ecological research to elucidate these mechanisms. This study lends to a better understanding of viviparous fish in Borneo and contributes to the broader field of aquatic ecology, enhancing our knowledge of species adaptations to unique ecological challenges.
1. IOSR Journal of Pharmacy and Biological Sciences (IOSR-JPBS)
e-ISSN: 2278-3008, p-ISSN:2319-7676. Volume 10, Issue 1 Ver. 1 (Jan -Feb. 2015), PP 36-42
www.iosrjournals.org
DOI: 10.9790/3008-10113642 www.iosrjournals.org 36 | Page
DNA damage repair Neil3 gene Knockout in MOLT-4
Perry H. Saifullah
Assis Prof. Biochemistry, Department Chemistry, College of Science for women, University of Baghdad
Abstract: RNAi is superannuated cellular mechanism that protect organism against viruses that replicate
through double- stranded RNA. RNAi can be used to diminish gene expression from plasmid expressing and
inserted sequence repeat. A stable harpin would be expressed after the vector was integrated into the genome.
In this paper a shiRNA expressing vector for Neil3 was designed and developed which is capable of replication
in MOLT-4. This shiRNA vector had the ability to arose the RNAi pathway, and reduce the gene expression of
Neil3. This was assessed by using pSilence 4.1CMV as a vector, and Gapdh as positive control.
Key words: Neil3, Gapdh, shiRNA, MOLT-4, gene knockout
I. Introduction
An evolutionary preserved pathway, the base excision repair ( BER) , a reformatory repair pathway to
prevent mutagenesis and cytotoxicity1 . Five key enzymatic steps are involved in the repair response which aim
to abstract the initial DNA damages and restore the genetic material back to its original state1,2 (1) excision of
an inadequate base , (2) incision of phosphate backbone at a resulting abasic site, (3) authorization unabated
repair synthesis and , or nick ligation by termini clean-up , (4) gap-filling to substitute the excised nucleotide,
and finally (5) sealind of the final DNA nick1,2.
First enzymes in BER are DNA glycosylases, which distinguish the wrong bases, excise the damage
and stock substrate for the later enzymes in the pathway 3. Five DNA glycosylase that are specific for oxidative
DNA base damage have been assigned in Human cells, OGG1, NTH1, Neil1, Neil2, Neil33,4. OGG1 , is
responsible for excision a mutagenic base byproduct which is the result of DNA exposure to ROS ( hydroxyl
radical OH.), the 8-oxoguanin.5 NHT1 removes oxidized pyrimidine from dd DNA.4 NEIL1 removes oxidized
pyrimidines and some purines from ddDNA , Neil 2, Neil3 preferred ssDNA4.
The glycosylase activity of human NEIL3 is on both single-stranded and duplex DNA containing Tg
and Sp [59]. NEIL3 a proteins exhibit very weak lyase activity which occurs primarily via β-elimination,
leaving an α, β-unsaturated aldehyde at the 3’terminus . In contrast, most other Fpg/Nei family members exhibit
robust lyase activity acting primarily via β,δ-elimination leaving cleavage products with 3′ phosphate termini 6.
Few literatures worked on NEIL3 knockout in cell line, especially MOLT-4. In this paper I focused on
Neil3 genotyping in MOLT-4 cells, and transfection these cell with pNeil3 vector by using pSilencer 4.1 CMV
(gene silencing technique), pGapdh was used as a positive control.
II. Material and Methods
Reagents and there composition are listed in table (1)( All reagents all analytical grade from Sigma)
Table (1) reagent composition
ReagentsComposition
10x TBE buffer0.89M Tris. , 0.89M boric acid, 20M EDTA (pH 8.3)
Agarose gel DNA loading buffer(w/v) bromophenol blue, 025%(w/v)xylene cyanol,
30%(v/v)glycerol, 10M EDTA
Annealing buffer50mMNaCl, 10mM Tris HCl, 0.1mM EDTA (pH8.3)
PBS10x stock solution (Invitrogen) , diluted with dd H2O to 1x (
pH7.4).
