SlideShare a Scribd company logo
Nuclear Transport And Its Effect On Breast Cancer Tumor Cells
Nuclear transport is the method by which large molecules enter and exit the cell nucleus through nuclear pore
complexes. Small molecules however do not require much regulation. This method of transport and translocation
provides an understanding of various protein movement between the cytoplasm and nucleoplasm of the cell. The
hundreds of nuclear transport pathways allow for the study and mechanistic view of nuclear transport's role in the
onset as well as expression of multiple diseases; breast cancer being one in particular. Various nuclear transport
pathways play an important role in the progression and suppression of breast cancer tumor cells. Proteins and
enzymes that propagate these pathways can lead to cell proliferation or inhibition of the invasive and metastatic
behavior of breast cancer advancement. A further look at these pathways will aid in the understanding of breast
cancer tumor cells. Nuclear localization sequences or NLS, is a necessary component of nuclear transport. It is an
amino acid sequence that will "tag" a protein for import. By disrupting this sequence, the way a protein is
imported is altered and can lead to numerous defects. Where it may localize can change the functionality of the
protein. This can be seen in the case of spleen tyrosine kinase, Syk. Spleen tyrosine kinase is "a candidate tumor
(metastasis) suppressor that is highly expressed in mammary epithelial cells" (Wang). Lei Wang and associates
looked at two different variants of Syk;
... Get more on HelpWriting.net ...
Binary Chromatography Lab Report
Afterward, PTEN purified using affinity chromatography. Since PTEN fused with His6 tag, Ni–NTA affinity
chromatography would work to purify PTEN. Ni–NTA is a type of immobilized metal affinity chromatography
that contain coupled Ni2+ nickel chelate forming ligand (imiondiacetic acid) that immobilized to agarose. The
science behind using Ni–NTA affinity chromatography is that histidine bind specifically and reversibly to the
nickel chalet thus washing step will remove other contaminate and then His–PTEN eluted using imidazole.
Bradford assay and SDS–PAGE performed to quantify and analyze the progress toward PTEN purification. The
calculated concentration of the samples presented in table 8. The Concentration of samples make since having the
... Show more content on Helpwriting.net ...
A scientist need to demonstrate mammalian cell transfection under very sterile technique since they grow slowly
and affected by contamination resulting in lower expression. In addition, the total number of mammalian cell
should maintain steady and once there is confluent, cells have no more room to grow, mammalian cell culture
should split using digestive enzyme and placed into new fresh media. To do so, hemocytometer used to count
mammalian cell and demonstrate the cell concentration. Table 11 shows the calculation of mammalian cell
concentration and for transfecting 1000,000 cell we need 1.17 ml. Following mammalian transfection,
immunoprecipitation processed for FLAG–PTEN gained from mammalian cells. Anti–FLAG antibody used as
ligand just as affinity chromatography to purify FLAG–PTEN. Latter on, western blotting carried out by
transferring the protein from the completed SDS–PAGE to PVDF membrane as the order in figure 5. After that,
incubation with primary and secondary antibody to visualize PTEN through the chemiliuminescence reaction as
shown in figure 7. The figure present FLAG–PTEN in three samples the FLAG–PTEN IP, supernatant FLAG–
PTEN after IP, and lysate FLAG–PTEN before IP. Lysate FLAG–PTEN before IP and FLAG–PTEN IP spouse to
contain PTEN and that confirm the success of mammalian transfection. However, the FLAG–PTEN IP showed a
smeared band. That may due to high protein concentration load
... Get more on HelpWriting.net ...
Expressed Sequence Tags (ESTs) versus Serial Analysis of...
Expressed Sequence Tags (ESTs) versus Serial Analysis of Gene Expression (SAGE)
INTRODUCTION Expressed sequence tag or also known as EST are 200 to 800 unedited nucleotide bases in
length, and randomly selected single pass sequence reads which are derived from the cDNA libraries while serial
analysis of gene expression or SAGE have more shorter sequence tags with only 10 to 20 base pairs. But even it
is short it still have enough information to uniquely identify a transcript, especially if it is obtained from a unique
position in each of the transcripts. Serial analysis of gene expression is a method or technique designed to gain a
direct and quantitative measure of overall gene expression pattern. It is basically a sequence based ... Show more
content on Helpwriting.net ...
ETS also can determine definitively the number of copies of each transcript per cell and highlight any differential
gene expression. EST includes an inefficient sequencing step, in which one sequencing process yields only one
cDNA sequence. Although the more recent methods of hybridization based analyses (DNA microarray) using
immobilized cDNAs (Schena et al., 1995) or oligonucleotides (Lockhart et al., 1996) can potentially examine the
expression patterns of a relatively large number of genes, the method can only examine expressed sequences that
have already been identified. In contrast, the SAGE method allows for a quantitative and simultaneous analysis
of a large number of transcripts in any particular cells or tissues, without prior knowledge of the genes
(Velculescu et al., 1995).
METHODOLOGY The SAGE method is based on the isolation of unique sequence tags from individual mRNAs
and concatenation of tags serially into long DNA molecules for lump sum sequencing. It can be applied to the
studies exploring virtually any kinds of biological phenomena in which the changes in cellular transcription are
responsible. SAGE is based mainly on three principles, firstly, a short sequence tags, 10 to 15 base pairs contains
sufficient information to uniquely identify a transcript provided that the tag is obtained from a unique position
within each transcript to allow the efficient sequencing analysis. Secondly
... Get more on HelpWriting.net ...
Optogenetic Manipulation In Transgenic Rats
To effectively integrate the applications of optogenetics in a living organism, there needs to be previous genetic
manipulation to enable the rat to be receptive to optogenetic technologies. The genetic manipulation involves
creating transgenic rats. Transgenic manipulation involves the movement or insertion of a gene in an organism
that does not normally possess the gene. The gene of interest is the gene for halorhodopsin, and to produce rats
that possess this gene requires injecting a DNA construct into a fresh embryo. A DNA construct is an artificially
constructed segment of nucleic acid that is transplanted in the cell. The DNA construct is usually constructed as a
plasmid. The construct must contain a DNA insert, which has the gene sequence ... Show more content on
Helpwriting.net ...
The primary antibody is the antibody that will bind to the protein of interest. This is generated by exposing the
halorhodopsin protein to a rat so that an immune response of antibodies can be generated and these antibodies are
harvested from the rat. This antibody will bind to the protein of interest during incubation. The detection,
however, is done with the use of a secondary antibody generated from another animal. When unbound primary
antibodies are removed from the blotting sheet, the secondary antibody can be used to detect bound primary
antibodies. The secondary antibody will be modified with a fluoresce tag that lights up when the secondary
antibody binds with the bonded primary antibody. If there is a detectable fluoresce signal, then there is the
halorhodopsin protein present in the blot. The amount of fluoresce indicates how much of the halorhodopsin gene
is being generated. With the confirmation that HaloX gene was properly inserted into the genome, pain testing
with optogenetics can
... Get more on HelpWriting.net ...
Rationale & Hypotheses. Past Studies Have Shown That Podxl
RATIONALE & HYPOTHESES
Past studies have shown that Podxl overexpression identifies a highly aggressive subset of breast carcinomas.
Moreover, our previous results show an important role of Podxl on in vivo primary tumor growth and metastasis
of MDA–MB–231 cells. However, the mechanism of action by which Podxl plays a role in tumor progression it
still unclear. I hypothesize that the structure and biochemical and signalling properties of podocalyxin promote
breast cancer tumor progression and, therefore, podocalyxin may be a novel target for future therapeutics.
OBJECTIVES & AIMS
Objective #1: Identify the Podxl functional domains required for cancer metastasis.
Aim 1.1: Generation of human Podxl mutants
Aim 1.2: Identify critical ... Show more content on Helpwriting.net ...
We have selected different hPodxl mutants to generate (Figure 5). 1) PodxlDTHL: Podxl mutant lacking the C–
terminal PDZ docking site, the docking site for NHERF1/2. This mutant will allow us to determine whether or
not the ability to bind NHERF1/2 is critical for tumor progression. 2) PodxlTail, lacking all but three aminoacids
of the cytoplasmic tail and, therefore, eliminating all intracellular binding (ezrin, NHERF1/2 and other potential
unknown ligands). 3) PodxlEC missing the whole extracellular domain, allowing us to account for the lack of the
highly negatively charged glycosylated portion as well as the stalk domain.
We previously demonstrated that a high–affinity monoclonal antibody (mAb) targeting Podxl (PODOC1) could
be used to block tumor growth and metastasis in a pre–clinical tumor model in mice(28). Administration of
PODOC1 mAb to tumor–bearing mice inhibited primary tumor growth and attenuated distant metastases to the
lung(28). The PODOC1 epitope is the stalk domain of Podxl's extracellular portion (a core protein domain).
Because other very similar anti–podocalyxin mAbs that we generated to Podxl's extracellular core protein
domains had no therapeutic effect, we post that this critical domain (the PODOC1 epitope) serves a functional
role in Podxl mode of action in metastasis. Since PODOC1's epitope appears to have a significant role in
tumorigenesis, we will generate an additional hPodxl mutant (ECGlyco) lacking only the
... Get more on HelpWriting.net ...
Epigenetic Research Paper
Epigenetics and the factors that relate to Organisms Diversity The development and importance of epigenetics
has revealed to the world the explanation of many gene expressing mutations also factors that may account for
genetic variation. The result of this observation helped many scientists around the world cures as well as new
analysis methods to help survivors .The understanding obtained from the discovery of epigenetics has and will
continue to inform ways of preventing and manipulating genetic expressions to our advantage throughout these
upcoming generations. Throughout this essay response, the following information will cover the focus on how
epigenetics can account for genetic variability in organisms, it will also relate to factors ... Show more content on
Helpwriting.net ...
Epigenetic factors are compounds that attach to, or "mark" DNA. These factors interact with genetic material, but
do not change the underlying DNA sequence. Instead, they act as chemical tags, indicating what, where, and
when genes should be "turned on" or expressed. Some epigenetic factors come from natural sources or are even
encoded in the DNA, and are a normal part of gene regulation. That is, the epigenome helps control which genes
are active in a particular cell, and therefore, which proteins are transcribed locally. For example, epigenetic
factors tell brain cells to act like brain cells, and skin cells to behave like skin cells. In the absence of a normal
epigenome, disease can occur. These factors are also increasingly implicated in social and behavioral traits.
FActor four: A frameshift mutation also called a framing error or a reading frameshift is a genetic mutation
caused by insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three.
Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame the
grouping of the codons, resulting in a completely different translation from the original. The earlier in the
sequence the deletion or insertion occurs, the more altered the
... Get more on HelpWriting.net ...
Recurrent Incidence Of Babesiosis Among Adults Essay
Recurrent incidence of babesiosis among apparently healthy bovines in Egypt, submits the needs for suitably
destined prevalence studies with rapid and accurate diagnosis and immediate treatment of infected animals are
required to control this disease. The routine epidemiological survey and diagnosis usually based upon
microscopical examination of Giemsa stained blood smears. This technique is insufficient for accurate detection
and identification of Babesia species during mixed infections and not reliable for detecting the infection in carrier
cases or subclinical infections with low parasitemia. Combination of molecular and serological diagnostic tools
for the infection provides powerful tools for accurate diagnosis as well as for epidemiological investigations as
means of overcoming limitations of microscopical examination. The polymerase chain reaction will be conducted
using highly conserved and species specific genes for detecting the parasite DNA in the blood of infected animals
based on the B. bigemina rhoptry associated proteins, Apical membrane protein 1 & Internal trancribed spacer
and B. bovis Spherical body proteins 4. The serological diagnostic tools, including the indirect fluorescent
antibody test, the Indirect enzyme–linked immunosorbent assay, a competitive ELISA will be conducted to detect
Babesia antibodies in serum of naturally infected cattle based on Babesia lysate, Cyanogen bromide–activated
Sepharose 4B, affinity purified antigen and expressed,
... Get more on HelpWriting.net ...
Greek Language Essay
A survey on various platforms for Sanskrit and Part–Of–Speech Tagging Methods
Sulabh Bhatt, Parmar Krunal
Department Of Computer Science, Gujarat University
Ahmedabad, India sulabhbhatt@gmail.com parmar.krunal005@gmail.com
Abstract – In this paper we present a Natural language processing for Sanskrit using Different approaches.
Sanskrit is a oldest and considered as the mother of all languages. The Sanskrit, the world 's ancient language has
got a wealthy grammar. The Sanskrit grammar text Ashtadhyayi is written by Panini (an Indian Sage). Sanskrit is
a well suitable language for providing an advanced artificial intelligence for Computers. Part of Speech (POS)
Tagging is the first step in the development of any NLP Application. A POS Tagger (POST) is a piece of software
that reads text in some language and assigns parts of speech to each word (and other token), such as noun, verb,
adjective, etc.
Keywords – NLP for Sanskrit, Tagset, POS Tagging, HMM, CRF
I. INTRODUCTION
Natural language processing: Natural language is the embodiment of human cognition and human intelligence.
Natural language processing (NLP) is a cross disciplinary field in computer science and linguistics where a
computer can generate and understand human speech. It is the ability of a computer program to understand
human speech as it is spoken. NLP is a component of artificial intelligence (AI).The development of NLP
applications is challenging because computers traditionally require humans to "speak"
... Get more on HelpWriting.net ...
Honey Bees Eusociality
This study explored the connection between changes in genetics and eusocial evolution in honey bees. The
evolution of eusociality is when a single species lives in a cooperative group that depends on a single female and
several males who are reproductively active, with the nonbreeding individuals responsible for caring for the
young and providing food and protection to the whole colony. Bees were used in this experiment due to the fact
that eusociality was obtained in bees more times than any other group, making comparing numerous origins of
various social lifestyles of closely related species possible. The vast amount of information pertaining to the
natural history of bees also helped in the establishment of the idea of adaptive significance
... Get more on HelpWriting.net ...
Prader-Willi And Angelman Syndrome: Epigenetic Analysis
Prader–Willi and Angelman Syndrome are two key examples of genomic imprinting of epigenetics. Epigenetics
is the changes of an organism, which is changed by the gene expression, instead of the alteration of the genetic
code (Butler, 2011). Genomic imprinting is subtopic among an epigenetic phenomenon in which genes are
expressed based upon the parent who gives the gene. Although Prader–Willi and Angelman Syndrome are two
completely different genetic disorders, they both involve the same chromosome region but each disorder is
inherited by a different parent. It has been said that Prader–Willi and Angelman Syndrome are one of the first
examples of error in genomic imprinting in humans (Butler, 2011). In 1942 an embryologist Conrad Waddington
... Show more content on Helpwriting.net ...
The process of gametogenesis is where epigenetics is erased throughout each new generation supposedly.
However, in 2005, reports were made that epigenetics undergoes four subsequent generations (Weinhold 2006).
As for being able to reverse the genes given by the sperm and egg after they are already formed, is not possible.
The only way a disorder like Angelman or Prader–Willi could be reversed is through the next generations. This
explains how a mother can have two children and only one of them could end up with one of these disorders.
Although there isn't much to be done to try and reverse the effects of epigenetics once and individual has suffered
from it, researches want more technology advances to go into the process of identifying genomically imprinted
genes. More development of counting the number of protein in the cell to recognize better protein modification
(Weinhold 2006). All of the recognized and know genes that are imprinted are tallied in the Mammalian Genetics
research group. There is still a lot of room to grow and learn about epigenetics and all of the modified genes that
occur in human bodies. Graduate school students are advancing technology for this reason. More specifically,
technology for additional
... Get more on HelpWriting.net ...
Advantages And Disadvantages Of Prunus
Introduction
Prunus is a genus of trees and shrubs, which includes the plums, cherries, peaches, nectarines, apricots and
almonds. Around 430 species are spread throughout the northern temperate regions of the globe. Many members
of the genus are widely cultivated for fruit and ornament. The fruit from this genus are commonly called the
stone fruit (Browiz 1996; Browiz and Zohary 1996).
Microsatellites or simple sequence repeats (SSRs) are short, tandemly repeated DNA regions that are
