1. Materials
Table 1. Primer names and sequences used in this plasmid
construction.
Discussion
By utilizing this constructed plasmid, the adenylate cyclase gene
should be knocked out via homologous recombination. In that, the
two complementary sequences should loosely bind to each other
and switch the adenylate cyclase sequence with that of the Trp
marker gene so that the Trp gene replaces the adenylate cyclase
gene within the genome (Figure 2). Because the S. commune host
strain is deficient in tryptophan synthesis, the individuals where
adenylate cyclase has been knocked out should be the only ones
able to survive on media without tryptophan if adenylate cyclase is
not essential.
A ku80 knockout strain of S. commune will be used in this
experiment, and this should increase the likelihood of homologous
recombination significantly among transformants. This is because
the Ku80 subunit of the enzyme that catalyzes non-homologous
end joining of DNA is absent from the organism.
Construction of a Plasmid for the Knockout of Adenylate
Cyclase in Schizophyllum commune,
a Mushroom-Forming Fungus
Introduction
Schizophyllum commune is a tree rotting basidiomycete
mushroom-forming fungus. Because S. commune is one of the rare
organisms which have the enzymes to degrade the lignin present in
the cell walls of trees and other plants, it is useful to understand S.
commune’s signaling pathways for use of the fungus in the pulp
industry and perhaps in bioremediation.1 This fungus is also closely
related to pathogenic fungi such as Ustilago maydis2 and edible
mushroom.3 Therefore, by understanding the signaling pathways of
S. commune, we may gain a better insight to the medical and farming
aspects of basidomycetes.
Cyclic adenosine monophosphate (cAMP) is produced by
adenylate cyclase from ATP. cAMP is involved in the activation of
cAMP- dependent protein kinase A3 and regulates lignin degrading
enzymes like lignin peroxidase or manganese peroxidase in S.
commune.2 However, much of how cAMP is regulated and the
pathways it affects are unknown in this particular fungus. Through
homologous recombination via a constructed plasmid, knockout of
the adenylate cyclase gene may shed some light on pathways in
which adenylate cyclase and cAMP are involved.
Methods
In order to amplify the flanking regions to clone into the
plasmid, primers were designed from the noncoding regions between
the adenylate cyclase gene and surrounding genes. These primers
were then used for a PCR amplification of the genomic or template
DNA which produce the desired flanks.
The vector plasmid pRLS1013 was cut with restriction
enzymes to linearize it. Phosphatase was then added in order to
cleave the phosphate groups of the ends of the vector. This prevented
the vector from circularizing on itself or repairing itself and
becoming a circularized plasmid as before. When the flank (cut by
the same restriction enzyme) and the vector are put together in a
ligation reaction, the two molecules bound together at the ends.
Ligase, in this reaction, fixed the nicks in the DNA between the
vector plasmid and the flank.
This insert was then transformed into competent bacterial cells
via a heat shock transformation. Once this was achieved, a DNA
isolation was done from these cells to isolate the plasmid from the
cells. The new plasmid was then be used to insert the second flank.
As before but with different restriction enzymes, this plasmid was
ligated and then transformed into competent bacterial cells in order to
obtain the desired plasmid for the knockout of adenylate cyclase via
homologous recombination.
GEF
GAP1
AC
ATP cAMP
Lip/Mnp
cAMP
cAMP
PKA
PDE
Gα
Gα
Gϒ
Gβ
G protein
receptor
GAP1
RAS
(GDP)
RAS
(GTP)
Primers Primer Sequence
111107-1 TTTTCTAGAGCGGCCGCTGCTCGCAG
111107-2 TTTTCTAGATTGCCGCAGATTCGCGT
111107-3 TTTAGATCTTGCATCTCCAGCAAGTC
111107-4 TTTGGATCCAACTTCACCAAATTCGC
090427-3 ACGAGGGTCATGCATATCGGA
Primers were ordered from IDT (Coralville, IA). The first four were used in a
PCR to obtain Flank 1 and Flank 2, and the last three were used to confirm
that the insert was in the plasmid in the correct direction.