Restriction Enzyme
Restriction enzymes were accommodated from New England Biolabs ( NEB), stored at -20. All restriction
endonuclease used for diagnostic restriction digestion, and cloning the siRNA vector are listed in table (2)
2. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 37 | Page
Table (2) Restriction Enzymes: The annotation in the restriction site sequence is the position the restriction
endonuclease cuts.
Restriction EndonucleasesRestriction site
HindIII-HF
BamHI-HF
Oligonucleotides
An inverted complementary DNA sequence must be expressed within the cell for stable reduction of
gene expression . A hairpin loop should be performed , once this inverted sequence is expressed, double –strand
RNA imitated, know trigger for RNAi. Only target sites specific for gene insert were chosen, these target sites
appeared at least two out of the four computer programs which were checked for homology to other sequence in
the human genome( 7-11). The target sequence for Gapdh was the sequence used by Ambion as the positive
control in the pSilencerTM 4.1-CMV puro siRNA kit. The oligonucleotide inserts for pshRNA were designed to
have the sense target (18-20 nucleotides) and the corresponding inverted antisense sequence separated by a 9
nucleotide loop sequence (5′-TTCAAGAGA-3′)7-12 .The inverted repeats were flanked at the 5′ end by an
BamH I site, and at the 3′ end with a RNA polymerase termination signal of 6 thymine residues and a Hind III
site for ease of cloning into pshRNA , fig (1). PCR oligonucleotide that used for genotyping MOL-4 cell line
and PCR nucleotide are showed in table 3.
Fig (1) A: pSilencer 4.1 CMV puro
Fig(1) B: Sequence of (˜ 55bp) , the sense and antisense sequence for neil3 and Gapdh, loop, cloning site
BamHI & HindIII.
Table (3) DNA oligonucleotides used in genotyping and PCR
GenotypeSequence 5′ to 3′
Neil3ForwardACTGAAT GGAGAGAAGATCCGGG
ReverseCAGCTCCTTCCCTAA GGTTTCCA
GapdhForwardAACTTTGGCATTGTGGAAGG
ReverseACACATTGGGGGTAGGAACA
PCRSequence 5′ to 3′
Neil3ForwardGGGCAACATCATCAAAAATGAA
ReverseCTGTTTGTCTGATAGTTGACACACCTT
GapdhForwardTCGTCCCGTAGACAAAATGGT
ReverseCGCCCAATACGGCCAAA
3. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 38 | Page
Cell culture
Molt-4 cell lines were examined in this study for gene silencing. MOLT-4 cells are T-4 cell lines which
were initially derived in 1971 from T-cell acute lymphoblastic leukemia patients12. Memorialization was done
by continuous growth at 20% O2. MOLT-4 cell line were preserved in RPMI 1640 medium ( Invitrogen),
supplemented with 10% FBS ( Invitrogen), and 2 mM L-Glutamine (Invitrogen) at 37C0, 5% CO2, 3% O2.
Cells were subcultured every 2-3 days, by pipetting the cell solution into universal flask, centrifuged for
5minutes at 125g. Supernatant were removed, and the cells were re-suspended in fresh medium. Cells were
counted by a haematocytometer .
Optimizing Antibiotic Selection Conditions
Concentration of the antibiotic (puromycin) that killed non–transfected cells were determined. MOLT-
4 cells were platted in 2x104 , and 4x104 cell/well of 12 well plate and incubated for 24 hours. Puromycin was
added to the wells at the concentration range from 0 – 4 µg/ml .
Cell were cultured for 14 days, replacing the puromycin–containing medium every 3 days.Wells were
examined for viable cells at 100x magnification every 2 days to identify the lowest puromycin concentration
that began to give massive cell death in approximately 5-7 days ,and kills all cells within 2 weeks. This
concentration was used to select cell containing the pSilencer 4.1CMV puromycin ( DNA plasmid) after
transfection.
Annealing the hairpin siRNA template oligonucleotides
Both sense and antisense siRNA for ( NEIL3 and GAPDH)(1µg/µl) were annealed through mixing
with 1xDNA annealing solution , reaction mixtures were completed to 50µl, heated 90 to C0 for 3min, then
placed in 16 C0 overnight incubation. The annealed hairpin siRNA template insert can either be ligated into a
pSilencer 4.1-CMV vector immediately or stored at –20°C for future ligation.