ubiquitously present in the genomes of pro– and eukaryotes. Because of their abundance, multiallelic behavior,
high polymorphism, codominant inheritance and excellent reproducibility, PCR–amplified SSRs have become
the markers of choice for many applications, including genetic mapping and population genetics (Powell et al.
1996). Among the few disadvantages of SSR markers are the often tedious and costly cloning and enrichment
procedures required for their generation (Zane et al. 2002; Squirrell et al. 2003; Weising et al. 2005).
Since about a decade, computational methods have been applied ... Show more content on Helpwriting.net ...
The genomic SSRs were analyzing by GMATo, graphic and command line application. The program and manual
is freely available at http://sourceforge.net/p/GMATo (Table 1.). The minimum motif repeat size were set to 8 for
mononucleotide, 5 for dinucleotide, 3 for trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide
heptaanucleotide, octaanucleotide, nonaanucleotide and decanucleotide in locating the microsatellites with
maximum differences two SSRs was 100. SSRs were searched in full chloroplast genome as well as separate
coding and non–coding regions for each species. Also, GC content was
... Get more on HelpWriting.net ...
The Importance Of Micrornas
The microRNAs (miRNAs) are single–stranded small, endogenous, non–coding regulatory RNA with size
varying ~21 to 24 nucleotides. microRNA mediated gene regulation play an important role in the negative
regulation of gene at post–transcriptional level by targeting the mRNAs of protein coding genes by cleavage or
repressing protein translation in eukaryotes and viruses (Bartel, 2004). microRNAs are expressed from their own
genes located in the intergenic or intragenic region on the chromosomes (Lagos–Quintana et al., 2001). In plants,
most miRNA genes are intergenic and transcribed individually from their own region, but a few genes are
organized into polycistronic transcription units and co–transcribed from single promoter at the end of a ... Show
more content on Helpwriting.net ...
The functional genomics studies have shown the involvement of plant miRNAs in many developmental processes
of plant (Jones et al., 2006), response to biotic and biotic stresses, hormone signalling (Frazier et al., 2011,
Jagadeeswaran et al., 2009), signal transduction, protein degradation (Zhou et al., 2010; Zhang et al., 2008),
transgene suppression (Allen et al., 2005), disease development (Johnson et al., 2005), defense against viruses
(Bennasser et al., 2004), molecular mechanisms regulating developmental transitions, such as seed germination,
vegetative and reproductive phase changes, flowering initiation, seed production and root development (Yang et
al., 2011) and nutrient deprivation and heavy metals (Chen et al., 2012).
Many miRNAs have been identified and investigated extensively in plant species with sequenced genomes and
comparative genome analysis from expressed sequence tag (EST), genome survey sequences (GSS) and
nucleotide sequences. miRNAs are evolutionarily conserved in the plant kingdom from mosses and ferns to
angiosperms (Zhang et al., 2006b). Using this attribute, identification and prediction of miRNA by sequence
analysis has advantage over other methods. It has been suggested that miRNAs predicted by EST analysis can be
recovered by high throughput deep sequencing (Kwak et ai., 2009).
Pearl millet (Pennisetum glaucum L.) is a monocot, C4 annual grass belonging to the family Poaceae. It is
cultivated as staple food grain
... Get more on HelpWriting.net ...
What Is Epigenetics?
What is Epigenetics?
The word "epigenetic" means "in addition to changes in genetic sequence." The term has changed to include any
process that alters gene activity without changing the DNA sequence, and leads to modifications that can be
transmitted to daughter cells. The term epigenetics was first used in the early 1940s, when embryologist Conrad
Waddington used it to describe the interactions between genes and their products, which give rise to an
organism's observable characteristics or phenotype.
Epigenetics involves genetic control by factors other than an individual's DNA sequence. Certain circumstances
in life can cause genes to be silenced or expressed over time. They can be turned off, becoming dormant, or
turned on, becoming active. ... Show more content on Helpwriting.net ...
If we could map every single cause and effect of the different combinations, and if we could reverse the gene's
state to keep the good while eliminating the bad, then theoretically we could cure cancer, slow the aging process
and stop obesity. Epigenetic processes are natural and essential to many organism functions, but if they occur
improperly, there can be major adverse health and behavioural effects.
How does epigenetics work?
Epigenetic changes alter the physical structure of DNA. Chemical tags known as epigenetic marks sit atop genes,
either on the DNA itself or on the histone proteins around which DNA is wrapped. Changes in the mix of these
marks can alter a gene's behaviour, turning the gene off so that protein synthesis is inhibited, or turning it on, all
without changing the information the gene contains.
Epigenetic tags act as a kind of cellular memory. A cell's epigenetic profile, a collection of tags that tell genes
whether to be on or off, is the sum of the signals it has received during its lifetime. Some epigenetic marks inhibit
genes by inducing tight folding of chromatin, which is DNA mixed with histones and other proteins, and thus
keeping genes from being read. Methyl groups sometimes play that
... Get more on HelpWriting.net ...
Based on the Plant Biology Journal entitled “Gene...
Based on the Plant Biology Journal entitled "Gene discovery in the wood–forming tissues of poplar: Analysis of
5,692 expressed sequence tags", by Sterky et al., 1998, expressed sequence tags (EST) database was prepared
with specific procedure. First of all, EST can be defined as a short fragments sequence, range from 100 bp– 1000
bp. It derived from a c DNA clone which represents the expressed genes sequence. Usually, ESTs are used to
identify the full length genes and serves as a target for mapping with providing important evidence in the ORF
for confirmation as it is organised into libraries (Ganten et al., 2006). In order to improve the value of EST, few
steps of preparing EST database should be encounter with pre–processing, ... Show more content on
Helpwriting.net ...
The ESTs database was prepared by constructing cDNA libraries from the sample at first, which are from the
stem tissue of actively growing trees of P. tremula L.× tremuloides Michx. The cambial–region EST library was
prepared from developing xylem tissue, developing and mature phloem and cambial meristem tissue. The cDNA
library was prepared from λgt22a by using Superscript Lambda System for cDNA synthesis and cloning and
packaged into λ particles with the Gigapack II Gold. λ DNA was isolated form an aliquot of the cDNA library
representing 200,000 clones, and the cDNA inserts were isolated and ligated into pBluescript SK. Bacterial
clones of the cambial–region from cDNA library were randomly picked, suspended in 100 µl of Tris/EDTA
buffer, lysed and stored at –22 ºC until further analysis. Sample from Populus trichocarpa 'Trichobel' was
prepared for a developing–xylem library where cDNA was extracted from the mRNA to clone into λZAPII
vector. Meanwhile, the plasmid clones of individual phages were obtained by in vivo excision (Sterky et al.,
1998).
Next step involve DNA sequencing of the cambial–region cDNA inserts. It was performed using PCR products as
templates from the 59 end. Microtiter plates were loaded onto a robotic worktable. This worktable is the place
where the PCRs, quality control and sequencing reactions performed automatically. How do PCRs performed?
By using general vector primers and standard PCR controls
... Get more on HelpWriting.net ...
Analysis Of The Movie ' 12 Years ' A Slave '
In 12 Years A Slave (2013), directed by Steve McQueen, the audience is provided with an understanding of
characters, place and main character's experience through mise–en–scene and cinematography. 12 Years a Slave
surrounds a black man named Solomon Northup, who was sold into slavery in the 1850's. It is a graphic retelling
of a slave's existence in Louisiana. The specific sequence used for analysis is one where Northup attempts to
escape, but stumbles upon a lynching ritual. By use of cinematography and mise–en–scene, Steve McQueen
allows the audience to view slavery in its every day format, and learn that this part of history was simply a
reality.
Characters Experience. Through mise–en–scene and cinematography, McQueen provides us with ... Show more
content on Helpwriting.net ...
Northup's expression as he immediately comes across the party, compared to the expression as he walks away, is
key in understanding the thematic intention of the film. To start it is one of shock and fear, an immediate reaction
to the ritual he fell upon. After the quick understanding of what is occurring, he makes eye contact with the men
in the nooses. Their expressions are pained, there is no hope left, they are now only bodies primed for hanging.
Solomon walks away from the bodies of the hanged slaves, his expression gradually changing from shock to
acceptance. An understanding that this is common practice. The lighting develops this idea, as in this sequence it
is entirely natural, and sun is beaming down on all characters. This suggests to the audience that this act of
violence is not hidden, it isn't executed in the dark when there is lesser chance of being seen. it is a reality.
Compare this with the scene of Solomon's own attempted lynching. While he is strung up by a noose struggling
to survive, the slave children begin to play in the background. They are fully aware that he is there, however this
form of violence is part of their life, it is not shocking. Through this we are made aware of the theme in the film–
slavery, and the violence accompanied with it, was not shameful nor kept secret. Black people in this
environment lived a life constantly plagued by the threat of a hanging noose.
Character. The dynamics between characters are
... Get more on HelpWriting.net ...
Epigenetics: A Comparative Analysis Of Cell Structure And...
All cells in the body contain the same DNA sequence. Although all cells contain an identical DNA sequence, they
all have different cell structures and functions. Each structure and function of the cell differs because the cell has
specific use for or will only express certain genes. Genes in DNA are expressed when they are read and
transcribed into RNA which then gets translated into proteins by ribosome structures. Proteins are used to
determine a cells characteristics and functions. Inside of each cell the DNA as well as histones can be tagged by
tiny chemicals that modify gene expression. These chemical tags have the responsibility that causes genes to be
turned on or turned off. This causes genes to be expressed or silenced. The epigenome is a wrapped up package
of DNA. ... Show more content on Helpwriting.net ...
When chemical tags are labeled the modifications are called epigenetic modification. These can be classified as
modifications that take place on or above the genes. Epigenetic modification permits lasting changes in gene
expression. Epigenetics studies the changes in gene expression or development caused by mechanisms other than
changes in the primary DNA sequence. Epigenetics demonstrates how DNA interacts with the multitude of
smaller molecules found within cells which can activate and deactivate cells. Epigenetics can be highly based off
of nature versus nurture. Epigenetic changes are a part of normal development. As genes are activated some are
... Get more on HelpWriting.net ...
Importance Of Sequence Specific Primer PCR
Sequence specific primer PCR
With the advancement of sequencing technology, vast information on DNA sequences of many animal genomes
has been developed (Goff et al. 2002; Yu et al. 2002). In order to correlate DNA sequence information with
particular a phenotype of a trait, sequence–specific molecular marker techniques have been designed. Expressed
sequence tags (EST) analysis is one such type. By adopting this method, Expressed sequence tags of many
animal species have been created and these sequences are subjected as putative functional genes by using
advanced bioinformatics tools.
Allozyme markers
Allozymes are allelic variants of proteins produced by a single gene locus, and are of interest as markers because
polymorphism exists and ... Show more content on Helpwriting.net ...
They usually exhibit simple Mendelian inheritance and codominant expression, making genetic interpretations
easy. Disadvantages associated with allozymes include heterozygote deficiencies due to null (enzymatically
inactive) alleles and the amount and quality of tissue samples required (Hillis et al., 1996). In addition, some
changes in DNA sequence are masked at the protein level, reducing the level of detectable variation. Some
changes in nucleotide sequence do not change the encoded polypeptide (silent substitutions), and some
polypeptide changes do not alter the mobility of the protein in an electrophoretic gel (synonymous substitutions).
Moreover, genetic variations caused by mutations are expressed as amino acid replacements due to changes in
protein compositions, and are resolved as bands (alleles) on electrophoresis (DeYoung and Honeycutt, 2005).
However, other limitations developed by allozymes are highly biased genomic sampling (only genes encoding
well–documented, soluble proteins are detectable); a low number of markers, insufficient for examining major
portions of the genome; occasional differences between tissues or ontogenetic stages; and difficulty in the
standardization of experimental methods from laboratory to laboratory (DeYoung and Honeycutt, 2005). Low
levels of genetic variation revealed in many allozyme studies of animal populations prompted a continued search
for markers with greater genetic resolution.
... Get more on HelpWriting.net ...
The Causes Of Sexual Orientation And Homosexuality
Charles Darwin famously said, "We do not even in the least know the final cause of sexuality. The whole subject
is hidden in darkness" (Ryu). Since the beginning of time, there have been questions revolving around the topic
of sexual orientation. Within the past few decades, homosexuality is becoming more mainstream and socially
acceptable as more people begin to examine their gender identity and sexual preferences. Scientists researched to
determine the cause of sexual orientation; however, two opposing sides have formed around the issue: nature
(inherited genes and biology) versus nurture (the environment). Proponents of nature argue sexual orientation is
biological and genetic; whereas proponents of nurture argue sexual orientation is non–biological, environmental,
and socially constructed.
According to the American Psychological Association, sexual orientation is not a choice; instead "...it emerges
from most people in early adolescence with no prior sexual experience" ("Answers to Your Questions About
Sexual Orientation and Homosexuality"). Despite this, social theorists and other branches of scientists argue an
individual's upbringing directly impacts their sexual orientation. Many proponents of nurture are religiously
motivated to establish the morality behind sexual orientation. However, the purpose of this essay is to examine
and develop a deeper understanding of the theories surrounding the cause of sexual orientation. When combining
all four non–adaptive,
... Get more on HelpWriting.net ...
Annotated Bibliography On The Landscape Of Transcription
LANDSCAPE OF TRANSCRIPTION IN HUMAN CELLS
INTRODUCTION
The Encyclopedia of DNA Elements (ENCODE) is a project designed to compare and contrast the repertoire of
RNAs produced by the human cells and cross verify with other methods like NGS. After a five year start–up
since the beginning of the ENCODE project just 1% of the human genome has been observed and what was
achieved was just the confirmation of the results of previous studies.
RNA has functions of coding, regulation, decoding, and gene expression. RNA highlights the sequential output
from genomes which gives the genetic information. They define the cells regulatory capabilities by their
synthesis, translation, transport, processing, and modification. DNA, RNA and cellular ... Show more content on
Helpwriting.net ...
Cytosol and Nucleus) for 15 cell lines that were observed. This project also aims to evaluate the degree of
modification of the identified transcript at their 3' and 5' termini in the predicament of polyadenylation or 7–
methyl guanosine cap. A genes isoform expression limits the boundary of minimalistic expression strategy which
results in general behavior of genes to express simultaneous multiple isoforms. The results of gene expression
range nearly at ten to twelve expressed isoforms for every gene in every cell line.
This study shows that 6% of the entire annotated non–coding and coding gene transcripts are overlapping with
small RNAs. Highly specific subcellular positioning is found for both unannotated & annotated short RNA.
METHODS
In this paper, the necessary RNA data set was generated by subcellular fractionation of the 15 cell lines
considered to analyse the human transcriptome. Thus isolated RNAs were classified into two categories long
(>200 nucleotides) and short (<200 nucleotides) and the long transcripts were further separated into
polyadenylated and non–polyadenylated transcripts.
Data set Generation
The procedure followed for data set generation in this paper is mentioned below:
15 cell lines were acquired for the purpose of this experiment. Process of subcellular compartment fractionation
was performed on these cell lines, this included complete cells, nucleus and cytosol (seen in
... Get more on HelpWriting.net ...
The Importance Of Green Fluorescent Protein
In the 1960's, Green Fluorescent Protein was discovered to be responsible for Aequorea victoria's fluorescence
under UV light (Niwa et al., 1996). Today, GFP is often used in protein tagging and has made it possible for
scientists to study expression and track proteins in vivo. With the rising importance of GFP fusion proteins and
other recombinant vectors, the metal affinity of Histidine helps to make the protein purification process easier
(Lilius et al., 1991). His tags are commonly used to purify proteins through immobilized metal–affinity
chromatography (IMAC) (Lilius et al., 1991). This rapid and efficient method separates the recombinant protein
from unwanted products such as RNA. The His tag DNA sequence is inserted into the ... Show more content on
Helpwriting.net ...
It is of strong interest to molecular biologists because of the strong light emission of 508 nm under UV light. UV
wavelengths excite the fluorophore, contained in the Ser – Tyr – Gly sequence near GFP's N–terminus, and a
