This proposal seeks funding to develop an assay to determine the efficiency of the E. coli γ-complex clamp loader loading the E. coli β-clamp onto DNA. The researcher will purify proteins and assemble the γ-complex. An oligonucleotide will be biotinylated and annealed to bind to streptavidin beads. The γ-complex will load β-clamp onto the DNA using varying ratios and times. Analyzing samples by SDS-PAGE will optimize conditions and verify loading. Developing this assay will allow future study of the β-clamp-clamp loader complex role in DNA replication. Challenges include optimizing protein ratios and times to achieve sufficient loading without unloading.
This laboratory report summarizes an experiment exploring RNA splicing in Drosophila melanogaster. Genomic DNA and total RNA were extracted from fruit flies and used to study the rngo gene. PCR and RT-PCR were performed on the genomic DNA and cDNA samples. The genomic PCR product was cloned and sequenced. Bioinformatics analysis showed the genomic sequence was longer, containing introns absent from the cDNA, indicating splicing of the rngo pre-mRNA. Future work could investigate other splicing sites and homology to human genes.
This study characterized the Dvilp7 gene from Drosophila virilis through a series of experiments. RNA was purified from D. virilis and used to construct cDNA. RACE experiments were used to amplify the 5' and 3' ends of the Dvilp7 cDNA sequence. The full Dvilp7 cDNA sequence was assembled and found to encode a putative protein with a signal peptide. Genomic DNA was also sequenced and compared to determine intron sequences. Characterizing the Dvilp7 gene expands understanding of the genetic mechanisms regulating insulin signaling in Drosophila.
N-acetyl-D-glucosamine kinase (NAGK) interacts with dynein light-chain roadblock type 1 (DYNLRB1) at dendritic branch points in neurons. Immunocytochemistry and proximity ligation assays showed colocalization of NAGK and DYNLRB1 on microtubule fibers at dendritic branches. NAGK was also found to interact with Golgi outposts and DYNLRB1 at branch points, indicating a tripartite interaction between NAGK, dynein, and Golgi that regulates dendritic growth and branching. Introduction of a peptide derived from DYNLRB1 stunted dendrite development in cultured neurons.
This document summarizes the expression of recombinant β-lactoglobulin (rBLG) in prokaryotic and eukaryotic cells. In Escherichia coli, rBLG was expressed with a pET26 vector and was found predominantly in a denatured form, even when expressed in the periplasm. In eukaryotic cells like COS-7 and mouse tibialis muscle, rBLG was expressed in its native conformation. The authors quantified rBLG expression using immunoassays that distinguish between native and denatured rBLG. They found higher expression levels and native folding of rBLG in eukaryotic systems compared to prokaryotic expression
Karen Hatten Experiment II Final ReportKaren Hatten
This experiment transformed the cyanobacterium Synechocystis sp. PCC 6803 in two parts. Part A introduced a mutation to the psbC gene, which encodes a chlorophyll-binding protein, via a plasmid. This disrupted photosystem II and allowed selection of transformed cells. Part B amplified the wild-type psbC gene, cloned it into a plasmid, and transformed mutant cells to restore photosystem function. Various DNA manipulations, transformations, and selections were performed to characterize and select transformed cells at each step.
This document summarizes an experiment that aimed to change both the expression level and color of the fluorescent protein mCherry. The experiment involved:
1) Using restriction digestion and ligation to swap the promoter of mCherry from low to high expression, resulting in more mCherry colonies.
2) Attempting site-directed mutagenesis to change mCherry to mOrange but this was unsuccessful, as no orange colonies were observed.
3) Characterizing the fluorescence of mCherry, mOrange from a partner, and a negative control colony, finding mOrange emitted better at 500nm.
This study aims to analyze conserved amino acids in GAPDH proteins from tropical plants Oxalis corniculata and Plectranthus amboinicus. GAPDH is important for energy production. Previous work cloned GAPDH genes from these plants and Myrtaceae psidium. Psidium showed no cloning and was eliminated. The current work will sequence the cloned GAPDH inserts and analyze conserved amino acids related to catalytic function through bioinformatics. This adds to knowledge of important plant genes and their evolution.
This laboratory report summarizes an experiment exploring RNA splicing in Drosophila melanogaster. Genomic DNA and total RNA were extracted from fruit flies and used to study the rngo gene. PCR and RT-PCR were performed on the genomic DNA and cDNA samples. The genomic PCR product was cloned and sequenced. Bioinformatics analysis showed the genomic sequence was longer, containing introns absent from the cDNA, indicating splicing of the rngo pre-mRNA. Future work could investigate other splicing sites and homology to human genes.
This study characterized the Dvilp7 gene from Drosophila virilis through a series of experiments. RNA was purified from D. virilis and used to construct cDNA. RACE experiments were used to amplify the 5' and 3' ends of the Dvilp7 cDNA sequence. The full Dvilp7 cDNA sequence was assembled and found to encode a putative protein with a signal peptide. Genomic DNA was also sequenced and compared to determine intron sequences. Characterizing the Dvilp7 gene expands understanding of the genetic mechanisms regulating insulin signaling in Drosophila.
N-acetyl-D-glucosamine kinase (NAGK) interacts with dynein light-chain roadblock type 1 (DYNLRB1) at dendritic branch points in neurons. Immunocytochemistry and proximity ligation assays showed colocalization of NAGK and DYNLRB1 on microtubule fibers at dendritic branches. NAGK was also found to interact with Golgi outposts and DYNLRB1 at branch points, indicating a tripartite interaction between NAGK, dynein, and Golgi that regulates dendritic growth and branching. Introduction of a peptide derived from DYNLRB1 stunted dendrite development in cultured neurons.