Ligation of annealed siRNA template insert ( NEIL3 and GAPDH ) into the pSilencer 4.1-CMV vector
An 8ng/µl of the diluted annealed hairpin siRNA insert ( NEIL3 , GAPDH) were use in a two set
reaction. The annealed were added to a 10x T4DNA ligase buffer, pSilencer CMV vector ( Ambion ,
Cambridge shire, UK) ,and (5U/µl) T4DNA ligase. The reactions were incubated overnight at 16C0 for high
ligation efficiency. Plasmid DNA was transformed in E.coli strains.
Transforming E. coli with the ligation products ( pNeil3 and pGapdh ) vectors
NovaBlue ( Novagen) competent E.coli strains were used for DNA plasmid transformation . The
medium composition for growing E coli strains is LB agar ( 10 g/L tryptone, 5g/L yeast extract, 17 mM NaCl ,
20 g/L bacto –agar).
For transformation of NovaBlue competent strains, 20µl of aliquots of cells were pipetted in pre-cooled
tube in ice for 5min to thaw. Plasmid DNA solution (1 µl) was added directly to the cells and mixed, incubated
in ice for approximately 5 min. Tubes were then heated for exactly 30sec in 42 C0 water bath without shaking,
and replaced in ice for 2 min to entitle the uptake of DNA plasmid into the bacterial cells. At room temperature,
(80 µl) of SOC (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4,
and 20 mM glucose) were added to the miture. Transformation were accomplished by platting the cells on LB
agar medium containing ampiciline ( 50µg/ml) and incubated overnight at
Inoculating a Liquid Bacterial Culture:
To isolate the transformed E.coli cells with plasmid DNA which is resistance to antibiotic, five
colonies from LB agar plate were picked, mixed with LB broth (5ml) containing ampiciline ( 50µg/ml) and
incubated 24 hours at with shaking (250rpm). After incubation growth was checked, which was characterized by
a cloudy haze in the medium
Plasmid Purification
To purify the plasmid DNA from the transformed E.coli cells, mini-probe ( Promega) plasmid DNA
purification protocol was used . The bacterial cell were lysed using a modified alkaline lysis solution, which will
lysis the cell and denature the plasmid DNA. DNA solution then neutralized to snap back the plasmid DNA into
double –stranded. The precipitant were removed by centrifugation. The supernatant was then applied to the
silica –gel membrane for further purification of the plasmid DNA. dsDNA will stick to the membrane, and
eluted from the membrane by using a low – ionic strength buffer or nuclease free water. The plasmid DNA
concentration was determined by absorption at 260nm using ND-2000 spectrophotometer (Thermo scientific).
4. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 39 | Page
Restriction Enzyme Digests.
Routine diagnostic endonuclease enzyme digest were performed for both plasmid GAPDH, and
plasmid NEIL3 . plasmid DNA (a 300 µg/ µl ), 2 µl of enzyme buffer, 0.5U Hind III, 0.5 BamH I, the reaction
volume was completed 20 µl by free nuclease water, incubation for 1.30hrs at 37 C0. Inactivation of the
reaction was accomplished by heating at 60 C0 for 20 min.
Agarose Gel Electrophoresis
Agarose gel electrophoresis was used to isolate plasmid DNA ( GAPDH , NIEL3). Agarose gel was
dissolved 0.5gm of the gel ( for DNA fragments less than 1kd)in 1x TBE, procceded by adding 4 µg/ml
ethidium bromide. Each sample loaded per gel well consists of plasmid DNA, loading buffer, and diluted with
free nuclease water. DNA ( hyperladder) ( promega) was used to identify the size of the DNA fragments.
Electrophoresis( Labnet) was performed in 1x TBE at 90 volt for 60min. DNA bands were visualized under UV
trasilluminater.