bright green fluorescence is given off as a result (Niwa et al., 1996). GFP can be successfully tagged to many
proteins without disturbing their function (Feilmeier et al., 2000). This allows scientists to exploit the protein for
its usefulness in marking proteins in vivo. GFP tagging has many applications. It can be used to study gene
expression by inserting gfp after a promotor in the plasmid, so that if expressed, the colony expressing the gene
of interest can be identified by a green fluorescence of GFP under UV light (Feilmeier et al., 2000). Specific
cellular organelles can be tagged, such as the endoplasmic reticulum, to visualize protein localization and
networking inside the living cell. GFP can also be used to monitor cofactor levels within a cell in real time. For
example, when GFP was tagged to proteins that contain a receptor sensitive to Ca2+, they interacted in a way so
that the fluorescence of the fusion protein was proportional to the calcium ion concentration with less than a 1
second lag in the cell (Romoser et al., 1997). Throughout the decades, GFP mutants have been created to give
brighter emission and different wavelengths. Researchers can track separate cell pathways at the same time, since
different proteins can
... Get more on HelpWriting.net ...
The Contributions Of DNA Sequences : DNA Is Not Destiny
DNA is Not Destiny
Deoxyribonucleic Acid (DNA) is made up of nucleotides which contain three parts: a phosphate group, a sugar
group, and one of four types of nitrogen bases. DNA then forms a double helix, with alternating phosphate and
sugar groups linked to a chain of nucleotides. DNA is important because it gives instructions to an organism on
how to develop, survive, and reproduce through DNA sequences. These sequences contain instructions on how to
make proteins, which are complex molecules that do most of the work in the human body. DNA Sequences that
contain instructions on how to make proteins are genes which also determine physical traits. The complete DNA
instruction book, or genome, for a human, contains about three billion ... Show more content on Helpwriting.net
...
The scientific studies conducted for epigenetics have given light and has helped disprove a common fact that
DNA is a person's destiny. A person's destiny is instead due to multiple factors. These factors range from the
mother's diet during pregnancy to the person's lifestyle (Watters 33). An experiment conducted by Randy Jirtle, a
professor at Duke University, has proven the mother's diet during pregnancy has a profound impact on child's
epigenome. The experiment took mice that have the agouti gene and bred them. Typically, the child would have
the agouti gene like the parents, which would make them yellow, fat, and prone to diseases, but it did not. The
offspring did not phonetically posses the agouti gene but were slender brown mice. This was due to the mother's
rich diet of methyl foods rich during pregnancy which altered the epigenome and phonetically turned off the
agouti gene (Watters 33). These methyl–rich foods are the type of victims usually found in the victim's pills
pregnant woman take so this data can be applied to humans like most mice experiments and results from them.
Scientists have conducted other studies and have found that identical twins having the same DNA can be
drastically different by the time they are twenty years old due to their different experiences in life (Fraga, Mario
F., et al). Epigenetics marks are affected by experiences a
... Get more on HelpWriting.net ...
The Encyclopedia Of Dna Elements
INTRODUCTION
The Encyclopedia of DNA Elements (ENCODE) is a project designed to compare and contrast the repertoire of
RNAs produced by the human cells and cross verify with other methods like NGS. After a five year start–up
since the beginning of the ENCODE project just 1% of the human genome has been observed and what was
achieved was just the confirmation of the results of previous studies.
RNA has functions of coding, regulation, decoding, and gene expression. RNA highlights the sequential output
from genomes which gives the genetic information. They define the cells regulatory capabilities by their
synthesis, translation, transport, processing, and modification. DNA, RNA and cellular proteins are the three most
essential ... Show more content on Helpwriting.net ...
Cytosol and Nucleus) for 15 cell lines that were observed. This project also aims to evaluate the degree of
modification of the identified transcript at their 3' and 5' termini in the predicament of polyadenylation or 7–
methyl guanosine cap. A genes isoform expression limits the boundary of minimalistic expression strategy which
results in general behavior of genes to express simultaneous multiple isoforms. The results of gene expression
range nearly at ten to twelve expressed isoforms for every gene in every cell line.
This study shows that 6% of the entire annotated non–coding and coding gene transcripts are overlapping with
small RNAs. Highly specific subcellular positioning is found for both unannotated & annotated short RNA.
METHODS
In this paper, the necessary RNA data set was generated by subcellular fractionation of the 15 cell lines
considered to analyse the human transcriptome. Thus isolated RNAs were classified into two categories long
(>200 nucleotides) and short (<200 nucleotides) and the long transcripts were further separated into
polyadenylated and non–polyadenylated transcripts.
Data set Generation
The procedure followed for data set generation in this paper is mentioned below:
15 cell lines were acquired for the purpose of this experiment. Process of subcellular compartment fractionation
was performed on these cell lines, this included complete cells, nucleus and cytosol (seen in Table 1).
The process of fractionation
... Get more on HelpWriting.net ...
Research on the Expressed Sequence Tag of Olives Essay
Introduction Olive, or scientific name Olea europaea L which belongs to Oleacea family is a valuable plant
species where it can produce oil and table olives. Gene at certain tissue in species will be expressed where cDNA
are sequenced to produce expressed sequence tag (EST) library. EST database is beneficial as it allows new gene
discovery, marker discovery, gene mapping, and functional studies to be carried out. This research has
contributed EST library of 2304 clone sequences from the young olive leaf and 1536 clone sequences from the
immature olive fruit for Turkish olive cultivar Gemlik. Good quality ESTs are used to further analysed by using
Phred–Phrap and Contig Assembly Program 3 (CAP3) software. They were then submitted to ... Show more
content on Helpwriting.net ...
EST sequences with vector sequence were edited using Phrap "cross–match" application. Contig Assembly
Program 3 (Cap3) was used to assemble the sequences obtained from sequencing for analysis while
Consed/Autofinish software was used to control the sequence assembly. All sequences were assembled separately
into contigs. BLAST of sequences was conducted to determine the gene homology in order to connect their
functions. Unique sequences were analysed for biological characteristics as well as functional annotation using
program BLAST2GO. New genes can then be identified eventually. Results Two cDNA libraries were
established from olive leaf and fruit, with 2304 clones and 1536 clones respectively. A total of 3840 EST
sequences was generated from the two cDNA libraries. 106 low–quality EST sequences were removed by using
Phred software. 3734 EST sequences with vector sequence were edited using Phrap "cross–match" application.
EST sequences and 1506 high quality fruit EST sequences were assembled using Contig Assembly Program 3
(Cap3) to assemble the sequences separately into contigs. Consequently, homolog genes which were consensus
EST sequences in GenBank can then be obtained. 2228 leaf EST sequences were assembled into 205 contigs,
length ranged from 514 bases to 1924 bases. 1506 fruit EST sequences were assembled into 69 contigs, length
ranged from 461 bases to 1909 bases. The two libraries were then assembled to obtain 299
... Get more on HelpWriting.net ...
Glutathione's Transferase Lab Report
Glutathione–S–Transferase (GST) is a detoxification enzyme which transfer glutathione to toxic substance and
can be used as a tag when fused to a protein of interest. The purpose of this experiment was for us to determine
which culture (A and B) was treated with Isopropyl B–D–thiogalactoside (IPTG) and therefore would express
GST. The bacteria E. coli BL21 carrying the pGEX–2T plasmid was used to express GST protein after which
protein extraction and GST purification from other proteins where done. GST expression is controlled by the Lac
operon promoter (Plac).
The Lac promoter sequence drives GST gene expression (transcription) and the lac repressor gene encodes a
protein that represses the lac promoter. When the lac repressor gene is always ... Show more content on
Helpwriting.net ...
On our SDS–PAGE, our protein standards were separated alongside our protein samples which allowed
determination of the sizes of our protein in our sample. SDS denature proteins and coats them with a negative
charge allowing for their electrophoretic separation by polyacrylamide gel electrophoresis (PAGE). As you can
see, after being stained with the coomassie blue, we could detect proteins of various sizes and our unknown
protein expressing GST was detected in our Pure B sample (Figure 2). The distance travelled from the wells on
the SDS–PAGES by our protein standards were measured and compared to our protein ladder in Daltons (Table
2), from which we could construct our semi log plot. On the semi–log plot, our unknown protein within our Pure
B travelled 27mm from the well with a size of 29,000 Dalton (Figure 3). To identify the specific protein in the
gel, the western blotting method was used to detect which of the cultures (A or B) contains GST (Figure 4). After
the cassette was taken out of the electrophoresis unit, colors of our protein standards appeared on top of our
membrane surface. After blocking, primary antibody incubation, and secondary antibody incubation, we could
clearly identify our GST in our Pure B and Crude B (Figure
... Get more on HelpWriting.net ...
Genetic Dna And Bioinformatics ( Accession No. Xp Essay
RESULTS
Isolation of BbovM17LAP gene
The BbM17LAP gene available in GenBank (accession no.
XP_001609968) was accessed through the National Center for
Biotechnology Information (NCBI), and its sequence was retrieved for further analysis. The genomic DNA of
BbM17LAP was found in chromosome 2, extending between 1,045,409 bp and
1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding BbM17LAP consists of 1,578 bp.
Alignment of the mRNA sequence with genomic DNA using Genetyx revealed that the gene has 4 introns within
its ORF. The first one was a 33– bp intron (50–ggtatgtttgtttgaatactgctgaatctgtgta–30) situated near the 50 end of
the gene. The other nucleotide sequences included a
35–bp (50–agatacttacagtaacgatacaagttcatgtaggt–30) intron, a 34–bp
(50–tgggttacactctttatgctatatttgttatagg–30) intron, and a 40–bp (50– gtaagttaattgggctacaagaagcgtaatatacatacag–30)
intron all located close to each other near the 30 end.
Isolation of BbovM17LAP cDNA and bioinformatics analysis
A pair of primers targeting the ORF of BbM17LAP was used to amplify and sequence the gene from a B. bovis
cDNA expression library. This BbM17LAP cDNA encoded a predicted
55–kDa protein without a signal peptide. The translated
BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP, having 71% amino acid identity
and similarity
(E value¼0). The other significant homologues included Theileria parva and Theileria annulata M17 LAPs, both
having 61% amino acid identities. The polypeptide
... Get more on HelpWriting.net ...
Protein Chromatography Lab Report
During this experiment the His–tagged protein RNase H was purified using affinity chromatography. The source
of over–expressed His–tagged RNase H used was 5.0 mL of E. coli lysate. The experiment was performed in
partners using different materials in order to prepare the needed three buffers to an approximate pH value of 7.9.
Once the three buffers were ready a minicolumn was packed with 0.5 mL of Ni–NTA agarose and then different
solutions were used to wash the column, starting with DI water, followed by the loading buffer, then the E.coli
lysate, the washing buffer, and finally the eluting buffer. Some of the flows through were collected for future
analysis in the upcoming experiments. The first was after the washing with the E.coli lysate, then the first wash
from the washing buffer, and finally the flow through obtained after the wash with the eluting buffer. ... Show
more content on Helpwriting.net ...
They are key constituents of all biological systems, and perform a great variety of functional and structural roles.
Proteins play a crucial role in almost all biological processes, like signal transmission, catalysis, and structural
support. This important range of functions comes from the existence of thousands of proteins, which are each
folded into a characteristics three–dimensional structure, the same structure that allows it to interact with one or
perhaps more molecules. A lot of the functional and structural studies of proteins are conducted with purified
preparations of proteins. In general the purification methods of proteins aim to exploit the differences in their
different properties such as, solubility, size, charge, and resin–binding specificity, all with the purpose to enrich
the solution for the targeted protein
... Get more on HelpWriting.net ...
Phaeodactylum Tricornutum Essay
Phaeodactylum tricornutum is a species of diatom: a eukaryotic, unicellular, photosynthetic organism (a result of
secondary endosymbiosis) that produces a silicified cell wall. P. tricornutum was chosen to be the second diatom
to have its full genome sequenced because it had already been studied for decades and there were substantial
genetic resources, including more than 100 000 expressed sequence tags (ESTs), available for it. As a model
system, P. Tricornutum is small, reproduces asexually with no loss in size and is easy to culture. In fact, the clone
that was sequenced was taken from a monoclonal culture, which came from a strain isolated in 1956 and
continually maintained in F/2 medium. Its genome is approximately 27.4 megabases in size,
... Get more on HelpWriting.net ...
Essay On Proteolytic Degradation Tagss
Results and Discussion
Multiple synthetic amino acid sequence tags target fluorescent proteins for degradation by different proteases. To
study proteolytic degradation by different proteases, fluorescent proteins were engineered with different potential
degradation tags on either the N–terminus or C–terminus (Table S2). Previously tested degradation tags could not
be compared directly to one another because they were characterized in different E. coli strains and under
different conditions. To our knowledge, this is the first systematic investigation of multiple degradation tags in E.
coli. We tested the previously determined degradation tags and several newly designed tags (Table 1A–B).
Degradation tags were fused to multiple fluorescent ... Show more content on Helpwriting.net ...
The fluorescence of RepA70–YFP increased as more RepA70–CFP was produced (Fig. 3C), and this indicated
that ClpAP protease could be overloaded and a proteolytic–queue forms similar to what was observed with the
LAA tagged proteins targeted to ClpXP8. We also tested two other tags, MarA and MarAn20 (20 amino acids
from the N–terminal of MarA), which target proteins to be degraded by the Lon protease. The Lon protease was
weakly overloaded by MarA tagged proteins but was overloaded more by MarAn20 tagged proteins (Fig. 3C–D).
This made us wonder if Lon could be overloaded when both MarA and MarAn20 were co–produced. Indeed, this
was the case (Fig. 3E).
The main proteases of E. coli can exhibit different levels of crosstalk depending on the degradation tags used. We
have demonstrated that ClpXP, ClpAP, and Lon can be overloaded using two proteins engineered with identical
degradation tags targeted for a specific protease. We have hypothesized that crosstalk between proteases may
occur through shared information (Fig. 1B). To test this hypothesis in a synthetic system, we monitored the level
of a fluorescent protein (YFP) targeted to one protease while producing another protein (CFP) targeted to a
different protease. There was strong crosstalk when proteins with the LAA degradation tag (target to ClpXP)
were co–produced with proteins with all other tags (RepA70, MarA, MarAn20, and HipB; Fig.
... Get more on HelpWriting.net ...
Module6LabAnswerSheet RANKOW Essay
********************************************************************************************
NAME: HEATHER M. RANKOW
Answer Sheet–Module 6 Lab
Gene Expression
View the following animation about gene switches: http://www.hhmi.org/biointeractive/gene–switch 1. What
does the yellow part of the DNA represent? The yellow part of the DNA is use for coding. It only expressed if
RNApolymerase lands on gene's promotor and makes mRNA from the gene.
2. What does the pink part of the DNA represent? The DNA promoter
3. What needs to land on the pink part in order for the gene to be expressed? RNA Polymerase
4. What do the blue, red and green parts of the DNA represent? Regulator switches
5. What are the functions of the blue, red, and green ... Show more content on Helpwriting.net ...
It becomes tightly wound and the genes are inaccessible.
b. What happens to the amount of GFP mRNA? It reduces, there is almost none left.
c. What happens to the amount of green fluorescent protein? It also reduces.
d. What happens to the appearance of the cell? It becomes faded with a faint green color.
3. Click on the Labels button near the control knob to reveal the following three links that reveal information
when clicked. Summarize the function of each:
a. a. histone – these are a type of protein that help to organize the DNA. There are 8 histones that make up one
group. Each have tails that are covered with chemical tags and stick out of the protein grouping. The chemical
tags on the tails affect how they interact with DNA.
b. b. methyl tag – these are used to either keep genes silent or turn them off. They are added to a cytosine in any
sequence of CG sequence of Nucleotides. They can turn off or silence the gene in two ways: (1) by blocking
transcription or (2) by recruiting proteins that bind to methylated DNA, which then also block transcription
machinery from binding to the active site.
c. c. acetyl tag – these tags occur near active genes. It allows for the activity between the histones and DNA to
relax making the DNA accessible. These tags are added to the amino acid lysine on the tails of histone proteins. It
is one of the many tags that make up the histone code.
4. Click on Insights from Identical Twins and then view the video Identical Twins:
... Get more on HelpWriting.net ...