This document summarizes the expression of recombinant β-lactoglobulin (rBLG) in prokaryotic and eukaryotic cells. In Escherichia coli, rBLG was expressed with a pET26 vector and was found predominantly in a denatured form, even when expressed in the periplasm. In eukaryotic cells like COS-7 and mouse tibialis muscle, rBLG was expressed in its native conformation. The authors quantified rBLG expression using immunoassays that distinguish between native and denatured rBLG. They found higher expression levels and native folding of rBLG in eukaryotic systems compared to prokaryotic expression
Karen Hatten Experiment II Final ReportKaren Hatten
This experiment transformed the cyanobacterium Synechocystis sp. PCC 6803 in two parts. Part A introduced a mutation to the psbC gene, which encodes a chlorophyll-binding protein, via a plasmid. This disrupted photosystem II and allowed selection of transformed cells. Part B amplified the wild-type psbC gene, cloned it into a plasmid, and transformed mutant cells to restore photosystem function. Various DNA manipulations, transformations, and selections were performed to characterize and select transformed cells at each step.
This document summarizes an experiment that aimed to change both the expression level and color of the fluorescent protein mCherry. The experiment involved:
1) Using restriction digestion and ligation to swap the promoter of mCherry from low to high expression, resulting in more mCherry colonies.
2) Attempting site-directed mutagenesis to change mCherry to mOrange but this was unsuccessful, as no orange colonies were observed.
3) Characterizing the fluorescence of mCherry, mOrange from a partner, and a negative control colony, finding mOrange emitted better at 500nm.
This study aims to analyze conserved amino acids in GAPDH proteins from tropical plants Oxalis corniculata and Plectranthus amboinicus. GAPDH is important for energy production. Previous work cloned GAPDH genes from these plants and Myrtaceae psidium. Psidium showed no cloning and was eliminated. The current work will sequence the cloned GAPDH inserts and analyze conserved amino acids related to catalytic function through bioinformatics. This adds to knowledge of important plant genes and their evolution.
This study aims to clone and analyze GAPDH genes from various plant species to compare amino acid sequences related to catalytic function. Previous work successfully cloned GAPDH from Oxalis corniculata and Plectranthus amboinicus but not Myrtaceae psidium. The current study will continue work on the cloned samples through midipreps, restriction enzyme digestion and sequencing. Sequence data will undergo bioinformatics analysis to compare conserved amino acids of the GAPDH protein between plant species. Results could provide new genetic information published in GenBank and further the understanding of energy production pathways in plants.
The document discusses various gene editing technologies. It begins by introducing genome/gene editing as a type of genetic engineering that uses engineered nucleases to precisely modify genomes by creating DNA insertions, deletions, or replacements at specific DNA sequences. It then describes three main gene editing systems - zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system. For each system, it provides details on the nuclease domains, methods for engineering DNA binding specificity, and mechanisms for creating DNA double strand breaks to facilitate gene modifications.
ReedWoyda_Introducing Green Fluorescence Into Homo sapiens And Escherichia Co...Reed Woyda
This study aimed to introduce the green fluorescent protein (GFP) gene into E. coli and human cells. GFP was successfully inserted into E. coli and shown to be expressed under control of the L-arabinose promoter. Addition of restriction sites to GFP was also successful, allowing for digestion of the GFP and pcDNA plasmid. However, ligation of the digested GFP fragment into pcDNA was unsuccessful, likely due to nuclease contamination. Expression of GFP in human cells could not be verified due to a technical error during immunoblotting. While some goals were achieved, such as GFP expression in E. coli, further optimization is needed to fully introduce GFP into human cells via this methodology.
This document summarizes work done on culturing crocodile cell lines and cloning the parc gene from Pseudomonas keratitis. Primary crocodile cell lines were established from various organs and immortalized using hTERT. The parc gene was cloned from mutant and wild-type Pseudomonas strains and will be expressed and crystallized to study its role in quinolone antibiotic resistance.
Cpf1- a new tool for CRISPR genome editingSachin Bhor
Cpf1 is a new genome editing tool that was discovered as part of bacterial CRISPR immune systems. It is an RNA-guided DNA nuclease that provides immunity in bacteria. Unlike Cas9, Cpf1 cleaves DNA distal to a T-rich protospacer adjacent motif (PAM) in a staggered pattern. Several Cpf1 orthologs have been shown to mediate robust genome editing in human cells. Cpf1 expands the targeting range of CRISPR to include AT-rich regions and requires only a single short CRISPR RNA for guiding, representing advantages over the Cas9 system.
Peptide nucleic acid (PNA) is a synthetic analogue of nucleic acids (DNA & RNA) with unique characteristics and several potential applications in biotechnology and biomedicine. This presentation is a slide format of an 2020 review article from Yale university scientists focused on genome editing application of PNA in votro, ex vivo and in vivo.
This document discusses Polycomb group (PcG) proteins, which are important repressor proteins that regulate gene expression during development. It describes two main PcG complexes, PRC1 and PRC2, and their mechanisms of action, including histone modifications and chromatin compaction. The document also examines a case study on the interaction between the PcG protein LHP1 and deubiquitinating enzymes UBP12 and UBP13 in Arabidopsis thaliana. The study found that UBP12 and UBP13 interact with and help recruit LHP1 to target genes, and are involved in histone deubiquitination, which impacts gene silencing by PcG proteins.
The document summarizes research on the Monascus genome project and related genetic studies. Key points include:
1) The Monascus genome was sequenced to 8x coverage, revealing various genomic features. A Monacolin K biosynthesis gene cluster was identified containing genes for polyketide synthases and other enzymes.
2) An efficient method for genetic transformation of Monascus pilosus was developed using aurintricarboxylic acid.
3) Disruption of the mokA gene and overexpression of the mokH transcription factor gene resulted in loss of and increased Monacolin K production, respectively.