Generation of stable knockdown mammalian cells ( MOLT-4 ) ( Plasmid transfection for both gene
GAPDH and Neil3)
Before stable knockdown for both genes ( Neil3 and GAPDH), the reaction conditions for MOLT-4
cell line were optimized to ensure best transfection results. The recommended starting conditions were: cell
density, MOLT-4 cell density was ≥ 80 %, DNA samples were highly purified with A260/ A280 absorbance
ratio of 1.8-2.0 and using appropriated cell culture medium. Other conditions like ratio of TransIT-LT1
reagent to DNA complex formation condition, and post- transfection incubation time were sated in
transfection protocol as mentioned later.
Immortalized MOLT-4 were plated at a cell density of 2x105 cell/well in a 24 well plate and incubated
at 37C0 , 5%CO2, 3%O2 until 90% cell confluency . For transfection, 1µg of plasmid vector DNA was diluted
with 500µl of complete growth medium, (opti-MEM reduced medium) (with 5 min incubation) a 1.5µl TransIT-
LT1 reagent, 50 µl of serum free medium was added respectively to the mixture, mixed and incubated for 30min
in RT. Mixture was added to the MOLT-4 cells drop-wise to different area of the well within 2 min and
incubated for 48 hours. Cells were harvested and re-plated in 24 well /plate and 4µg/ml of puromycin were
added to the medium to select for resistant cells. Fresh pyromycin containing medium was added to the cells
every 3-4 days until wells containing individual colonies could be identified. Individual clones were expanded
for ~ 5 passages in pyromycin containing medium to ensure the clones were antibiotic resistant.( a negative
control with no plasmid were needed to check that all the cells have been killed by the puromycin).
Extraction of total RNA
Extraction of total RNA were performed for both non- transfected and transfected MOLT-4 cell line,
first one was to identify the existence of Neil3 gene and the second was to test the efficiency of gene silencing
achieved by the target vector, the level of target gene expression in the stable knockdown cell lines was assayed
by PCR. RNA extraction was performed by using PureLink RNA Mini Kit ( Ambion)
Molt-4 cell ( 1x10 6 cell) were translated to an RNAase – free tube and centrifuged for 2000xg for 5
min at 5 c0 , the supernatant was discarded. A fixed volume of lysis buffer was added to the cells, mixed, until
the cells appeared to sample was lysed. Ethanol 70 % were added to homogenate and mixed. Sample was added
to a silica column centrifuged at 12000xg for 15
sec. at rt., this will insure that all RNA molecules would bind to the silica. , the silica mini columns
were washed thoroughly with washing buffer I and washing buffer II respectively. RNA samples were collected
by washing the silica mini tubes with RNAase free water and the concentration of the RNA samples were
determined by absorption at 260nm using ND-2000 spectrophotometer ( Thermo scientific).
First strand cDNA synthesis:
Reversal transcription reactions was performed to form c DNA from m RNA that consisted in the
cellular total RNA samples for both non –transfected and transfected MOLT-4 cell line. A ( 500 ng/ml) of oligo
(dT)12-18 were added to specifically (19.5 ng/µl) of total RNA samples, followed by (10 mM ) of dNTP(mix) ,
the reaction mixture were completed to 12µl with sdH2O. After heating the mixture at 65 C0 for 5 min and
quiche chilled on ice later. A 5 X first – strand buffer, 0.1 M DTT, 40U/µl of RNase OWT were added to the
mixture, and mixed gently, incubated at 42 C0 for 2 min. SuperScript II RT ( 200 Units) were added to the
mixture , incubated at 42 C0 for 52 min. Finally the reactions were deactivated by heating at 70 C0 for 15 min.
PCR:
PCR was first performed to the non- transfected MOLT-4 to examine the expression of Neil3 gene, in the
association with housekeeping gene (GAPDH)
5. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 40 | Page
PCR for non – transfected MOLT-4 cell line (genotyping for Neil3, and Gapdh):
PCR reactions were performed in 50 ul using 200ng of cDNA , 20uM of each primers( table 3), in
DNase free PCR tubes, 2 X of MY TaqMix ( BioLine. UK)13 was added to the mixture, and reactions were
completed to the exact volume with DNase free water. PCR protocol was 1 cycle at 95C0 for 1 min, 30 cycle of
at 95C0 for 15sec, 57C0 for 15 sec, and 72 C0 for 30sec, and 1 cylce at 72 C0 for 1 min. the PCR products were
assessed by agarose gel electrophoresis( 2.5% agarose gel in 0.5 x TBE ) and performed at 80 volts for 20 min .