More Related Content

Similar to Nuclear Transport And Its Effect On Breast Cancer Tumor Cells

DNA Sequencing in Phylogeny
DNA Sequencing in PhylogenyDNA Sequencing in Phylogeny
DNA Sequencing in PhylogenyBikash1489
 
gene mapping, clonning of disease gene(1).pptx
gene mapping, clonning of disease gene(1).pptxgene mapping, clonning of disease gene(1).pptx
gene mapping, clonning of disease gene(1).pptx
Rajesh Yadav
 
Proteomics ppt
Proteomics pptProteomics ppt
Proteomics ppt
Shashikala Chinnaswamy
 
Lab Differential Expression Differential gene expression provides th.pdf
 Lab Differential Expression Differential gene expression provides th.pdf Lab Differential Expression Differential gene expression provides th.pdf
Lab Differential Expression Differential gene expression provides th.pdf
rita892197
 
Lab Differential Expression Differential gene expression provides .pdf
 Lab Differential Expression Differential gene expression provides .pdf Lab Differential Expression Differential gene expression provides .pdf
Lab Differential Expression Differential gene expression provides .pdf
basilpaul63
 
Please describe in detaila. How to create and to use a transpo.pdf
Please describe in detaila. How to create and to use a transpo.pdfPlease describe in detaila. How to create and to use a transpo.pdf
Please describe in detaila. How to create and to use a transpo.pdf
4babies2010
 
proteomics
 proteomics proteomics
proteomics
vruddhi desai
 

Similar to Nuclear Transport And Its Effect On Breast Cancer Tumor Cells (8)

DNA Sequencing in Phylogeny
DNA Sequencing in PhylogenyDNA Sequencing in Phylogeny
DNA Sequencing in Phylogeny
 
gene mapping, clonning of disease gene(1).pptx
gene mapping, clonning of disease gene(1).pptxgene mapping, clonning of disease gene(1).pptx
gene mapping, clonning of disease gene(1).pptx
 
14825.full
14825.full14825.full
14825.full
 
Proteomics ppt
Proteomics pptProteomics ppt
Proteomics ppt
 
Lab Differential Expression Differential gene expression provides th.pdf
 Lab Differential Expression Differential gene expression provides th.pdf Lab Differential Expression Differential gene expression provides th.pdf
Lab Differential Expression Differential gene expression provides th.pdf
 
Lab Differential Expression Differential gene expression provides .pdf
 Lab Differential Expression Differential gene expression provides .pdf Lab Differential Expression Differential gene expression provides .pdf
Lab Differential Expression Differential gene expression provides .pdf
 
Please describe in detaila. How to create and to use a transpo.pdf
Please describe in detaila. How to create and to use a transpo.pdfPlease describe in detaila. How to create and to use a transpo.pdf
Please describe in detaila. How to create and to use a transpo.pdf
 
proteomics
 proteomics proteomics
proteomics
 

More from Stephanie Clark

School Essay How To Write A Introduc. Online assignment writing service.
School Essay How To Write A Introduc. Online assignment writing service.School Essay How To Write A Introduc. Online assignment writing service.
School Essay How To Write A Introduc. Online assignment writing service.
Stephanie Clark
 
College Essay Guy On Twitter Words Quotes, Ins
College Essay Guy On Twitter Words Quotes, InsCollege Essay Guy On Twitter Words Quotes, Ins
College Essay Guy On Twitter Words Quotes, Ins
Stephanie Clark
 
Qualitative Research Hypothesis Examples - Methods Of Research
Qualitative Research Hypothesis Examples - Methods Of ResearchQualitative Research Hypothesis Examples - Methods Of Research
Qualitative Research Hypothesis Examples - Methods Of Research
Stephanie Clark
 
Using Citations In A Paper - MLA Citations - Library Ho
Using Citations In A Paper - MLA Citations - Library HoUsing Citations In A Paper - MLA Citations - Library Ho
Using Citations In A Paper - MLA Citations - Library Ho
Stephanie Clark
 
10 Proven Steps Master How To Write Article Revie
10 Proven Steps Master How To Write Article Revie10 Proven Steps Master How To Write Article Revie
10 Proven Steps Master How To Write Article Revie
Stephanie Clark
 
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.ComMla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
Stephanie Clark
 
Free Thesis On Poverty. Online assignment writing service.
Free Thesis On Poverty. Online assignment writing service.Free Thesis On Poverty. Online assignment writing service.
Free Thesis On Poverty. Online assignment writing service.
Stephanie Clark
 
Four Types Of Writing Teaching Poster Set
Four Types Of Writing Teaching Poster SetFour Types Of Writing Teaching Poster Set
Four Types Of Writing Teaching Poster Set
Stephanie Clark
 
Martin Luther King Jr Coloring Pages And Works
Martin Luther King Jr Coloring Pages And WorksMartin Luther King Jr Coloring Pages And Works
Martin Luther King Jr Coloring Pages And Works
Stephanie Clark
 
Review Paper Format Sample. How To Write A Re
Review Paper Format Sample. How To Write A ReReview Paper Format Sample. How To Write A Re
Review Paper Format Sample. How To Write A Re
Stephanie Clark
 
Pin By Cindy Campbell On GrammarEnglish Language Essay Writing ...
Pin By Cindy Campbell On GrammarEnglish Language  Essay Writing ...Pin By Cindy Campbell On GrammarEnglish Language  Essay Writing ...
Pin By Cindy Campbell On GrammarEnglish Language Essay Writing ...
Stephanie Clark
 
The Christmas Tree Writing Paper By StevenS Social S
The Christmas Tree Writing Paper By StevenS Social SThe Christmas Tree Writing Paper By StevenS Social S
The Christmas Tree Writing Paper By StevenS Social S
Stephanie Clark
 
How To Evaluate Essay Writing (With Pictures) - Wik
How To Evaluate Essay Writing (With Pictures) - WikHow To Evaluate Essay Writing (With Pictures) - Wik
How To Evaluate Essay Writing (With Pictures) - Wik
Stephanie Clark
 
Thanksgiving Writing Template For Kindergarten
Thanksgiving Writing Template For KindergartenThanksgiving Writing Template For Kindergarten
Thanksgiving Writing Template For Kindergarten
Stephanie Clark
 
Organisation Behavier
Organisation BehavierOrganisation Behavier
Organisation Behavier
Stephanie Clark
 
A Study On Meeting Receptor
A Study On Meeting ReceptorA Study On Meeting Receptor
A Study On Meeting Receptor
Stephanie Clark
 
Organization Structure And Inter-Organizational...
Organization Structure And Inter-Organizational...Organization Structure And Inter-Organizational...
Organization Structure And Inter-Organizational...
Stephanie Clark
 
George Frideric Handel Influences
George Frideric Handel InfluencesGeorge Frideric Handel Influences
George Frideric Handel Influences
Stephanie Clark
 
Kore The Impossible Country
Kore The Impossible CountryKore The Impossible Country
Kore The Impossible Country
Stephanie Clark
 
Earthquake Intensities
Earthquake IntensitiesEarthquake Intensities
Earthquake Intensities
Stephanie Clark
 

More from Stephanie Clark (20)

School Essay How To Write A Introduc. Online assignment writing service.
School Essay How To Write A Introduc. Online assignment writing service.School Essay How To Write A Introduc. Online assignment writing service.
School Essay How To Write A Introduc. Online assignment writing service.
 
College Essay Guy On Twitter Words Quotes, Ins
College Essay Guy On Twitter Words Quotes, InsCollege Essay Guy On Twitter Words Quotes, Ins
College Essay Guy On Twitter Words Quotes, Ins
 
Qualitative Research Hypothesis Examples - Methods Of Research
Qualitative Research Hypothesis Examples - Methods Of ResearchQualitative Research Hypothesis Examples - Methods Of Research
Qualitative Research Hypothesis Examples - Methods Of Research
 
Using Citations In A Paper - MLA Citations - Library Ho
Using Citations In A Paper - MLA Citations - Library HoUsing Citations In A Paper - MLA Citations - Library Ho
Using Citations In A Paper - MLA Citations - Library Ho
 
10 Proven Steps Master How To Write Article Revie
10 Proven Steps Master How To Write Article Revie10 Proven Steps Master How To Write Article Revie
10 Proven Steps Master How To Write Article Revie
 
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.ComMla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
Mla Format Citing Multiple Pages - Uirunisaza.Web.Fc2.Com
 
Free Thesis On Poverty. Online assignment writing service.
Free Thesis On Poverty. Online assignment writing service.Free Thesis On Poverty. Online assignment writing service.
Free Thesis On Poverty. Online assignment writing service.
 