P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is req...David W. Salzman
P68 RNA helicase was identified as being required for unwinding the human let-7 microRNA precursor duplex. Recombinant P68 RNA helicase was shown to unwind the let-7 duplex in vitro. Knockdown of P68 inhibited let-7 microRNA function, indicating P68 is essential for loading let-7 into the silencing complex. This study identifies P68 RNA helicase as playing a key role in the human let-7 microRNA pathway.
By constructing a plasmid containing flanking sequences of the adenylate cyclase gene and a tryptophan marker gene, researchers aim to knockout the adenylate cyclase gene in Schizophyllum commune via homologous recombination. The plasmid would replace the adenylate cyclase sequence with the tryptophan gene in the genome, allowing only cells without adenylate cyclase to grow in media lacking tryptophan. Using a ku80 knockout strain of S. commune increases the likelihood of homologous recombination during transformation. Primers and restriction enzymes were used to amplify flanking sequences and insert them into a vector plasmid to ultimately construct the adenylate cyclase knockout plasmid.
This document discusses the purification of regucalcin (RGN), a calcium-binding protein, from seminal vesicular fluid. It introduces RGN and its functions in maintaining calcium homeostasis and roles in apoptosis and antioxidant activity. The authors describe using PCR, Western blot, and SDS-PAGE techniques to demonstrate that RGN is present in seminal fluid and confirm its identity using mass spectrometry. Their results show RGN can be purified from seminal fluid using an immunoaffinity method and identify its molecular weight. The conclusion states RGN's important roles and potential applications for developing cancer treatments.
Gene Editing: An Essential Tool For Plant BreedingNoreen Fatima
Gene editing is a type of genetic engineering that modifies an organism's DNA by deleting, inserting or replacing parts of the genome. The document discusses several molecular "scissors" or nucleases that can make targeted cuts in DNA, including meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR-Cas9 system. These nucleases are used to induce double-strand breaks that are then repaired through natural cellular mechanisms, allowing for targeted changes to the genome. The techniques have been applied successfully in several crop plants to develop traits like herbicide resistance and disease resistance.
The document summarizes genetic and mutational characterization of the relV gene of Vibrio cholerae, which encodes a small alarmone synthetase protein called RelV. Key findings include:
1) Site-directed mutagenesis identified five amino acid residues (K107, D129, R132, L150, E188) in the RelA-SpoT domain of RelV that are essential for its (p)ppGpp synthetase activity.
2) Progressive deletion analysis determined the functional N-terminal boundary of RelV to be amino acid 59 and the C-terminal boundary to be amino acid 248, indicating that flanking sequences of the RelA-SpoT
This document summarizes a study that compared the DNA binding properties of two Myb transcription factor homologues (Pt Myb 126 and Pt Myb 413) from loblolly pine. The study found that while the two Myb proteins bound to identical DNA sequences, they had different relative affinities for these sequences. It also found that the two Mybs putatively targeted overlapping but distinct sets of genes when searching a eukaryotic promoter database based on their consensus binding sites. The results suggest these Myb proteins evolved different functions in part by evolving the ability to target the same DNA sequences with different relative affinities.
Genome editing technologies allow genetic material to be added, removed or altered at specific locations in an organism's genome. Several approaches exist, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR/Cas9, and base editors. These tools create precise breaks in DNA that can be repaired through non-homologous end joining or homology-directed repair. They enable trait discovery and crop improvement by generating plants with high yield, stress resistance, or other desired properties. While powerful, challenges remain in fully editing complex genomes and reducing off-target mutations.
This document summarizes an RNA project focused on inhibition of Dipeptidyl peptidase-IV (DPP-IV), a treatment for Type 2 Diabetes. Key components included:
1) An Internal Ribosome Entry Site (IRES) to allow translation of multiple protein coding regions. Two IRES sequences from EMCV and NKRF were characterized.
2) A neomycin gene to confer antibiotic resistance for selection.
3) An aptazyme as an RNA "kill switch" activated by theophylline.
4) siRNA targeting the 3' untranslated region of DPP-IV mRNA for cleavage.
5) An RNA-dependent RNA polymerase (
The document summarizes a student laboratory experiment attempting to genetically transform E. coli bacterial cells with a GFP plasmid (pGLO) using heat shock. The expected results were that bacterial cells transformed with the plasmid would grow on ampicillin-containing media and glow under black light. However, the actual results found that all bacterial cells died on ampicillin-containing plates, contradicting expectations. Possible sources of error that could have caused transformation failure are discussed.
Recombinant protein expression and purification Lecturetest
The document discusses recombinant protein expression and engineering. It describes:
1) Cloning or synthesizing the gene of interest, making an expression construct, transfecting cells, purifying the recombinant protein.
2) Factors to consider like the protein's origin (prokaryotic/eukaryotic), required post-translational modifications, and available expression systems.
3) A case study expressing recombinant human alpha-1-acid glycoprotein in E. coli, including vector construction, periplasmic extraction, affinity purification, and yield.
CRISPR- Trap: a clean approach for the generation of gene knockouts and gene replacements in human cells.- a paper is taken for lab presentation. A very good technique having advantages over conventional KO approaches and allow for the generation of clean CRISPR/ Cas9- based KOs.
The study aimed to test the specificity of two antibodies (033 and 1-9E10) for binding the c-myc protein. Human colon carcinoma cells were extracted to obtain cytosolic, nuclear, and nuclear pellet extracts. The 033 antibody bound c-myc in the cytosolic extract at approximately 110 kDa, but the 9E10 antibody did not bind c-myc. This suggests c-myc is not restricted to the nucleus and more research is needed to fully understand c-myc and its role in cancer.
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
This study aims to clone and analyze GAPDH genes from various plant species to compare amino acid sequences related to catalytic function. Previous work successfully cloned GAPDH from Oxalis corniculata and Plectranthus amboinicus but not Myrtaceae psidium. The current study will continue work on the cloned samples through midipreps, restriction enzyme digestion and sequencing. Sequence data will undergo bioinformatics analysis to compare conserved amino acids of the GAPDH protein between plant species. Results could provide new genetic information published in GenBank and further the understanding of energy production pathways in plants.