DNA bands were visualized under UV trasilluminater.
PCR for transfected MOLT-4 cell line by ( pNeil3, pGapdh, psilencer 4.1 CMV):
PCR reaction were performend as with the non – transfected MOLT-4 . Primers are mentioned in table(3)
III. Result and discussion
Genotyping the Neil3 and housekeeping gene Gapdh in MOLT-4
To study the inhibitory effect of hsiRNA, MOLT-4 cell line was used for this study. To confirm the
existence of Neil3 and Gapdh, total RNA was extracted from Molt-4 and cDNA were formed for genotyping,
finally PCR reaction was performed by using designed primers to amplify the genes. Fig ( ) revealed the
amplified fragment of DNA from Neil3 and Gapdh, thus confirming the expected genotype.
Neil3 has been shown to be highly expressed in various tumor types and to synchronic with
organogenesis. Taking in regards to these observations , and the truth that no durable DNA glycosylase activity
has been detected, elucidate that Neil3 is a protein involve in the process but not a typical DNA glycosylase.
Neil3 take place in extensive proliferative process, it is a hallmark substance as tumor developing, progressing
and brain development (14, 15.16).
Figure 2: PCR to confirm the genotype Neil3, Gapdh
Lane 1: Neil3 gene in MOLT-4 cell, Lane 2 : Gapdh in MOLT-4 cell, Lane 3: Marker
Establishment the optimum condition for MOLT-4 transfection .
MOLT-4 cell line would be transfected with shiRNA expression vector that modulate the expression of
both Neil3 and Gapdh genes. This vector contains puromycin resistance gene, therefore cells containing shiRNA
vector can sustain in the presence of puromycin. The preserver concentration of puromycin was determined by
adding increasing concentration of puromycin to the cell culture medium and utilized to MOLT-4. 0.5 µg/ml
was the concentration of puromycin that result in approximately 70% of MOLT-4 death ( eye examination) after
3 days, and full cell death after two weeks. This concentration was chosen for the isolation of resistant cell
colonies after transfection.
A 0.75 µg/ml of puromycin was used as an ultimate concentration to initiate the generation of stable gal3
knockout cell line (17).
Generation of plasmid DNA : pNeil3 and pGapdh
For long Neil4 and Gapdh knockdown, siRNA were designed for these two genes, cloned into
pSilencer 4.1 CMV puro (Ambion), as approximately 55bp hairpin loop between restricted site HindIII and
BamH1. E. Coli. Cells were transformed with plasmid DNA for gene Niel3, and housekeeping gene GAPDH
(plasmid DNA : pSilencer cmv4.1 + insert( Neil3, and Gapdh) respectively , by using heat-shock method. The
transformation was approved by further growth of selected transformed Ecoli in liquid LB broth medium
containing 50ug/ml of carbancilin. Plasmid DNA samples were isolated from confirmed transformed Ecoli , a
6. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 41 | Page
restriction digest was performed with HindIII HF, and BamHI HF , two bands were distinguished in the gel ,
first with higher nucleotides 4535nt , and the second 22nt, Fig (3).
Nox4 was knokdown successfully by using pSilencer 4.1 CMV and resulted in lowering vascular
endothelial growth factor transcription, and decreasing the transforming growth (18). MRAP expression in cells
was knoked down by the iRNA using siRNA duplexes cloned into BamH1 and HindIII digest pSilencer 4.1
CMV neo expression vector (19) , pSilencer was further used to create plasmid expression miR-17-5P (20).