Four Types Of Writing Teaching Poster Set
Four Types Of Writing Teaching Poster SetFour Types Of Writing Teaching Poster Set
Four Types Of Writing Teaching Poster Set
 
Martin Luther King Jr Coloring Pages And Works
Martin Luther King Jr Coloring Pages And WorksMartin Luther King Jr Coloring Pages And Works
Martin Luther King Jr Coloring Pages And Works
 
Review Paper Format Sample. How To Write A Re
Review Paper Format Sample. How To Write A ReReview Paper Format Sample. How To Write A Re
Review Paper Format Sample. How To Write A Re
 
Pin By Cindy Campbell On GrammarEnglish Language Essay Writing ...
Pin By Cindy Campbell On GrammarEnglish Language  Essay Writing ...Pin By Cindy Campbell On GrammarEnglish Language  Essay Writing ...
Pin By Cindy Campbell On GrammarEnglish Language Essay Writing ...
 
The Christmas Tree Writing Paper By StevenS Social S
The Christmas Tree Writing Paper By StevenS Social SThe Christmas Tree Writing Paper By StevenS Social S
The Christmas Tree Writing Paper By StevenS Social S
 
How To Evaluate Essay Writing (With Pictures) - Wik
How To Evaluate Essay Writing (With Pictures) - WikHow To Evaluate Essay Writing (With Pictures) - Wik
How To Evaluate Essay Writing (With Pictures) - Wik
 
Thanksgiving Writing Template For Kindergarten
Thanksgiving Writing Template For KindergartenThanksgiving Writing Template For Kindergarten
Thanksgiving Writing Template For Kindergarten
 
Organisation Behavier
Organisation BehavierOrganisation Behavier
Organisation Behavier
 
A Study On Meeting Receptor
A Study On Meeting ReceptorA Study On Meeting Receptor
A Study On Meeting Receptor
 
Organization Structure And Inter-Organizational...
Organization Structure And Inter-Organizational...Organization Structure And Inter-Organizational...
Organization Structure And Inter-Organizational...
 
George Frideric Handel Influences
George Frideric Handel InfluencesGeorge Frideric Handel Influences
George Frideric Handel Influences
 
Kore The Impossible Country
Kore The Impossible CountryKore The Impossible Country
Kore The Impossible Country
 
Earthquake Intensities
Earthquake IntensitiesEarthquake Intensities
Earthquake Intensities
 

Recently uploaded

The Roman Empire A Historical Colossus.pdf
The Roman Empire A Historical Colossus.pdfThe Roman Empire A Historical Colossus.pdf
The Roman Empire A Historical Colossus.pdf
kaushalkr1407
 
Additional Benefits for Employee Website.pdf
Additional Benefits for Employee Website.pdfAdditional Benefits for Employee Website.pdf
Additional Benefits for Employee Website.pdf
joachimlavalley1
 
Palestine last event orientationfvgnh .pptx
Palestine last event orientationfvgnh .pptxPalestine last event orientationfvgnh .pptx
Palestine last event orientationfvgnh .pptx
RaedMohamed3
 
Model Attribute Check Company Auto Property
Model Attribute  Check Company Auto PropertyModel Attribute  Check Company Auto Property
Model Attribute Check Company Auto Property
Celine George
 
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.pptThesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
EverAndrsGuerraGuerr
 
Sectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdfSectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdf
Vivekanand Anglo Vedic Academy
 
Template Jadual Bertugas Kelas (Boleh Edit)
Template Jadual Bertugas Kelas (Boleh Edit)Template Jadual Bertugas Kelas (Boleh Edit)
Template Jadual Bertugas Kelas (Boleh Edit)
rosedainty
 
Cambridge International AS A Level Biology Coursebook - EBook (MaryFosbery J...
Cambridge International AS  A Level Biology Coursebook - EBook (MaryFosbery J...Cambridge International AS  A Level Biology Coursebook - EBook (MaryFosbery J...
Cambridge International AS A Level Biology Coursebook - EBook (MaryFosbery J...
AzmatAli747758
 
ESC Beyond Borders _From EU to You_ InfoPack general.pdf
ESC Beyond Borders _From EU to You_ InfoPack general.pdfESC Beyond Borders _From EU to You_ InfoPack general.pdf
ESC Beyond Borders _From EU to You_ InfoPack general.pdf
Fundacja Rozwoju Społeczeństwa Przedsiębiorczego
 
Digital Tools and AI for Teaching Learning and Research
Digital Tools and AI for Teaching Learning and ResearchDigital Tools and AI for Teaching Learning and Research
Digital Tools and AI for Teaching Learning and Research
Vikramjit Singh
 
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdfUnit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
Thiyagu K
 
How to Make a Field invisible in Odoo 17
How to Make a Field invisible in Odoo 17How to Make a Field invisible in Odoo 17
How to Make a Field invisible in Odoo 17
Celine George
 
Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345
beazzy04
 
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
MysoreMuleSoftMeetup
 
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptxChapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptx
Mohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
 
Fish and Chips - have they had their chips
Fish and Chips - have they had their chipsFish and Chips - have they had their chips
Fish and Chips - have they had their chips
GeoBlogs
 
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXXPhrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
MIRIAMSALINAS13
 
Home assignment II on Spectroscopy 2024 Answers.pdf
Home assignment II on Spectroscopy 2024 Answers.pdfHome assignment II on Spectroscopy 2024 Answers.pdf
Home assignment II on Spectroscopy 2024 Answers.pdf
Tamralipta Mahavidyalaya
 
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
Nguyen Thanh Tu Collection
 
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
Welcome to TechSoup   New Member Orientation and Q&A (May 2024).pdfWelcome to TechSoup   New Member Orientation and Q&A (May 2024).pdf
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
TechSoup
 

Recently uploaded (20)

The Roman Empire A Historical Colossus.pdf
The Roman Empire A Historical Colossus.pdfThe Roman Empire A Historical Colossus.pdf
The Roman Empire A Historical Colossus.pdf
 
Additional Benefits for Employee Website.pdf
Additional Benefits for Employee Website.pdfAdditional Benefits for Employee Website.pdf
Additional Benefits for Employee Website.pdf
 
Palestine last event orientationfvgnh .pptx
Palestine last event orientationfvgnh .pptxPalestine last event orientationfvgnh .pptx
Palestine last event orientationfvgnh .pptx
 
Model Attribute Check Company Auto Property
Model Attribute  Check Company Auto PropertyModel Attribute  Check Company Auto Property
Model Attribute Check Company Auto Property
 
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.pptThesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
 
Sectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdfSectors of the Indian Economy - Class 10 Study Notes pdf
Sectors of the Indian Economy - Class 10 Study Notes pdf
 
Template Jadual Bertugas Kelas (Boleh Edit)
Template Jadual Bertugas Kelas (Boleh Edit)Template Jadual Bertugas Kelas (Boleh Edit)
Template Jadual Bertugas Kelas (Boleh Edit)
 
Cambridge International AS A Level Biology Coursebook - EBook (MaryFosbery J...
Cambridge International AS  A Level Biology Coursebook - EBook (MaryFosbery J...Cambridge International AS  A Level Biology Coursebook - EBook (MaryFosbery J...
Cambridge International AS A Level Biology Coursebook - EBook (MaryFosbery J...
 
ESC Beyond Borders _From EU to You_ InfoPack general.pdf
ESC Beyond Borders _From EU to You_ InfoPack general.pdfESC Beyond Borders _From EU to You_ InfoPack general.pdf
ESC Beyond Borders _From EU to You_ InfoPack general.pdf
 
Digital Tools and AI for Teaching Learning and Research
Digital Tools and AI for Teaching Learning and ResearchDigital Tools and AI for Teaching Learning and Research
Digital Tools and AI for Teaching Learning and Research
 
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdfUnit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
 
How to Make a Field invisible in Odoo 17
How to Make a Field invisible in Odoo 17How to Make a Field invisible in Odoo 17
How to Make a Field invisible in Odoo 17
 
Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345Sha'Carri Richardson Presentation 202345
Sha'Carri Richardson Presentation 202345
 
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
 
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptxChapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptx
 
Fish and Chips - have they had their chips
Fish and Chips - have they had their chipsFish and Chips - have they had their chips
Fish and Chips - have they had their chips
 
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXXPhrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
Phrasal Verbs.XXXXXXXXXXXXXXXXXXXXXXXXXX
 
Home assignment II on Spectroscopy 2024 Answers.pdf
Home assignment II on Spectroscopy 2024 Answers.pdfHome assignment II on Spectroscopy 2024 Answers.pdf
Home assignment II on Spectroscopy 2024 Answers.pdf
 
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
GIÁO ÁN DẠY THÊM (KẾ HOẠCH BÀI BUỔI 2) - TIẾNG ANH 8 GLOBAL SUCCESS (2 CỘT) N...
 
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
Welcome to TechSoup   New Member Orientation and Q&A (May 2024).pdfWelcome to TechSoup   New Member Orientation and Q&A (May 2024).pdf
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdf
 