The document discusses various gene editing technologies. It begins by introducing genome/gene editing as a type of genetic engineering that uses engineered nucleases to precisely modify genomes by creating DNA insertions, deletions, or replacements at specific DNA sequences. It then describes three main gene editing systems - zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 system. For each system, it provides details on the nuclease domains, methods for engineering DNA binding specificity, and mechanisms for creating DNA double strand breaks to facilitate gene modifications.
ReedWoyda_Introducing Green Fluorescence Into Homo sapiens And Escherichia Co...Reed Woyda
This study aimed to introduce the green fluorescent protein (GFP) gene into E. coli and human cells. GFP was successfully inserted into E. coli and shown to be expressed under control of the L-arabinose promoter. Addition of restriction sites to GFP was also successful, allowing for digestion of the GFP and pcDNA plasmid. However, ligation of the digested GFP fragment into pcDNA was unsuccessful, likely due to nuclease contamination. Expression of GFP in human cells could not be verified due to a technical error during immunoblotting. While some goals were achieved, such as GFP expression in E. coli, further optimization is needed to fully introduce GFP into human cells via this methodology.
This document summarizes work done on culturing crocodile cell lines and cloning the parc gene from Pseudomonas keratitis. Primary crocodile cell lines were established from various organs and immortalized using hTERT. The parc gene was cloned from mutant and wild-type Pseudomonas strains and will be expressed and crystallized to study its role in quinolone antibiotic resistance.
Cpf1- a new tool for CRISPR genome editingSachin Bhor
Cpf1 is a new genome editing tool that was discovered as part of bacterial CRISPR immune systems. It is an RNA-guided DNA nuclease that provides immunity in bacteria. Unlike Cas9, Cpf1 cleaves DNA distal to a T-rich protospacer adjacent motif (PAM) in a staggered pattern. Several Cpf1 orthologs have been shown to mediate robust genome editing in human cells. Cpf1 expands the targeting range of CRISPR to include AT-rich regions and requires only a single short CRISPR RNA for guiding, representing advantages over the Cas9 system.
Peptide nucleic acid (PNA) is a synthetic analogue of nucleic acids (DNA & RNA) with unique characteristics and several potential applications in biotechnology and biomedicine. This presentation is a slide format of an 2020 review article from Yale university scientists focused on genome editing application of PNA in votro, ex vivo and in vivo.
This document discusses Polycomb group (PcG) proteins, which are important repressor proteins that regulate gene expression during development. It describes two main PcG complexes, PRC1 and PRC2, and their mechanisms of action, including histone modifications and chromatin compaction. The document also examines a case study on the interaction between the PcG protein LHP1 and deubiquitinating enzymes UBP12 and UBP13 in Arabidopsis thaliana. The study found that UBP12 and UBP13 interact with and help recruit LHP1 to target genes, and are involved in histone deubiquitination, which impacts gene silencing by PcG proteins.
The document summarizes research on the Monascus genome project and related genetic studies. Key points include:
1) The Monascus genome was sequenced to 8x coverage, revealing various genomic features. A Monacolin K biosynthesis gene cluster was identified containing genes for polyketide synthases and other enzymes.
2) An efficient method for genetic transformation of Monascus pilosus was developed using aurintricarboxylic acid.
3) Disruption of the mokA gene and overexpression of the mokH transcription factor gene resulted in loss of and increased Monacolin K production, respectively.
P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is req...David W. Salzman
P68 RNA helicase was identified as being required for unwinding the human let-7 microRNA precursor duplex. Recombinant P68 RNA helicase was shown to unwind the let-7 duplex in vitro. Knockdown of P68 inhibited let-7 microRNA function, indicating P68 is essential for loading let-7 into the silencing complex. This study identifies P68 RNA helicase as playing a key role in the human let-7 microRNA pathway.
By constructing a plasmid containing flanking sequences of the adenylate cyclase gene and a tryptophan marker gene, researchers aim to knockout the adenylate cyclase gene in Schizophyllum commune via homologous recombination. The plasmid would replace the adenylate cyclase sequence with the tryptophan gene in the genome, allowing only cells without adenylate cyclase to grow in media lacking tryptophan. Using a ku80 knockout strain of S. commune increases the likelihood of homologous recombination during transformation. Primers and restriction enzymes were used to amplify flanking sequences and insert them into a vector plasmid to ultimately construct the adenylate cyclase knockout plasmid.
This document discusses the purification of regucalcin (RGN), a calcium-binding protein, from seminal vesicular fluid. It introduces RGN and its functions in maintaining calcium homeostasis and roles in apoptosis and antioxidant activity. The authors describe using PCR, Western blot, and SDS-PAGE techniques to demonstrate that RGN is present in seminal fluid and confirm its identity using mass spectrometry. Their results show RGN can be purified from seminal fluid using an immunoaffinity method and identify its molecular weight. The conclusion states RGN's important roles and potential applications for developing cancer treatments.
Gene Editing: An Essential Tool For Plant BreedingNoreen Fatima
Gene editing is a type of genetic engineering that modifies an organism's DNA by deleting, inserting or replacing parts of the genome. The document discusses several molecular "scissors" or nucleases that can make targeted cuts in DNA, including meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR-Cas9 system. These nucleases are used to induce double-strand breaks that are then repaired through natural cellular mechanisms, allowing for targeted changes to the genome. The techniques have been applied successfully in several crop plants to develop traits like herbicide resistance and disease resistance.
The document summarizes genetic and mutational characterization of the relV gene of Vibrio cholerae, which encodes a small alarmone synthetase protein called RelV. Key findings include:
1) Site-directed mutagenesis identified five amino acid residues (K107, D129, R132, L150, E188) in the RelA-SpoT domain of RelV that are essential for its (p)ppGpp synthetase activity.