Restriction enzymes were manufactured at New England BioLabs (NEB)
and were used to create complementary ends in the vector and flank being
ligated.
T4 ligase (NEB) was used to covalently link the sugar- phosphate
backbones of the vector and flank involved in the ligation reaction.
PCR enzyme LongAmp Taq DNA polymerase was used in all PCRs.
All enzymatic reactions that were done with NEB buffers according to
manufacturer’s instruction.
Schizophyllum commune H4-8 strain was used as the template DNA for
PCR.
Bacterial cells used were NEB DH5-α competent E. coli strain.
Results
Flank1 Flank2Trp1
Adenylate Cyclase
Figure 1. An illustration of the cAMP signaling pathway that has
been studied or suggested in the literature in the organism S.
commune.1,2,3,4
Figure 2. Illustration of how the homologous recombination should theoretically
work so that the adenylate cyclase is knocked out and the Trp1 gene is inserted into
the genome in its place.
*
Figure 4. The gel electrophoresis illustrates the
size of the flanks obtained in the PCR. The gel
on the left depicts Flank 1 at about 1kb in size,
and the gel on the right illustrates that Flank 2
is approximately 1.2 kb in size.
Figure 3. A theoretical
representation of the plasmid
construct which should produce an
adenylate cyclase knockout of S.
commune (BVTech Plasmid).
1kb
10kb
2 kb
1kb
1.5 kb
10 kb
Figure 7. A gel electrophoresis
of a BamHI and BglII
restriction digest. This was
done to determine which of the
potential inserts were in the
correct orientation based on the
number of detectable bands.
The asterisk denotes the
plasmid with the correct
orientation because the
different size bands indicate
that the plasmid was cut at the
cut sites expected had Flank 2
been in the correct direction
and not by an additional site in
the center of these cut expected
sites if in the other direction.
*
Figure 8. Illustration of the final
confirmation that the insert was in
the correct orientation. This was
done via two PCRs: one using
090427-3 and 111107-3 primers
(lane 2) and another using 090427-
3 and 111107-4 primers (lane 3).
Lane 3 is consistent with the size
of the DNA between the primers
that would be expected to be
amplified; whereas, lane 2
illustrates random complementary
pieces that were amplified.
References
[1] Yamagishi, Kenji et al., Identification and Overexpression of genes
encoding cAMP-Dependent Protein Kinase Catalytic Subunits in Homobasidiomycete
Schizophyllum commune. 2005. Biosci. Biotechnol. Biochem. 69(12) 2333-2342.
[2] Yamagishi, Kenji et al., 2004. Elevation of Intracellular cAMP Levels by
Dominant Active Heterotrimeric G Protein Alpha Subunits ScGP-A and ScGP-C in
Homobasidiomycete, Schizophyllum commune. Biosci. Biotechnol. Biochem. 68(5).
1017-1026
[3] Palmer, Gail E. and Horton, J. Stephen., Mushrooms by magic: making
connections between signal transduction and fruiting body development in the
basidiomycete fungus Schizophyllum commune. 2006. FEMS Microbiol Lett. 262. 1-
8.
[4] Kinoshita, Hideki et al., Effects of indole and caffeine on cAMP in the
ind1 and cfn1 mutant strains of Schizophyllum commune during sexual development.
2002. FEMS Microbioogy Letters. 206. 247-251.
Kelly Thompson
Figure 5 and 6. An example of S. commune fruiting bodies in nature.
M F1 F1 M F2
M V
M 2 3
10 kb
6 kb
3 kb
1 kb
10 kb
1.5 kb
1 kb
0.5 kb
http://flickrhivemind.net/Tags/schizophyllum/Interesting http://www.pilze-augsburg.de/berichte/2008_03_15_haltenberg/
Adenylate Cyclase Knockout Plasmid
*