Nuclear Transport And Its Effect On Breast Cancer Tumor Cells

  • 1. Nuclear Transport And Its Effect On Breast Cancer Tumor Cells Nuclear transport is the method by which large molecules enter and exit the cell nucleus through nuclear pore complexes. Small molecules however do not require much regulation. This method of transport and translocation provides an understanding of various protein movement between the cytoplasm and nucleoplasm of the cell. The hundreds of nuclear transport pathways allow for the study and mechanistic view of nuclear transport's role in the onset as well as expression of multiple diseases; breast cancer being one in particular. Various nuclear transport pathways play an important role in the progression and suppression of breast cancer tumor cells. Proteins and enzymes that propagate these pathways can lead to cell proliferation or inhibition of the invasive and metastatic behavior of breast cancer advancement. A further look at these pathways will aid in the understanding of breast cancer tumor cells. Nuclear localization sequences or NLS, is a necessary component of nuclear transport. It is an amino acid sequence that will "tag" a protein for import. By disrupting this sequence, the way a protein is imported is altered and can lead to numerous defects. Where it may localize can change the functionality of the protein. This can be seen in the case of spleen tyrosine kinase, Syk. Spleen tyrosine kinase is "a candidate tumor (metastasis) suppressor that is highly expressed in mammary epithelial cells" (Wang). Lei Wang and associates looked at two different variants of Syk; ... Get more on HelpWriting.net ...
  • 2.
  • 3. Binary Chromatography Lab Report Afterward, PTEN purified using affinity chromatography. Since PTEN fused with His6 tag, Ni–NTA affinity chromatography would work to purify PTEN. Ni–NTA is a type of immobilized metal affinity chromatography that contain coupled Ni2+ nickel chelate forming ligand (imiondiacetic acid) that immobilized to agarose. The science behind using Ni–NTA affinity chromatography is that histidine bind specifically and reversibly to the nickel chalet thus washing step will remove other contaminate and then His–PTEN eluted using imidazole. Bradford assay and SDS–PAGE performed to quantify and analyze the progress toward PTEN purification. The calculated concentration of the samples presented in table 8. The Concentration of samples make since having the ... Show more content on Helpwriting.net ... A scientist need to demonstrate mammalian cell transfection under very sterile technique since they grow slowly and affected by contamination resulting in lower expression. In addition, the total number of mammalian cell should maintain steady and once there is confluent, cells have no more room to grow, mammalian cell culture should split using digestive enzyme and placed into new fresh media. To do so, hemocytometer used to count mammalian cell and demonstrate the cell concentration. Table 11 shows the calculation of mammalian cell concentration and for transfecting 1000,000 cell we need 1.17 ml. Following mammalian transfection, immunoprecipitation processed for FLAG–PTEN gained from mammalian cells. Anti–FLAG antibody used as ligand just as affinity chromatography to purify FLAG–PTEN. Latter on, western blotting carried out by transferring the protein from the completed SDS–PAGE to PVDF membrane as the order in figure 5. After that, incubation with primary and secondary antibody to visualize PTEN through the chemiliuminescence reaction as shown in figure 7. The figure present FLAG–PTEN in three samples the FLAG–PTEN IP, supernatant FLAG– PTEN after IP, and lysate FLAG–PTEN before IP. Lysate FLAG–PTEN before IP and FLAG–PTEN IP spouse to contain PTEN and that confirm the success of mammalian transfection. However, the FLAG–PTEN IP showed a smeared band. That may due to high protein concentration load ... Get more on HelpWriting.net ...
  • 4.
  • 5. Expressed Sequence Tags (ESTs) versus Serial Analysis of... Expressed Sequence Tags (ESTs) versus Serial Analysis of Gene Expression (SAGE) INTRODUCTION Expressed sequence tag or also known as EST are 200 to 800 unedited nucleotide bases in length, and randomly selected single pass sequence reads which are derived from the cDNA libraries while serial analysis of gene expression or SAGE have more shorter sequence tags with only 10 to 20 base pairs. But even it is short it still have enough information to uniquely identify a transcript, especially if it is obtained from a unique position in each of the transcripts. Serial analysis of gene expression is a method or technique designed to gain a direct and quantitative measure of overall gene expression pattern. It is basically a sequence based ... Show more content on Helpwriting.net ... ETS also can determine definitively the number of copies of each transcript per cell and highlight any differential gene expression. EST includes an inefficient sequencing step, in which one sequencing process yields only one cDNA sequence. Although the more recent methods of hybridization based analyses (DNA microarray) using immobilized cDNAs (Schena et al., 1995) or oligonucleotides (Lockhart et al., 1996) can potentially examine the expression patterns of a relatively large number of genes, the method can only examine expressed sequences that have already been identified. In contrast, the SAGE method allows for a quantitative and simultaneous analysis of a large number of transcripts in any particular cells or tissues, without prior knowledge of the genes (Velculescu et al., 1995). METHODOLOGY The SAGE method is based on the isolation of unique sequence tags from individual mRNAs and concatenation of tags serially into long DNA molecules for lump sum sequencing. It can be applied to the studies exploring virtually any kinds of biological phenomena in which the changes in cellular transcription are responsible. SAGE is based mainly on three principles, firstly, a short sequence tags, 10 to 15 base pairs contains sufficient information to uniquely identify a transcript provided that the tag is obtained from a unique position within each transcript to allow the efficient sequencing analysis. Secondly ... Get more on HelpWriting.net ...
  • 6.
  • 7. Optogenetic Manipulation In Transgenic Rats To effectively integrate the applications of optogenetics in a living organism, there needs to be previous genetic manipulation to enable the rat to be receptive to optogenetic technologies. The genetic manipulation involves creating transgenic rats. Transgenic manipulation involves the movement or insertion of a gene in an organism that does not normally possess the gene. The gene of interest is the gene for halorhodopsin, and to produce rats that possess this gene requires injecting a DNA construct into a fresh embryo. A DNA construct is an artificially constructed segment of nucleic acid that is transplanted in the cell. The DNA construct is usually constructed as a plasmid. The construct must contain a DNA insert, which has the gene sequence ... Show more content on Helpwriting.net ... The primary antibody is the antibody that will bind to the protein of interest. This is generated by exposing the halorhodopsin protein to a rat so that an immune response of antibodies can be generated and these antibodies are harvested from the rat. This antibody will bind to the protein of interest during incubation. The detection, however, is done with the use of a secondary antibody generated from another animal. When unbound primary antibodies are removed from the blotting sheet, the secondary antibody can be used to detect bound primary antibodies. The secondary antibody will be modified with a fluoresce tag that lights up when the secondary antibody binds with the bonded primary antibody. If there is a detectable fluoresce signal, then there is the halorhodopsin protein present in the blot. The amount of fluoresce indicates how much of the halorhodopsin gene is being generated. With the confirmation that HaloX gene was properly inserted into the genome, pain testing with optogenetics can ... Get more on HelpWriting.net ...
  • 8.
  • 9. Rationale & Hypotheses. Past Studies Have Shown That Podxl RATIONALE & HYPOTHESES Past studies have shown that Podxl overexpression identifies a highly aggressive subset of breast carcinomas. Moreover, our previous results show an important role of Podxl on in vivo primary tumor growth and metastasis of MDA–MB–231 cells. However, the mechanism of action by which Podxl plays a role in tumor progression it still unclear. I hypothesize that the structure and biochemical and signalling properties of podocalyxin promote breast cancer tumor progression and, therefore, podocalyxin may be a novel target for future therapeutics. OBJECTIVES & AIMS Objective #1: Identify the Podxl functional domains required for cancer metastasis. Aim 1.1: Generation of human Podxl mutants Aim 1.2: Identify critical ... Show more content on Helpwriting.net ... We have selected different hPodxl mutants to generate (Figure 5). 1) PodxlDTHL: Podxl mutant lacking the C– terminal PDZ docking site, the docking site for NHERF1/2. This mutant will allow us to determine whether or not the ability to bind NHERF1/2 is critical for tumor progression. 2) PodxlTail, lacking all but three aminoacids of the cytoplasmic tail and, therefore, eliminating all intracellular binding (ezrin, NHERF1/2 and other potential unknown ligands). 3) PodxlEC missing the whole extracellular domain, allowing us to account for the lack of the highly negatively charged glycosylated portion as well as the stalk domain. We previously demonstrated that a high–affinity monoclonal antibody (mAb) targeting Podxl (PODOC1) could be used to block tumor growth and metastasis in a pre–clinical tumor model in mice(28). Administration of PODOC1 mAb to tumor–bearing mice inhibited primary tumor growth and attenuated distant metastases to the lung(28). The PODOC1 epitope is the stalk domain of Podxl's extracellular portion (a core protein domain). Because other very similar anti–podocalyxin mAbs that we generated to Podxl's extracellular core protein domains had no therapeutic effect, we post that this critical domain (the PODOC1 epitope) serves a functional role in Podxl mode of action in metastasis. Since PODOC1's epitope appears to have a significant role in tumorigenesis, we will generate an additional hPodxl mutant (ECGlyco) lacking only the ... Get more on HelpWriting.net ...
  • 10.
  • 11. Epigenetic Research Paper Epigenetics and the factors that relate to Organisms Diversity The development and importance of epigenetics has revealed to the world the explanation of many gene expressing mutations also factors that may account for genetic variation. The result of this observation helped many scientists around the world cures as well as new analysis methods to help survivors .The understanding obtained from the discovery of epigenetics has and will continue to inform ways of preventing and manipulating genetic expressions to our advantage throughout these upcoming generations. Throughout this essay response, the following information will cover the focus on how epigenetics can account for genetic variability in organisms, it will also relate to factors ... Show more content on Helpwriting.net ... Epigenetic factors are compounds that attach to, or "mark" DNA. These factors interact with genetic material, but do not change the underlying DNA sequence. Instead, they act as chemical tags, indicating what, where, and when genes should be "turned on" or expressed. Some epigenetic factors come from natural sources or are even encoded in the DNA, and are a normal part of gene regulation. That is, the epigenome helps control which genes are active in a particular cell, and therefore, which proteins are transcribed locally. For example, epigenetic factors tell brain cells to act like brain cells, and skin cells to behave like skin cells. In the absence of a normal epigenome, disease can occur. These factors are also increasingly implicated in social and behavioral traits. FActor four: A frameshift mutation also called a framing error or a reading frameshift is a genetic mutation caused by insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame the grouping of the codons, resulting in a completely different translation from the original. The earlier in the sequence the deletion or insertion occurs, the more altered the ... Get more on HelpWriting.net ...
  • 12.
  • 13. Recurrent Incidence Of Babesiosis Among Adults Essay Recurrent incidence of babesiosis among apparently healthy bovines in Egypt, submits the needs for suitably destined prevalence studies with rapid and accurate diagnosis and immediate treatment of infected animals are required to control this disease. The routine epidemiological survey and diagnosis usually based upon microscopical examination of Giemsa stained blood smears. This technique is insufficient for accurate detection and identification of Babesia species during mixed infections and not reliable for detecting the infection in carrier cases or subclinical infections with low parasitemia. Combination of molecular and serological diagnostic tools for the infection provides powerful tools for accurate diagnosis as well as for epidemiological investigations as means of overcoming limitations of microscopical examination. The polymerase chain reaction will be conducted using highly conserved and species specific genes for detecting the parasite DNA in the blood of infected animals based on the B. bigemina rhoptry associated proteins, Apical membrane protein 1 & Internal trancribed spacer and B. bovis Spherical body proteins 4. The serological diagnostic tools, including the indirect fluorescent antibody test, the Indirect enzyme–linked immunosorbent assay, a competitive ELISA will be conducted to detect Babesia antibodies in serum of naturally infected cattle based on Babesia lysate, Cyanogen bromide–activated Sepharose 4B, affinity purified antigen and expressed, ... Get more on HelpWriting.net ...
  • 14.
  • 15. Greek Language Essay A survey on various platforms for Sanskrit and Part–Of–Speech Tagging Methods Sulabh Bhatt, Parmar Krunal Department Of Computer Science, Gujarat University Ahmedabad, India sulabhbhatt@gmail.com parmar.krunal005@gmail.com Abstract – In this paper we present a Natural language processing for Sanskrit using Different approaches. Sanskrit is a oldest and considered as the mother of all languages. The Sanskrit, the world 's ancient language has got a wealthy grammar. The Sanskrit grammar text Ashtadhyayi is written by Panini (an Indian Sage). Sanskrit is a well suitable language for providing an advanced artificial intelligence for Computers. Part of Speech (POS) Tagging is the first step in the development of any NLP Application. A POS Tagger (POST) is a piece of software that reads text in some language and assigns parts of speech to each word (and other token), such as noun, verb, adjective, etc. Keywords – NLP for Sanskrit, Tagset, POS Tagging, HMM, CRF I. INTRODUCTION Natural language processing: Natural language is the embodiment of human cognition and human intelligence. Natural language processing (NLP) is a cross disciplinary field in computer science and linguistics where a computer can generate and understand human speech. It is the ability of a computer program to understand human speech as it is spoken. NLP is a component of artificial intelligence (AI).The development of NLP applications is challenging because computers traditionally require humans to "speak" ... Get more on HelpWriting.net ...
  • 16.
  • 17. Honey Bees Eusociality This study explored the connection between changes in genetics and eusocial evolution in honey bees. The evolution of eusociality is when a single species lives in a cooperative group that depends on a single female and several males who are reproductively active, with the nonbreeding individuals responsible for caring for the young and providing food and protection to the whole colony. Bees were used in this experiment due to the fact that eusociality was obtained in bees more times than any other group, making comparing numerous origins of various social lifestyles of closely related species possible. The vast amount of information pertaining to the natural history of bees also helped in the establishment of the idea of adaptive significance ... Get more on HelpWriting.net ...
  • 18.
  • 19. Prader-Willi And Angelman Syndrome: Epigenetic Analysis Prader–Willi and Angelman Syndrome are two key examples of genomic imprinting of epigenetics. Epigenetics is the changes of an organism, which is changed by the gene expression, instead of the alteration of the genetic code (Butler, 2011). Genomic imprinting is subtopic among an epigenetic phenomenon in which genes are expressed based upon the parent who gives the gene. Although Prader–Willi and Angelman Syndrome are two completely different genetic disorders, they both involve the same chromosome region but each disorder is inherited by a different parent. It has been said that Prader–Willi and Angelman Syndrome are one of the first examples of error in genomic imprinting in humans (Butler, 2011). In 1942 an embryologist Conrad Waddington ... Show more content on Helpwriting.net ... The process of gametogenesis is where epigenetics is erased throughout each new generation supposedly. However, in 2005, reports were made that epigenetics undergoes four subsequent generations (Weinhold 2006). As for being able to reverse the genes given by the sperm and egg after they are already formed, is not possible. The only way a disorder like Angelman or Prader–Willi could be reversed is through the next generations. This explains how a mother can have two children and only one of them could end up with one of these disorders. Although there isn't much to be done to try and reverse the effects of epigenetics once and individual has suffered from it, researches want more technology advances to go into the process of identifying genomically imprinted genes. More development of counting the number of protein in the cell to recognize better protein modification (Weinhold 2006). All of the recognized and know genes that are imprinted are tallied in the Mammalian Genetics research group. There is still a lot of room to grow and learn about epigenetics and all of the modified genes that occur in human bodies. Graduate school students are advancing technology for this reason. More specifically, technology for additional ... Get more on HelpWriting.net ...
  • 20.