Stable Transfection of MOLT-4 with pNeil3 and pGapdh
MOLT-4 cell line was stably transfected with pNeil3 and pGapdh to generate MOLT-4 with pshRNA
vector. The transfection on MOLT_4 was performed with pshRNA of Neil3, Gapdh, or pSilencer 4.1 CMV
without insert. Cell culture medium containing 0.5 ug/ml puromycin was used to select positively transfected
MOLT-4. Individual colonies were isolated to assure homogenous population, and developed for a number of
passages in puromycin medium. As the MOLT-4 + psh Neil3 and MOLT-4 + psh Gapdh colonies was
confirmed. To prevent unusual gene expression resulting from the existence of puromycin , the antibiotic was
removed from the culturing medium.
Fig (3): Purified plasmid DNA for Neil3, Gapdh from transformed E.coli
Lane 1: Hyperladder, Lane2 : pNeil3, Lane 3: pGapdh
Potential knockdown of Neil3 and Gapdh genes .
RNA was extracted from transfected MOLT-4 +pNeil3, and MOLT-4 +pGapdh clones, and cDNA
were generated by reverse transcription PCR to project for potential reduction in Neil3 and Gapdh gene
expression. The oligonucleotide primers characteristic for Neil3 and Gapdh genes were mixed with cDNA
samples and subjected to PCR to decide any alteration in the levels of mRNA for both neil3 and Gapdh genes.
Fig(4 ) , PCR screen showed reduced intensity for both Neil3 and Gapdh genes as compared to MOLT-4 with
empty vector cDNA. This represents a potential Neil3 and Gapdh knockdown target. This result revealed that
Neil3 knockdown underscore the usefulness of this knockdown on human tumor prolifrative and developing, (
no references were found that support this result) Further studies is needed on MOLT-4 phenotyping to show the
effect on Neil3 transfection the cancer proliferation and prognosis.
Acknowledgements
My Deep acknowledgements to Afaq Kadhim, for her support and advice
References
[1]. Kim YJ1, Wilson DM 3rd. Overview of base excision repair biochemistry, Curr Mol Pharmacol. 2012 Jan;5(1):3-13
[2]. Yngve Sejersteda,b,c,1, Gunn A. Hildrestranda,c,1, David Kunkea,c,2, Veslemøy Rolsetha,c, Silje Z. Krokeidea,et.al Endonuclease
VIII-like 3 (Neil3) DNA glycosylase promotes neurogenesis induced by hypoxia-ischemia, 18802–18807 | PNAS | November 15,
2011 | vol. 108 | no. 46.
[3]. Jia Zhou1, Minmin Liu1,3, Aaron M. Fleming2, Cynthia J. Burrows2, Susan S. Wallace, Neil3 and NEIL1 DNA glycosylases
remove oxidative damages from quadruplex DNA and exhibit preferences for lesions in the telomeric sequence context( 2013),
Journal of Biological Chemistry, 288, 27263-27272.
7. DNA damage repair Neil3 gene Knockout in MOLT-4
DOI: 10.9790/3008-10113642 www.iosrjournals.org 42 | Page
[4]. Duclos, S., Doublié, S., and Wallace, S. S. (2012) Consequences and repair of oxidative DNA damage. in The Cellular Response to
the Genotoxic Insult: The Question of Threshold forGenotoxic Carcinogens (Greim, H., and Albertini, R. J. eds.), The Royal
Society of Chemistry, Cambridge, United Kingdom. pp 15-159
[5]. Lee HT1, Lin CS, Lee CS, Tsai CY, Wei YH. Increased 8-hydroxy-2'-deoxyguanosine in plasma and decreased mRNA expression
of human 8-oxoguanine DNA glycosylase 1, anti-oxidant enzymes, mitochondrial biogenesis-related proteins and glycolytic
enzymes in leucocytes in patients with systemic lupus erythematosus. Clin Exp Immunol. 2014 Apr;176(1):66-77. doi:
10.1111/cei.12256.
[6]. Minmin Liu, Sylvie Doublié, and Susan S. Wallace* Neil3, the final frontier for the DNA glycosylases that recognize oxidative
damage, Published online Dec 26, 2012. doi: 10.1016/j.mrfmmm.2012.12.003
[7]. Ambion. "The RNA Interference Resource". http://www.ambion.com/techlib/resources/RNAi/index.html
[8]. Dharmacon. "Dharmacon RNAi Technologies". http://www.dharmacon.com/DesignCenter/DesignCenterPage.aspx .