2) Progressive deletion analysis determined the functional N-terminal boundary of RelV to be amino acid 59 and the C-terminal boundary to be amino acid 248, indicating that flanking sequences of the RelA-SpoT
This document summarizes a study that compared the DNA binding properties of two Myb transcription factor homologues (Pt Myb 126 and Pt Myb 413) from loblolly pine. The study found that while the two Myb proteins bound to identical DNA sequences, they had different relative affinities for these sequences. It also found that the two Mybs putatively targeted overlapping but distinct sets of genes when searching a eukaryotic promoter database based on their consensus binding sites. The results suggest these Myb proteins evolved different functions in part by evolving the ability to target the same DNA sequences with different relative affinities.
Genome editing technologies allow genetic material to be added, removed or altered at specific locations in an organism's genome. Several approaches exist, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR/Cas9, and base editors. These tools create precise breaks in DNA that can be repaired through non-homologous end joining or homology-directed repair. They enable trait discovery and crop improvement by generating plants with high yield, stress resistance, or other desired properties. While powerful, challenges remain in fully editing complex genomes and reducing off-target mutations.
This document summarizes an RNA project focused on inhibition of Dipeptidyl peptidase-IV (DPP-IV), a treatment for Type 2 Diabetes. Key components included:
1) An Internal Ribosome Entry Site (IRES) to allow translation of multiple protein coding regions. Two IRES sequences from EMCV and NKRF were characterized.
2) A neomycin gene to confer antibiotic resistance for selection.
3) An aptazyme as an RNA "kill switch" activated by theophylline.
4) siRNA targeting the 3' untranslated region of DPP-IV mRNA for cleavage.
5) An RNA-dependent RNA polymerase (
The document summarizes a student laboratory experiment attempting to genetically transform E. coli bacterial cells with a GFP plasmid (pGLO) using heat shock. The expected results were that bacterial cells transformed with the plasmid would grow on ampicillin-containing media and glow under black light. However, the actual results found that all bacterial cells died on ampicillin-containing plates, contradicting expectations. Possible sources of error that could have caused transformation failure are discussed.
Recombinant protein expression and purification Lecturetest
The document discusses recombinant protein expression and engineering. It describes:
1) Cloning or synthesizing the gene of interest, making an expression construct, transfecting cells, purifying the recombinant protein.
2) Factors to consider like the protein's origin (prokaryotic/eukaryotic), required post-translational modifications, and available expression systems.
3) A case study expressing recombinant human alpha-1-acid glycoprotein in E. coli, including vector construction, periplasmic extraction, affinity purification, and yield.
CRISPR- Trap: a clean approach for the generation of gene knockouts and gene replacements in human cells.- a paper is taken for lab presentation. A very good technique having advantages over conventional KO approaches and allow for the generation of clean CRISPR/ Cas9- based KOs.
The study aimed to test the specificity of two antibodies (033 and 1-9E10) for binding the c-myc protein. Human colon carcinoma cells were extracted to obtain cytosolic, nuclear, and nuclear pellet extracts. The 033 antibody bound c-myc in the cytosolic extract at approximately 110 kDa, but the 9E10 antibody did not bind c-myc. This suggests c-myc is not restricted to the nucleus and more research is needed to fully understand c-myc and its role in cancer.
Western Blotting Of Camkii Β And T 287Beth Salazar
1. Tomato production is affected by various bacterial, fungal and viral diseases which can cause considerable yield losses.
2. One of the most devastating diseases is tomato leaf curl disease (ToLCD), caused by geminiviruses, which is increasing worldwide and poses a major constraint to tomato production in India.
3. ToLCD causes serious yield losses according to studies from the 1940s and more recently. Effective management strategies are needed to control this and other diseases threatening tomato production.
This document provides the timetable and protocols for a practical course on making and analyzing tRNA synthetases in vivo and using cell-free protein synthesis. Over two weeks, students will perform site-directed mutagenesis to produce mutant aminoacyl-tRNA synthetases, express their proteins in E. coli cells and purify the proteins, and use cell-free synthesis to attempt incorporating a phosphotyrosine analogue into a target protein using their mutant synthetases and suppressor tRNA. The document outlines the experimental steps, including mutagenesis, transformation, plasmid preparation, sequencing, protein expression and purification, cell-free reaction set up, and analysis by SDS-PAGE. Safety procedures are also described to handle
This document discusses gene cloning and summarizes key steps in the process:
1. DNA is extracted from a sample and cut into fragments using restriction enzymes.
2. Bacterial plasmids are also cut with the same restriction enzymes.
3. DNA fragments are inserted into the plasmids through recombination, creating recombinant plasmids.
4. The recombinant plasmids are introduced into bacteria through transformation. Transformed bacteria are selected by their ability to grow in antibiotic-containing media, as the plasmids contain antibiotic resistance genes.
This is an internship report on molecular biology techniques, which was performed at PERD center under the guidance of Dr. Anshu Srivastava. This pdf contains all the basic information which is a preliminary requisite to know while approaching the molecular biology experimentally.
Structural and biochemical studies of cold shock domain containing proteins.
This thesis examines cold shock domain containing proteins through three chapters:
[1] A novel DNA microarray approach is developed to determine the sequence specificity of single-stranded nucleic acid binding proteins. Using this method, the major cold shock protein CspB from Bacillus subtilis is shown to bind preferentially to pyrimidine-rich sequences, with a high affinity for the consensus sequence 5'-GTCTTTG/T-3'.
[2] Six cold shock proteins from Salmonella typhimurium (CspA, B, C, D, E, and H) are cloned, expressed, and purified.
This document provides an overview of DNA cloning including:
1. The basic steps in DNA cloning including isolation of vector and gene source DNA, insertion into the vector, and introduction into cells.