  • 21. Advantages And Disadvantages Of Prunus Introduction Prunus is a genus of trees and shrubs, which includes the plums, cherries, peaches, nectarines, apricots and almonds. Around 430 species are spread throughout the northern temperate regions of the globe. Many members of the genus are widely cultivated for fruit and ornament. The fruit from this genus are commonly called the stone fruit (Browiz 1996; Browiz and Zohary 1996). Microsatellites or simple sequence repeats (SSRs) are short, tandemly repeated DNA regions that are ubiquitously present in the genomes of pro– and eukaryotes. Because of their abundance, multiallelic behavior, high polymorphism, codominant inheritance and excellent reproducibility, PCR–amplified SSRs have become the markers of choice for many applications, including genetic mapping and population genetics (Powell et al. 1996). Among the few disadvantages of SSR markers are the often tedious and costly cloning and enrichment procedures required for their generation (Zane et al. 2002; Squirrell et al. 2003; Weising et al. 2005). Since about a decade, computational methods have been applied ... Show more content on Helpwriting.net ... The genomic SSRs were analyzing by GMATo, graphic and command line application. The program and manual is freely available at http://sourceforge.net/p/GMATo (Table 1.). The minimum motif repeat size were set to 8 for mononucleotide, 5 for dinucleotide, 3 for trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide heptaanucleotide, octaanucleotide, nonaanucleotide and decanucleotide in locating the microsatellites with maximum differences two SSRs was 100. SSRs were searched in full chloroplast genome as well as separate coding and non–coding regions for each species. Also, GC content was ... Get more on HelpWriting.net ...
  • 22.
  • 23. The Importance Of Micrornas The microRNAs (miRNAs) are single–stranded small, endogenous, non–coding regulatory RNA with size varying ~21 to 24 nucleotides. microRNA mediated gene regulation play an important role in the negative regulation of gene at post–transcriptional level by targeting the mRNAs of protein coding genes by cleavage or repressing protein translation in eukaryotes and viruses (Bartel, 2004). microRNAs are expressed from their own genes located in the intergenic or intragenic region on the chromosomes (Lagos–Quintana et al., 2001). In plants, most miRNA genes are intergenic and transcribed individually from their own region, but a few genes are organized into polycistronic transcription units and co–transcribed from single promoter at the end of a ... Show more content on Helpwriting.net ... The functional genomics studies have shown the involvement of plant miRNAs in many developmental processes of plant (Jones et al., 2006), response to biotic and biotic stresses, hormone signalling (Frazier et al., 2011, Jagadeeswaran et al., 2009), signal transduction, protein degradation (Zhou et al., 2010; Zhang et al., 2008), transgene suppression (Allen et al., 2005), disease development (Johnson et al., 2005), defense against viruses (Bennasser et al., 2004), molecular mechanisms regulating developmental transitions, such as seed germination, vegetative and reproductive phase changes, flowering initiation, seed production and root development (Yang et al., 2011) and nutrient deprivation and heavy metals (Chen et al., 2012). Many miRNAs have been identified and investigated extensively in plant species with sequenced genomes and comparative genome analysis from expressed sequence tag (EST), genome survey sequences (GSS) and nucleotide sequences. miRNAs are evolutionarily conserved in the plant kingdom from mosses and ferns to angiosperms (Zhang et al., 2006b). Using this attribute, identification and prediction of miRNA by sequence analysis has advantage over other methods. It has been suggested that miRNAs predicted by EST analysis can be recovered by high throughput deep sequencing (Kwak et ai., 2009). Pearl millet (Pennisetum glaucum L.) is a monocot, C4 annual grass belonging to the family Poaceae. It is cultivated as staple food grain ... Get more on HelpWriting.net ...
  • 24.
  • 25. What Is Epigenetics? What is Epigenetics? The word "epigenetic" means "in addition to changes in genetic sequence." The term has changed to include any process that alters gene activity without changing the DNA sequence, and leads to modifications that can be transmitted to daughter cells. The term epigenetics was first used in the early 1940s, when embryologist Conrad Waddington used it to describe the interactions between genes and their products, which give rise to an organism's observable characteristics or phenotype. Epigenetics involves genetic control by factors other than an individual's DNA sequence. Certain circumstances in life can cause genes to be silenced or expressed over time. They can be turned off, becoming dormant, or turned on, becoming active. ... Show more content on Helpwriting.net ... If we could map every single cause and effect of the different combinations, and if we could reverse the gene's state to keep the good while eliminating the bad, then theoretically we could cure cancer, slow the aging process and stop obesity. Epigenetic processes are natural and essential to many organism functions, but if they occur improperly, there can be major adverse health and behavioural effects. How does epigenetics work? Epigenetic changes alter the physical structure of DNA. Chemical tags known as epigenetic marks sit atop genes, either on the DNA itself or on the histone proteins around which DNA is wrapped. Changes in the mix of these marks can alter a gene's behaviour, turning the gene off so that protein synthesis is inhibited, or turning it on, all without changing the information the gene contains. Epigenetic tags act as a kind of cellular memory. A cell's epigenetic profile, a collection of tags that tell genes whether to be on or off, is the sum of the signals it has received during its lifetime. Some epigenetic marks inhibit genes by inducing tight folding of chromatin, which is DNA mixed with histones and other proteins, and thus keeping genes from being read. Methyl groups sometimes play that ... Get more on HelpWriting.net ...
  • 26.
  • 27. Based on the Plant Biology Journal entitled “Gene... Based on the Plant Biology Journal entitled "Gene discovery in the wood–forming tissues of poplar: Analysis of 5,692 expressed sequence tags", by Sterky et al., 1998, expressed sequence tags (EST) database was prepared with specific procedure. First of all, EST can be defined as a short fragments sequence, range from 100 bp– 1000 bp. It derived from a c DNA clone which represents the expressed genes sequence. Usually, ESTs are used to identify the full length genes and serves as a target for mapping with providing important evidence in the ORF for confirmation as it is organised into libraries (Ganten et al., 2006). In order to improve the value of EST, few steps of preparing EST database should be encounter with pre–processing, ... Show more content on Helpwriting.net ... The ESTs database was prepared by constructing cDNA libraries from the sample at first, which are from the stem tissue of actively growing trees of P. tremula L.× tremuloides Michx. The cambial–region EST library was prepared from developing xylem tissue, developing and mature phloem and cambial meristem tissue. The cDNA library was prepared from λgt22a by using Superscript Lambda System for cDNA synthesis and cloning and packaged into λ particles with the Gigapack II Gold. λ DNA was isolated form an aliquot of the cDNA library representing 200,000 clones, and the cDNA inserts were isolated and ligated into pBluescript SK. Bacterial clones of the cambial–region from cDNA library were randomly picked, suspended in 100 µl of Tris/EDTA buffer, lysed and stored at –22 ºC until further analysis. Sample from Populus trichocarpa 'Trichobel' was prepared for a developing–xylem library where cDNA was extracted from the mRNA to clone into λZAPII vector. Meanwhile, the plasmid clones of individual phages were obtained by in vivo excision (Sterky et al., 1998). Next step involve DNA sequencing of the cambial–region cDNA inserts. It was performed using PCR products as templates from the 59 end. Microtiter plates were loaded onto a robotic worktable. This worktable is the place where the PCRs, quality control and sequencing reactions performed automatically. How do PCRs performed? By using general vector primers and standard PCR controls ... Get more on HelpWriting.net ...
  • 28.
  • 29. Analysis Of The Movie ' 12 Years ' A Slave ' In 12 Years A Slave (2013), directed by Steve McQueen, the audience is provided with an understanding of characters, place and main character's experience through mise–en–scene and cinematography. 12 Years a Slave surrounds a black man named Solomon Northup, who was sold into slavery in the 1850's. It is a graphic retelling of a slave's existence in Louisiana. The specific sequence used for analysis is one where Northup attempts to escape, but stumbles upon a lynching ritual. By use of cinematography and mise–en–scene, Steve McQueen allows the audience to view slavery in its every day format, and learn that this part of history was simply a reality. Characters Experience. Through mise–en–scene and cinematography, McQueen provides us with ... Show more content on Helpwriting.net ... Northup's expression as he immediately comes across the party, compared to the expression as he walks away, is key in understanding the thematic intention of the film. To start it is one of shock and fear, an immediate reaction to the ritual he fell upon. After the quick understanding of what is occurring, he makes eye contact with the men in the nooses. Their expressions are pained, there is no hope left, they are now only bodies primed for hanging. Solomon walks away from the bodies of the hanged slaves, his expression gradually changing from shock to acceptance. An understanding that this is common practice. The lighting develops this idea, as in this sequence it is entirely natural, and sun is beaming down on all characters. This suggests to the audience that this act of violence is not hidden, it isn't executed in the dark when there is lesser chance of being seen. it is a reality. Compare this with the scene of Solomon's own attempted lynching. While he is strung up by a noose struggling to survive, the slave children begin to play in the background. They are fully aware that he is there, however this form of violence is part of their life, it is not shocking. Through this we are made aware of the theme in the film– slavery, and the violence accompanied with it, was not shameful nor kept secret. Black people in this environment lived a life constantly plagued by the threat of a hanging noose. Character. The dynamics between characters are ... Get more on HelpWriting.net ...
  • 30.
  • 31. Epigenetics: A Comparative Analysis Of Cell Structure And... All cells in the body contain the same DNA sequence. Although all cells contain an identical DNA sequence, they all have different cell structures and functions. Each structure and function of the cell differs because the cell has specific use for or will only express certain genes. Genes in DNA are expressed when they are read and transcribed into RNA which then gets translated into proteins by ribosome structures. Proteins are used to determine a cells characteristics and functions. Inside of each cell the DNA as well as histones can be tagged by tiny chemicals that modify gene expression. These chemical tags have the responsibility that causes genes to be turned on or turned off. This causes genes to be expressed or silenced. The epigenome is a wrapped up package of DNA. ... Show more content on Helpwriting.net ... When chemical tags are labeled the modifications are called epigenetic modification. These can be classified as modifications that take place on or above the genes. Epigenetic modification permits lasting changes in gene expression. Epigenetics studies the changes in gene expression or development caused by mechanisms other than changes in the primary DNA sequence. Epigenetics demonstrates how DNA interacts with the multitude of smaller molecules found within cells which can activate and deactivate cells. Epigenetics can be highly based off of nature versus nurture. Epigenetic changes are a part of normal development. As genes are activated some are ... Get more on HelpWriting.net ...
  • 32.
  • 33. Importance Of Sequence Specific Primer PCR Sequence specific primer PCR With the advancement of sequencing technology, vast information on DNA sequences of many animal genomes has been developed (Goff et al. 2002; Yu et al. 2002). In order to correlate DNA sequence information with particular a phenotype of a trait, sequence–specific molecular marker techniques have been designed. Expressed sequence tags (EST) analysis is one such type. By adopting this method, Expressed sequence tags of many animal species have been created and these sequences are subjected as putative functional genes by using advanced bioinformatics tools. Allozyme markers Allozymes are allelic variants of proteins produced by a single gene locus, and are of interest as markers because polymorphism exists and ... Show more content on Helpwriting.net ... They usually exhibit simple Mendelian inheritance and codominant expression, making genetic interpretations easy. Disadvantages associated with allozymes include heterozygote deficiencies due to null (enzymatically inactive) alleles and the amount and quality of tissue samples required (Hillis et al., 1996). In addition, some changes in DNA sequence are masked at the protein level, reducing the level of detectable variation. Some changes in nucleotide sequence do not change the encoded polypeptide (silent substitutions), and some polypeptide changes do not alter the mobility of the protein in an electrophoretic gel (synonymous substitutions). Moreover, genetic variations caused by mutations are expressed as amino acid replacements due to changes in protein compositions, and are resolved as bands (alleles) on electrophoresis (DeYoung and Honeycutt, 2005). However, other limitations developed by allozymes are highly biased genomic sampling (only genes encoding well–documented, soluble proteins are detectable); a low number of markers, insufficient for examining major portions of the genome; occasional differences between tissues or ontogenetic stages; and difficulty in the standardization of experimental methods from laboratory to laboratory (DeYoung and Honeycutt, 2005). Low levels of genetic variation revealed in many allozyme studies of animal populations prompted a continued search for markers with greater genetic resolution. ... Get more on HelpWriting.net ...
  • 34.
  • 35. The Causes Of Sexual Orientation And Homosexuality Charles Darwin famously said, "We do not even in the least know the final cause of sexuality. The whole subject is hidden in darkness" (Ryu). Since the beginning of time, there have been questions revolving around the topic of sexual orientation. Within the past few decades, homosexuality is becoming more mainstream and socially acceptable as more people begin to examine their gender identity and sexual preferences. Scientists researched to determine the cause of sexual orientation; however, two opposing sides have formed around the issue: nature (inherited genes and biology) versus nurture (the environment). Proponents of nature argue sexual orientation is biological and genetic; whereas proponents of nurture argue sexual orientation is non–biological, environmental, and socially constructed. According to the American Psychological Association, sexual orientation is not a choice; instead "...it emerges from most people in early adolescence with no prior sexual experience" ("Answers to Your Questions About Sexual Orientation and Homosexuality"). Despite this, social theorists and other branches of scientists argue an individual's upbringing directly impacts their sexual orientation. Many proponents of nurture are religiously motivated to establish the morality behind sexual orientation. However, the purpose of this essay is to examine and develop a deeper understanding of the theories surrounding the cause of sexual orientation. When combining all four non–adaptive, ... Get more on HelpWriting.net ...
  • 36.
  • 37. Annotated Bibliography On The Landscape Of Transcription LANDSCAPE OF TRANSCRIPTION IN HUMAN CELLS INTRODUCTION The Encyclopedia of DNA Elements (ENCODE) is a project designed to compare and contrast the repertoire of RNAs produced by the human cells and cross verify with other methods like NGS. After a five year start–up since the beginning of the ENCODE project just 1% of the human genome has been observed and what was achieved was just the confirmation of the results of previous studies. RNA has functions of coding, regulation, decoding, and gene expression. RNA highlights the sequential output from genomes which gives the genetic information. They define the cells regulatory capabilities by their synthesis, translation, transport, processing, and modification. DNA, RNA and cellular ... Show more content on Helpwriting.net ... Cytosol and Nucleus) for 15 cell lines that were observed. This project also aims to evaluate the degree of modification of the identified transcript at their 3' and 5' termini in the predicament of polyadenylation or 7– methyl guanosine cap. A genes isoform expression limits the boundary of minimalistic expression strategy which results in general behavior of genes to express simultaneous multiple isoforms. The results of gene expression range nearly at ten to twelve expressed isoforms for every gene in every cell line. This study shows that 6% of the entire annotated non–coding and coding gene transcripts are overlapping with small RNAs. Highly specific subcellular positioning is found for both unannotated & annotated short RNA. METHODS In this paper, the necessary RNA data set was generated by subcellular fractionation of the 15 cell lines considered to analyse the human transcriptome. Thus isolated RNAs were classified into two categories long (>200 nucleotides) and short (<200 nucleotides) and the long transcripts were further separated into polyadenylated and non–polyadenylated transcripts. Data set Generation The procedure followed for data set generation in this paper is mentioned below: 15 cell lines were acquired for the purpose of this experiment. Process of subcellular compartment fractionation was performed on these cell lines, this included complete cells, nucleus and cytosol (seen in ... Get more on HelpWriting.net ...
  • 38.