[9]. Whitehead Institute. "SiRNA at Whitehead". http://jura.wi.mit.edu/bioc/siRNAext/
[10]. Broad Institute. "The RNAi Consortium ShRNA Design Process". http://www.broad.mit.edu/science/projects/rnai-consortium/trc-
shrna-design-process
[11]. http://www.lifetechnologies.com/uk/en/home/references/ambion-tech-support/rnai-sirna/general-articles/-sirna-design-
guidelines.html
[12]. Greenberg JM1, Gonzalez-Sarmiento R, Arthur DC, Wilkowski CW, Streifel BJ, Kersey JH.(1988) Immunophenotypic and
cytogenetic analysis of Molt-3 and Molt-4: human T-lymphoid cell lines with rearrangement of chromosome 7. Blood.
Nov;72(5):1755-60.
[13]. www.bioline.com
[14]. Gunn A Hildrestrand1, Christine G Neurauter1, Dzung B Diep2, Cesilie G Castellanos3, Stefan Krauss1, Magnar Bjørås1 and Luisa
Luna1*Expression patterns of Neil3 during embryonic brain development and neoplasia BMC Neuroscience 2009, 10:45
doi:10.1186/1471-2202-10-45
[15]. Krokeide SZ, Bolstad N, Laerdahl JK, Bjoras M, Luna L: Expression and purification of NEIL3, a human DNA glycosylase
homolog, Protein Expr Purif 2009, 65:160-164.
[16]. Kauffmann A, Rosselli F, Lazar V, Winnepenninckx V, Mansuet-Lupo A, Dessen P, Oord JJ, Spatz A, Sarasin A: High expression
of DNA repair pathways is associated with metastasis in melanoma patients. Oncogene 2008, 27:565-573.
[17]. Prasun Guhaa,b, Engin Kaptana,b, Gargi Bandyopadhyayaa,b, Sabina Kaczanowskac, Eduardo Davilac,d Keyata Thompsone,
Stuart S. Martind,e, Dhananjaya V. Kalvakolanud,f, Gerardo R. Vastab,f, and Hafiz Ahmeda( 2013) Cod glycopeptide with
picomolar affinity to galectin-3 suppresses T-cell apoptosis and prostate cancer metastasis, 5052–5057 | PNAS | March 26, 2013 |
vol. 110 | no. 13 , http://www.pnas.org/content/suppl/2013/03/08/1202653110.DCSupplemental/pnas.201202653SI.pdf
[18]. Jodi K. Maranchie, and Ye Zhan( 2005) Nox4 Is Critical for Hypoxia-Inducible Factor 2-α Transcriptional Activity in von Hippel-
Lindau–Deficient Renal Cell Carcinoma Cancer Res October 15, 2005 65; 9190.
[19]. Zhou H, Xu M, Huang Q, Gates AT, Zhang XD, Castle JC, Stec E, Ferrer M, Strulovici B, Hazuda DJ, Espeseth AS: Genome-scale
RNAi screen for host factors required for HIV replication. Cell Host Microbe 2008, 4:495-504.
[20]. Sadani N. Cooray, Isabel Almiro Do Vale, Kit-Yi Leung, Tom R. Webb, J. Paul Chapple, Michaela Egertova´, Michael E.
Cheetham, Maurice R. Elphick, and Adrian J. L. Clark (2008) The Melanocortin 2 Receptor Accessory Protein Exists asa
Homodimer and Is Essential for the Function of the Melanocortin 2 Receptor in the Mouse Y1 Cell Line, Endocrinology, April
2008, 149(4):1935–1941
[21]. Nicole Cloonan*, Mellissa K Brown*, Anita L Steptoe*, Shivangi Wani*, Wei Ling Chan^*, Alistair RR Forrest*‡, Gabriel Kolle*,
Brian Gabrielli† and Sean M Grimmond* (2008) The miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle
transition , Genome Biology 2008, 9:R127 (doi:10.1186/gb-2008-9-8-r127).