2. Uses of polymerase chain reaction and restriction enzymes in cloning.
3. Applications of cloning such as recombinant protein production, genetically modified organisms, DNA fingerprinting, and gene therapy.
Genetically engineered E. coli were designed to express enhanced green fluorescent protein (EGFP). The EGFP gene was PCR amplified from a plasmid and inserted into the expression vector pET-41a. This recombinant DNA was transformed into E. coli. While some colonies were observed, none exhibited green fluorescence under UV light. Errors in PCR amplification and potential issues with the recombinant DNA inserts suggest the hypothesis that E. coli transformants would express EGFP was not supported.
Following is my journal documentation during Master's in Biotechnology completed in 2015. I do understand many changes would've occurred in the curriculum since then, but the basics seldom change. Kindly absorb as per your need.
Genomic and cDNA libraries provide a collection of DNA fragments that can be screened to find genes of interest. To make a genomic library, genomic DNA is purified from cells, fragmented, and cloned into a vector such as lambda phage. A large number of clones are needed to represent the entire genome. cDNA libraries are made from mRNA which is isolated, reverse transcribed to cDNA, and cloned into a vector. Libraries are screened by hybridization, expression analysis or other methods to identify clones containing genes of interest. Repeated screening allows chromosome walking to obtain overlapping genomic fragments.
2017 summer high school textbook (molecular biology and neuroscience)Masuma Sani
The document provides details about various techniques that will be covered in the Neuroscience Camp for High School Students. The camp will include hands-on activities involving 1) DNA techniques like PCR and electrophoresis, 2) protein techniques like Western blotting, 3) electrophysiology to record ion channels, 4) techniques to deliver genes to the brain and examine brain tissue, and 5) behavioral tests to assess learning and memory. Students will gain experience with fundamental molecular and cellular neuroscience methods.
Adipose derived osteoblasts cells from fat tissuesvijisenbiotech
This study characterized and compared surface proteins of primary osteoblasts isolated from iliac crest bone and osteoblast-like cells differentiated from adipose-derived mesenchymal stem cells. Gene and protein expression analysis using RT-PCR and western blotting showed that both cell types expressed osteoblast markers like osteocalcin, alkaline phosphatase, and collagen type 1, though osteocalcin expression was lower in adipose-derived cells. The study also found expression of stem cell markers and nucleostemin in both osteoblasts and adipose-derived osteoblast-like cells.
This study examined the interaction between the Abl kinase domain and the cancer drug Gleevec (imatinib) using site-directed mutagenesis to introduce a mutation (S417Y) associated with drug resistance. Researchers used PCR, protein purification techniques, and kinase assays to compare the inhibitory effect of Gleevec on wild-type Abl and the S417Y mutant. Their results supported the hypothesis that the S417Y mutation decreases Gleevec's ability to inhibit Abl kinase activity, though protein impurities limited the strength of the conclusions. The findings help explain why some cancers become resistant to Gleevec treatment.
This document discusses materials and methods used in a study involving the chemical fipronil and zinc. Twenty male albino rats were divided into four groups of five rats each: a control group, a zinc group that received zinc supplementation, a fipronil group exposed to the insecticide fipronil, and a combination group exposed to both zinc and fipronil. Biochemical assays were conducted to assess oxidative stress markers like superoxide dismutase, catalase, glutathione peroxidase, glutathione-S-transferase, glutathione, lipid peroxidation, and total protein in the rats. Chemicals used including fipronil and zinc sulfate were obtained from reputable suppliers. Kits for the biochemical assays were purchased from a diagnostic
The document discusses developing a DNA vaccine for fish using chitosan nanoparticles to deliver plasmid DNA encoding the OMP38 gene of Vibrio anguillarum. Key points:
- Chitosan nanoparticles were developed to deliver the pVAOMP38 plasmid and protect it from nuclease degradation. Studies showed the nanoparticles maintained plasmid integrity.
- The pVAOMP38 plasmid was transfected into seabass kidney cells in vitro and shown to express.
- Fish were vaccinated by feeding with chitosan-pVAOMP38 nanoparticles, chitosan-empty vector, or chitosan alone. The fish were later challenged with V. anguillarum to evaluate vaccine efficiency.
Nuclear Transport And Its Effect On Breast Cancer Tumor CellsStephanie Clark
The document discusses nuclear transport and its role in breast cancer tumor cells. It explains that nuclear transport involves the movement of large molecules in and out of the cell nucleus through nuclear pore complexes. It notes that various nuclear transport pathways play an important role in the progression and suppression of breast cancer tumor cells. Disrupting nuclear transport sequences can alter protein localization and functionality, as seen with spleen tyrosine kinase, which is a candidate tumor suppressor for breast cancer.
Recombinant antibody mediated delivery of organelle-specific DNA pH sensors a...saheli halder
This document describes the development of a new family of DNA pH sensors that can be targeted to specific intracellular locations using recombinant antibodies. The sensors incorporate a "handle" domain that binds recombinant antibodies identified through a phage display screen. One such antibody is fused to the membrane protein furin, allowing the sensors to be ferried along the furin endocytic pathway inside living cells. By changing the sequence of the pH sensitive domain, sensors were created that span pH ranges from 4 to 7.6. When targeted to cells expressing the antibody-furin chimera, the sensors map the spatiotemporal pH changes within intracellular compartments during furin trafficking. This targeting technique provides a generalizable strategy for delivering DNA nanode
Genetic Dna And Bioinformatics ( Accession No. Xp EssayJessica Deakin
This document discusses natural language processing (NLP) for Sanskrit and different part-of-speech (POS) tagging methods. It introduces NLP and POS tagging, noting that POS tagging is the first step in developing NLP applications. It then discusses different tagsets and POS tagging approaches for Sanskrit like hidden Markov models and conditional random fields.