  • 39. The Importance Of Green Fluorescent Protein In the 1960's, Green Fluorescent Protein was discovered to be responsible for Aequorea victoria's fluorescence under UV light (Niwa et al., 1996). Today, GFP is often used in protein tagging and has made it possible for scientists to study expression and track proteins in vivo. With the rising importance of GFP fusion proteins and other recombinant vectors, the metal affinity of Histidine helps to make the protein purification process easier (Lilius et al., 1991). His tags are commonly used to purify proteins through immobilized metal–affinity chromatography (IMAC) (Lilius et al., 1991). This rapid and efficient method separates the recombinant protein from unwanted products such as RNA. The His tag DNA sequence is inserted into the ... Show more content on Helpwriting.net ... It is of strong interest to molecular biologists because of the strong light emission of 508 nm under UV light. UV wavelengths excite the fluorophore, contained in the Ser – Tyr – Gly sequence near GFP's N–terminus, and a bright green fluorescence is given off as a result (Niwa et al., 1996). GFP can be successfully tagged to many proteins without disturbing their function (Feilmeier et al., 2000). This allows scientists to exploit the protein for its usefulness in marking proteins in vivo. GFP tagging has many applications. It can be used to study gene expression by inserting gfp after a promotor in the plasmid, so that if expressed, the colony expressing the gene of interest can be identified by a green fluorescence of GFP under UV light (Feilmeier et al., 2000). Specific cellular organelles can be tagged, such as the endoplasmic reticulum, to visualize protein localization and networking inside the living cell. GFP can also be used to monitor cofactor levels within a cell in real time. For example, when GFP was tagged to proteins that contain a receptor sensitive to Ca2+, they interacted in a way so that the fluorescence of the fusion protein was proportional to the calcium ion concentration with less than a 1 second lag in the cell (Romoser et al., 1997). Throughout the decades, GFP mutants have been created to give brighter emission and different wavelengths. Researchers can track separate cell pathways at the same time, since different proteins can ... Get more on HelpWriting.net ...
  • 40.
  • 41. The Contributions Of DNA Sequences : DNA Is Not Destiny DNA is Not Destiny Deoxyribonucleic Acid (DNA) is made up of nucleotides which contain three parts: a phosphate group, a sugar group, and one of four types of nitrogen bases. DNA then forms a double helix, with alternating phosphate and sugar groups linked to a chain of nucleotides. DNA is important because it gives instructions to an organism on how to develop, survive, and reproduce through DNA sequences. These sequences contain instructions on how to make proteins, which are complex molecules that do most of the work in the human body. DNA Sequences that contain instructions on how to make proteins are genes which also determine physical traits. The complete DNA instruction book, or genome, for a human, contains about three billion ... Show more content on Helpwriting.net ... The scientific studies conducted for epigenetics have given light and has helped disprove a common fact that DNA is a person's destiny. A person's destiny is instead due to multiple factors. These factors range from the mother's diet during pregnancy to the person's lifestyle (Watters 33). An experiment conducted by Randy Jirtle, a professor at Duke University, has proven the mother's diet during pregnancy has a profound impact on child's epigenome. The experiment took mice that have the agouti gene and bred them. Typically, the child would have the agouti gene like the parents, which would make them yellow, fat, and prone to diseases, but it did not. The offspring did not phonetically posses the agouti gene but were slender brown mice. This was due to the mother's rich diet of methyl foods rich during pregnancy which altered the epigenome and phonetically turned off the agouti gene (Watters 33). These methyl–rich foods are the type of victims usually found in the victim's pills pregnant woman take so this data can be applied to humans like most mice experiments and results from them. Scientists have conducted other studies and have found that identical twins having the same DNA can be drastically different by the time they are twenty years old due to their different experiences in life (Fraga, Mario F., et al). Epigenetics marks are affected by experiences a ... Get more on HelpWriting.net ...
  • 42.
  • 43. The Encyclopedia Of Dna Elements INTRODUCTION The Encyclopedia of DNA Elements (ENCODE) is a project designed to compare and contrast the repertoire of RNAs produced by the human cells and cross verify with other methods like NGS. After a five year start–up since the beginning of the ENCODE project just 1% of the human genome has been observed and what was achieved was just the confirmation of the results of previous studies. RNA has functions of coding, regulation, decoding, and gene expression. RNA highlights the sequential output from genomes which gives the genetic information. They define the cells regulatory capabilities by their synthesis, translation, transport, processing, and modification. DNA, RNA and cellular proteins are the three most essential ... Show more content on Helpwriting.net ... Cytosol and Nucleus) for 15 cell lines that were observed. This project also aims to evaluate the degree of modification of the identified transcript at their 3' and 5' termini in the predicament of polyadenylation or 7– methyl guanosine cap. A genes isoform expression limits the boundary of minimalistic expression strategy which results in general behavior of genes to express simultaneous multiple isoforms. The results of gene expression range nearly at ten to twelve expressed isoforms for every gene in every cell line. This study shows that 6% of the entire annotated non–coding and coding gene transcripts are overlapping with small RNAs. Highly specific subcellular positioning is found for both unannotated & annotated short RNA. METHODS In this paper, the necessary RNA data set was generated by subcellular fractionation of the 15 cell lines considered to analyse the human transcriptome. Thus isolated RNAs were classified into two categories long (>200 nucleotides) and short (<200 nucleotides) and the long transcripts were further separated into polyadenylated and non–polyadenylated transcripts. Data set Generation The procedure followed for data set generation in this paper is mentioned below: 15 cell lines were acquired for the purpose of this experiment. Process of subcellular compartment fractionation was performed on these cell lines, this included complete cells, nucleus and cytosol (seen in Table 1). The process of fractionation ... Get more on HelpWriting.net ...
  • 44.
  • 45. Research on the Expressed Sequence Tag of Olives Essay Introduction Olive, or scientific name Olea europaea L which belongs to Oleacea family is a valuable plant species where it can produce oil and table olives. Gene at certain tissue in species will be expressed where cDNA are sequenced to produce expressed sequence tag (EST) library. EST database is beneficial as it allows new gene discovery, marker discovery, gene mapping, and functional studies to be carried out. This research has contributed EST library of 2304 clone sequences from the young olive leaf and 1536 clone sequences from the immature olive fruit for Turkish olive cultivar Gemlik. Good quality ESTs are used to further analysed by using Phred–Phrap and Contig Assembly Program 3 (CAP3) software. They were then submitted to ... Show more content on Helpwriting.net ... EST sequences with vector sequence were edited using Phrap "cross–match" application. Contig Assembly Program 3 (Cap3) was used to assemble the sequences obtained from sequencing for analysis while Consed/Autofinish software was used to control the sequence assembly. All sequences were assembled separately into contigs. BLAST of sequences was conducted to determine the gene homology in order to connect their functions. Unique sequences were analysed for biological characteristics as well as functional annotation using program BLAST2GO. New genes can then be identified eventually. Results Two cDNA libraries were established from olive leaf and fruit, with 2304 clones and 1536 clones respectively. A total of 3840 EST sequences was generated from the two cDNA libraries. 106 low–quality EST sequences were removed by using Phred software. 3734 EST sequences with vector sequence were edited using Phrap "cross–match" application. EST sequences and 1506 high quality fruit EST sequences were assembled using Contig Assembly Program 3 (Cap3) to assemble the sequences separately into contigs. Consequently, homolog genes which were consensus EST sequences in GenBank can then be obtained. 2228 leaf EST sequences were assembled into 205 contigs, length ranged from 514 bases to 1924 bases. 1506 fruit EST sequences were assembled into 69 contigs, length ranged from 461 bases to 1909 bases. The two libraries were then assembled to obtain 299 ... Get more on HelpWriting.net ...
  • 46.
  • 47. Glutathione's Transferase Lab Report Glutathione–S–Transferase (GST) is a detoxification enzyme which transfer glutathione to toxic substance and can be used as a tag when fused to a protein of interest. The purpose of this experiment was for us to determine which culture (A and B) was treated with Isopropyl B–D–thiogalactoside (IPTG) and therefore would express GST. The bacteria E. coli BL21 carrying the pGEX–2T plasmid was used to express GST protein after which protein extraction and GST purification from other proteins where done. GST expression is controlled by the Lac operon promoter (Plac). The Lac promoter sequence drives GST gene expression (transcription) and the lac repressor gene encodes a protein that represses the lac promoter. When the lac repressor gene is always ... Show more content on Helpwriting.net ... On our SDS–PAGE, our protein standards were separated alongside our protein samples which allowed determination of the sizes of our protein in our sample. SDS denature proteins and coats them with a negative charge allowing for their electrophoretic separation by polyacrylamide gel electrophoresis (PAGE). As you can see, after being stained with the coomassie blue, we could detect proteins of various sizes and our unknown protein expressing GST was detected in our Pure B sample (Figure 2). The distance travelled from the wells on the SDS–PAGES by our protein standards were measured and compared to our protein ladder in Daltons (Table 2), from which we could construct our semi log plot. On the semi–log plot, our unknown protein within our Pure B travelled 27mm from the well with a size of 29,000 Dalton (Figure 3). To identify the specific protein in the gel, the western blotting method was used to detect which of the cultures (A or B) contains GST (Figure 4). After the cassette was taken out of the electrophoresis unit, colors of our protein standards appeared on top of our membrane surface. After blocking, primary antibody incubation, and secondary antibody incubation, we could clearly identify our GST in our Pure B and Crude B (Figure ... Get more on HelpWriting.net ...
  • 48.
  • 49. Genetic Dna And Bioinformatics ( Accession No. Xp Essay RESULTS Isolation of BbovM17LAP gene The BbM17LAP gene available in GenBank (accession no. XP_001609968) was accessed through the National Center for Biotechnology Information (NCBI), and its sequence was retrieved for further analysis. The genomic DNA of BbM17LAP was found in chromosome 2, extending between 1,045,409 bp and 1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding BbM17LAP consists of 1,578 bp. Alignment of the mRNA sequence with genomic DNA using Genetyx revealed that the gene has 4 introns within its ORF. The first one was a 33– bp intron (50–ggtatgtttgtttgaatactgctgaatctgtgta–30) situated near the 50 end of the gene. The other nucleotide sequences included a 35–bp (50–agatacttacagtaacgatacaagttcatgtaggt–30) intron, a 34–bp (50–tgggttacactctttatgctatatttgttatagg–30) intron, and a 40–bp (50– gtaagttaattgggctacaagaagcgtaatatacatacag–30) intron all located close to each other near the 30 end. Isolation of BbovM17LAP cDNA and bioinformatics analysis A pair of primers targeting the ORF of BbM17LAP was used to amplify and sequence the gene from a B. bovis cDNA expression library. This BbM17LAP cDNA encoded a predicted 55–kDa protein without a signal peptide. The translated BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP, having 71% amino acid identity and similarity (E value¼0). The other significant homologues included Theileria parva and Theileria annulata M17 LAPs, both having 61% amino acid identities. The polypeptide ... Get more on HelpWriting.net ...
  • 50.
  • 51. Protein Chromatography Lab Report During this experiment the His–tagged protein RNase H was purified using affinity chromatography. The source of over–expressed His–tagged RNase H used was 5.0 mL of E. coli lysate. The experiment was performed in partners using different materials in order to prepare the needed three buffers to an approximate pH value of 7.9. Once the three buffers were ready a minicolumn was packed with 0.5 mL of Ni–NTA agarose and then different solutions were used to wash the column, starting with DI water, followed by the loading buffer, then the E.coli lysate, the washing buffer, and finally the eluting buffer. Some of the flows through were collected for future analysis in the upcoming experiments. The first was after the washing with the E.coli lysate, then the first wash from the washing buffer, and finally the flow through obtained after the wash with the eluting buffer. ... Show more content on Helpwriting.net ... They are key constituents of all biological systems, and perform a great variety of functional and structural roles. Proteins play a crucial role in almost all biological processes, like signal transmission, catalysis, and structural support. This important range of functions comes from the existence of thousands of proteins, which are each folded into a characteristics three–dimensional structure, the same structure that allows it to interact with one or perhaps more molecules. A lot of the functional and structural studies of proteins are conducted with purified preparations of proteins. In general the purification methods of proteins aim to exploit the differences in their different properties such as, solubility, size, charge, and resin–binding specificity, all with the purpose to enrich the solution for the targeted protein ... Get more on HelpWriting.net ...
  • 52.
  • 53. Phaeodactylum Tricornutum Essay Phaeodactylum tricornutum is a species of diatom: a eukaryotic, unicellular, photosynthetic organism (a result of secondary endosymbiosis) that produces a silicified cell wall. P. tricornutum was chosen to be the second diatom to have its full genome sequenced because it had already been studied for decades and there were substantial genetic resources, including more than 100 000 expressed sequence tags (ESTs), available for it. As a model system, P. Tricornutum is small, reproduces asexually with no loss in size and is easy to culture. In fact, the clone that was sequenced was taken from a monoclonal culture, which came from a strain isolated in 1956 and continually maintained in F/2 medium. Its genome is approximately 27.4 megabases in size, ... Get more on HelpWriting.net ...
  • 54.
  • 55. Essay On Proteolytic Degradation Tagss Results and Discussion Multiple synthetic amino acid sequence tags target fluorescent proteins for degradation by different proteases. To study proteolytic degradation by different proteases, fluorescent proteins were engineered with different potential degradation tags on either the N–terminus or C–terminus (Table S2). Previously tested degradation tags could not be compared directly to one another because they were characterized in different E. coli strains and under different conditions. To our knowledge, this is the first systematic investigation of multiple degradation tags in E. coli. We tested the previously determined degradation tags and several newly designed tags (Table 1A–B). Degradation tags were fused to multiple fluorescent ... Show more content on Helpwriting.net ... The fluorescence of RepA70–YFP increased as more RepA70–CFP was produced (Fig. 3C), and this indicated that ClpAP protease could be overloaded and a proteolytic–queue forms similar to what was observed with the LAA tagged proteins targeted to ClpXP8. We also tested two other tags, MarA and MarAn20 (20 amino acids from the N–terminal of MarA), which target proteins to be degraded by the Lon protease. The Lon protease was weakly overloaded by MarA tagged proteins but was overloaded more by MarAn20 tagged proteins (Fig. 3C–D). This made us wonder if Lon could be overloaded when both MarA and MarAn20 were co–produced. Indeed, this was the case (Fig. 3E). The main proteases of E. coli can exhibit different levels of crosstalk depending on the degradation tags used. We have demonstrated that ClpXP, ClpAP, and Lon can be overloaded using two proteins engineered with identical degradation tags targeted for a specific protease. We have hypothesized that crosstalk between proteases may occur through shared information (Fig. 1B). To test this hypothesis in a synthetic system, we monitored the level of a fluorescent protein (YFP) targeted to one protease while producing another protein (CFP) targeted to a different protease. There was strong crosstalk when proteins with the LAA degradation tag (target to ClpXP) were co–produced with proteins with all other tags (RepA70, MarA, MarAn20, and HipB; Fig. ... Get more on HelpWriting.net ...
  • 56.
  • 57. Module6LabAnswerSheet RANKOW Essay ******************************************************************************************** NAME: HEATHER M. RANKOW Answer Sheet–Module 6 Lab Gene Expression View the following animation about gene switches: http://www.hhmi.org/biointeractive/gene–switch 1. What does the yellow part of the DNA represent? The yellow part of the DNA is use for coding. It only expressed if RNApolymerase lands on gene's promotor and makes mRNA from the gene. 2. What does the pink part of the DNA represent? The DNA promoter 3. What needs to land on the pink part in order for the gene to be expressed? RNA Polymerase 4. What do the blue, red and green parts of the DNA represent? Regulator switches 5. What are the functions of the blue, red, and green ... Show more content on Helpwriting.net ... It becomes tightly wound and the genes are inaccessible. b. What happens to the amount of GFP mRNA? It reduces, there is almost none left. c. What happens to the amount of green fluorescent protein? It also reduces. d. What happens to the appearance of the cell? It becomes faded with a faint green color. 3. Click on the Labels button near the control knob to reveal the following three links that reveal information when clicked. Summarize the function of each: a. a. histone – these are a type of protein that help to organize the DNA. There are 8 histones that make up one group. Each have tails that are covered with chemical tags and stick out of the protein grouping. The chemical tags on the tails affect how they interact with DNA. b. b. methyl tag – these are used to either keep genes silent or turn them off. They are added to a cytosine in any sequence of CG sequence of Nucleotides. They can turn off or silence the gene in two ways: (1) by blocking transcription or (2) by recruiting proteins that bind to methylated DNA, which then also block transcription machinery from binding to the active site. c. c. acetyl tag – these tags occur near active genes. It allows for the activity between the histones and DNA to relax making the DNA accessible. These tags are added to the amino acid lysine on the tails of histone proteins. It is one of the many tags that make up the histone code. 4. Click on Insights from Identical Twins and then view the video Identical Twins: ... Get more on HelpWriting.net ...