This study analyzed the salicylic acid methyltransferase (SAMT) protein in Asclepias curassavica milkweed. The researcher extracted RNA from A. curassavica leaf tissue, amplified the SAMT gene, cloned it into a vector plasmid, and performed assays. Analysis of the SAMT amino acid sequence showed motifs predicting preference for salicylic acid over benzoic acid. Enzyme assays using GC-MS confirmed SAMT preferentially methylated salicylic acid. Statistical analysis supported the hypothesis that SAMT amino acid sequence correlates with substrate preference.
1. John Donlan Provost Grant Proposal
1
Developing a Beta-Clamp Loading Assay
Purpose/Outcomes:
DNA replication is an essential function in all domains of life. DNA polymerase processivity
factors, including sliding clamps and clamp loaders, play key roles in this function. Escherichia
coli (E. coli) has a β-clamp protein that is loaded onto DNA by a clamp loader protein complex
(ɣ-complex) comprising three ɣ, one δ, and one δ’ subunits. The ɣ-complex opens the closed-
ring β-clamp and loads it onto DNA using the energy of ATP (Park et al 2009). The β-clamp
encircles DNA and helps control traffic on DNA during DNA replication and repair. The β-
clamp is also a processivity factor, helping increase the efficiency of DNA replication and
ensuring all genomic DNA can be copied within each cell cycle.
The primary goal of this project is to develop an assay to determine the efficiency of E. coli ɣ-
complex loading E. coli β-clamp onto DNA. This will be accomplished by varying the ratio of β-
clamp to ɣ-clamp loader and time of reaction. The expected outcome of this study is the
successful development of an assay to determine efficiency of the ɣ-complex loading β-clamp
onto DNA under these different conditions to allow us to use loaded β-clamp in future
biophysical studies.
Significance/Originality:
Because errors in the crucial function of DNA replication could lead to cancers and other
diseases, understanding the β-clamp-clamp loader complex interactions and their role in DNA
replication is the focus of many studies. One challenge that such studies encounter is determining
the optimal ratio of ɣ-clamp loader to β-clamp and time of reaction to produce as much DNA
with β-clamp loaded onto it as possible. The conditions I determine to be optimal will then
enable many future experiments. This would conserve time and resources for such studies that
strive to further elucidate the structure and/or role of the β-clamp-clamp loader complex.
Because the E. coli β-clamp is similar to the human proliferating cell nuclear antigen (PCNA)
sliding clamp, understanding the β-clamp-clamp loader complex in E. coli may also further our
understanding of the clamp-clamp loader complex in humans (Paschall et al. 2011).
Methods/Research Design:
Transformation and Protein Expression
We already have in hand the DNA constructs, pET3c vector encoding the sequence for δ protein,
pET3c vector encoding the sequence for δ’ protein, pET28a-pp vector encoding the sequence for
ɣ, and pET11t encoding the β-clamp. E. coli BL21(DE3)pLysS competent cells will be
transformed with all three ɣ-complex subunits whereas the BL21(DE3) cells will be transformed
with β. Each transformation will be plated onto Luria Broth (LB) plates containing the
appropriate antibiotic. Plates will be grown in a 37°C incubator overnight. A colony from each
2. John Donlan Provost Grant Proposal
2
plate will be selected and used to inoculate 50 mL of LB medium containing the appropriate
antibiotic and then grown overnight at 37°C. Protein expression will be induced by adding
Isopropyl β-D-1-thiogalactopyranoside (IPTG) to 1 mM final concentration either overnight at
18°C (ɣ-subunit) or for 4 hours at 30°C. Cell culture will be spun down and pellets will be stored
at -80°C and subsequently used for purification. Protein expression levels will be determined via
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
Protein Purification
Frozen cells will be thawed overnight on ice at 4°C. Lysis buffer containing lysozyme and
DNaseI will be added. After pellets are thoroughly resuspended, cells will be sonicated for 4
minutes, in 15 second on/off intervals. Cell debris will be pelleted by centrifugation. The lysate
will be filtered and loaded onto to the appropriate column for each protein. The δ lysate will be
loaded onto a HiTrap SP sepharose FF column then eluted using a gradient from 0 to 500 mM
NaCl. Fractions containing protein of interest will be pooled and stored at -80°C. The δ’ lysate
will be loaded onto a HiTrap Heparin HP column and eluted with 0 to 500 mM NaCl gradient.
Fractions containing protein of interest will then be pooled and loaded onto a HiTrap Q
sepharose FF column. Fractions containing the protein of interest will be then pooled and frozen
at -80°C. The ɣ lysate will be loaded onto a HisTrap FF column with 20 mM imidazole and
eluted using a linear gradient of 0 to 250 mM imidazole. Once all three subunits are purified, the
ɣ-complex will be assembled by mixing δ: δ’: ɣ in a 1:1:2 ratio and dialyzed overnight at 4°C.
The protein mixture will then be loaded onto a HiTrap Q sepharose FF column eluted using a 0
to 500 mM NaCl gradient. Fractions containing the ɣ-complex will be then pooled and frozen at
-80°C.
The β lysate will be loaded onto a DEAE column and eluted using a 0 to 1 M NaCl. Fractions
containing the protein of interest will be pooled and then loaded onto a HiTrap Phenyl high-
substitution FF column containing 1 M ammonium sulfate and eluted with a linear gradient to 0
mM ammonium sulfate. The fractions containing protein of interest will be concentrated using
VivaSpin 20, 10 MWCO, down to 2 mL and loaded onto a Superdex 75 SEC column. Fractions
containing the purified β-clamp will be then pooled and frozen at -80°C.
Determining Protein Concentration
The purified protein concentration will be determined using the Bio-Rad protein assay. A
standard curve will be created using known concentrations of bovine serum albumin (BSA) in 1x
Bradford reagent. The absorbance of the Coomassie Brilliant Blue G-250 dye binding to the
protein will be measured at 595 nm. The unknown protein concentration will be determined
using the standard curve.
3. John Donlan Provost Grant Proposal
3
β-Clamp Assay Development
Dynabeads M-280 Streptavidin beads will be used for tethering biotinylated oligonucleotides and
subsequently loading β-clamp protein onto the DNA bound to the streptavidin beads. The
magnetic Dynabeads are ideal for binding the biotinylated oligonucleotides as they require only a
magnet and short incubation period to separate DNA bound from unbound fractions. We will
have the two DNA oligonucleotide sequences shown below in Figure 1 synthesized by a
commercial service. The oligonucleotides will have sequence homology so that they will anneal
to each other resulting in a 5’ single-stranded (ss) DNA overhang onto which end the β-clamp
will be loaded. Each 5’ end of the oligonucleotide will be biotinylated which will bind to the
streptavidin-coated beads.
Figure 1. Biotinylated DNA Sequence.
The quantity of beads required to bind the DNA will be experimentally determined by adding
various amounts of DNA and quantifying the amount of DNA bound to beads. The streptavidin
beads will first be washed with Binding/Wash buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 1
M NaCl) to remove the storage buffer in which the beads are stored. Single-stranded biotinylated
DNA will be annealed using a thermal cycler by setting the temperature for 2 min at 95°C, 30
min at 50°C, and slowly cooling to room temperature to allow sufficient time for the DNA to
come together. We will run ss and double-stranded (ds) DNA on a polyacrylamide gel to verify
that sufficient annealing has occurred. Biotinylated dsDNA will be added to the washed
streptavidin beads. The time of incubation will be experimentally determined to ensure enough
DNA binds to the beads. Unbound DNA will be washed away with the Binding/Wash buffer.
Beads will then be resuspended in β-loading buffer (150 mM Hepes pH 7.5, 100 mM NaCl, 37.5
mM MgSO4, 10 mM βME) and β-clamp, ATP, and ɣ-complex will be added (Figure 2). The
optimal ratio of β-clamp, ATP, and ɣ-complex will be experimentally determined to ensure that
sufficient β-clamp is loaded onto the DNA. The time of incubation will also be optimized.
Samples will be analyzed by SDS-PAGE gel to verify the amount of β-clamp loaded and the
amount of time the β-clamp remains loaded.
Figure 2. ɣ-complex loading β-clamp onto DNA.
5’ - AGTTCTTCTGCAATAACTGGCCGTCGTTTGAAGATTTCG - 3’
3’ - CGTTATTGACCGGCAGCAAACTTCTAAAGCTTACAACTGACGCTTTTGGGACCGCAATGTCTTACC – 5’
Biotin Biotin
β-Clamp
γ- complex
ATP
Streptavidin
Bead
Streptavidin
Bead
Streptavidin
Bead
Streptavidin
Bead
Biotin Biotin BiotinBiotin
4. John Donlan Provost Grant Proposal
4
Challenges
We anticipate challenges to come up in every step of the development of the β-loading assay and
have plans to address them. Efficient annealing of the single-stranded oligonucleotides needs to
be achieved and the biotinylated-annealed oligos will need to be in the proper orientation in
order to bind to the magnetic streptavidin beads (see Figure 1). We will ensure that the double
stranded DNA is bound to the beads by analyzing the beads on a polyacrylamide gel. Optimizing
the ratio of ɣ-clamp loader proteins to the β-clamp dimer and ATP poses the biggest challenge as
the clamp loader when used in high concentration also serves as a clamp unloader. We plan to
use a range of concentrations of clamp loader and monitor many time points in order to optimize
the amount of clamp loader that allows sufficient loading without observing clamp unloading.
We will wash the beads gently to remove unbound proteins without removing bound proteins.
Determining the optimal time for the ɣ-complex to load the β-clamp onto the DNA is another
likely challenge and will be addressed by the time-course experiments. The β-clamp will need to
be loaded onto DNA and stay loaded for a sufficient amount of time in order to study its function
further.
Time Table
Action Time Needed
DNA Transformation/Protein expression and purification 1 week
Protein expression and purification 5-7 weeks
Optimizing ratio of proteins and time of reaction 7 weeks
Total 13-15 weeks
Dissemination:
Ongoing and final results of the study will be discussed during the weekly Beuning Laboratory
group meetings. We aim to present our findings at Northeastern University’s Honors Research
Showcase Event, RISE exposition in Spring 2016, and the American Chemical Society Chapter
at Northeastern.
Evaluation:
To analyze the results of the study, data will be discussed during the Beuning laboratory weekly
group meetings. Future experimentation will be planned based on conclusions made from the
results. Troubleshooting experiments will be designed accordingly. The assay will be redesigned
if an insufficient amount of β-clamp is loaded onto DNA.
5. John Donlan Provost Grant Proposal
5
Faculty Mentorship
This study will be conducted primarily under the mentorship of graduate student Bilyana Koleva
as well as the mentorship of principal investigator Dr. Penny Beuning.
References
Fang, Jing, Engen, John R., and Beuning, Penny J. "Escherichia coli Processivity Clamp β from
DNA Polymerase III Is Dynamic in Solution." Biochemistry 50.26 (2011): 5958-968.
Park, Mee Sook. and O’Donnell, Mike. “The Clamp Loader Assembles the β Clamp onto 3’ or 5’
Primer Terminus.” The Journal of Biological Chemistry 284.45 (2009): 31473-31483.
Paschall, Christopher O., Thompson, Jennifer A., Marzahn, Melissa R., Chiraniya, Ankita.,
Hayner, Jaclyn N., O’Donnell, Mike., Robbina, Arthur H., McKenna, Robert., and Bloom, Linda
B. “The Escherichia coli Clamp Loader Can Actively Pry Open the β-Sliding Clamp.” The
Journal of Biological Chemistry 286.49 (2011): 42704-42714.