This study aimed to characterize Staphylococcus aureus and detect the tst1 gene from clinical and food samples in Silchar, India. A total of 96 samples were collected, of which 42 were clinical and 54 were food. S. aureus was isolated from 34 clinical samples and 18 food samples using biochemical tests. The isolates showed high resistance to erythromycin but sensitivity to vancomycin and teicoplanin. Polymerase chain reaction detected the tst1 gene in 34 clinical and 18 food isolates. This study demonstrates the presence of virulent S. aureus strains in foods in Silchar that can potentially cause toxic shock syndrome.
The Indian Dental Academy is the Leader in continuing dental education , training dentists in all aspects of dentistry and
offering a wide range of dental certified courses in different formats.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri ...Scientific Review SR
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a
challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate
Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44
were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different
and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42)
tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with
highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes
(MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1
and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by
most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With
over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and
might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the
nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri M...Scientific Review
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44 were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42) tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes (MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1 and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
The Indian Dental Academy is the Leader in continuing dental education , training dentists in all aspects of dentistry and
offering a wide range of dental certified courses in different formats.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri ...Scientific Review SR
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a
challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate
Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44
were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different
and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42)
tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with
highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes
(MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1
and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by
most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With
over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and
might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the
nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
Multidrug Resistance Pattern of Staphylococcus Aureus Isolates in Maiduguri M...Scientific Review
Multi drug-resistant (MDR) isolates of Staphylococcus aureus are on rise and are becoming a challenge for timely and appropriate treatment. The present study was carried out with an objective to isolate Staphylococcus aureus from clinical samples and determine their sensitivity. Out of 110 samples collected, 44 were shown to contained S. aureus. The isolates were subjected to antibiotic sensitivity tests using 10 different and commonly used antibiotics by modified Kirby- Bauer disc diffusion technique. Out of the total isolates (42) tested, only 7.1% were susceptible to all the antibiotics. Multiple resistance was eminent in over 92% with highest occurrence in 4.8% where the entire antibiotics were resisted. Multiple antibiotic resistance indixes (MAR index) indicated that 0.6 index occurred most (23.8%) followed by 0.5 (19.0%). On the other hand, 0.1 and 0.8 indexes were the lowest with 0.0% and 1.0% occurrence respectively. Ciprofloxacin was resisted by most of the organisms (64.3%) while amoxicillin (64.3%) and streptomycin (61.9%) were most efficacious. With over 90% isolate having MAR index ≥ 0.2, the multiple drug resistance by the S. aureus is quite alarming and might suggest inappropriate antibiotic usage by the sampled population. Therefore, the need to strategize the nature of antibiotic treatment against S. aureus and massive campaign on indiscriminate antibiotic use is urgent.
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
Incidence rate of multidrug-resistant organisms in a tertiary care hospital, ...Apollo Hospitals
Antimicrobial resistance to microorganisms is a growing public health concern globally, especially in developing countries. This study was conducted to study the incidence rate of multidrug-resistant organisms with their antibiotic sensitivity pattern.
ISOLATION, IDENTIFICATION, AND DETERMINATION OF THE ANTIBIOTIC SUSCEPTIBILITY...Raphael Mwalimu
This study involved isolating, identifying, and determining the susceptibility patterns of bacteria from diabetic patients who were hospitalized for diabetic foot ulcers.
Methods: The specimen was collected using a deep swabbing approach from the feet of forty hospitalized patients with diabetes. The two sample swabs were delivered to the microbiology laboratory as soon as they were collected. One swab was used for microscopic examinations, and the other was utilized for culture. Three aseptically prepared agars – chocolate, MacConkey, and sheep blood were used for culture. In accordance with accepted clinical standards, the pathogens were identified. By performing the Kirby–Bauer disc diffusion method on Mueller–Hinton Agar medium, the isolates’ antibiotic sensitivity patterns were examined.
Results: Twenty-five patients had microorganisms in their foot ulcers, whereas 15 patients had sterile samples (no pathological growth). Gram-negative (10) and positive (15) bacteria were recovered, with some patients having both types. Pseudomonas aeruginosa (32%), Klebsiella species (8%), and methicillin-resistant (10), sensitive (2), and coagulase-negative (3) strains of Staphylococcus aureus were identified.
Conclusion: Imipenem was the antibiotic most sensitive to almost all of the isolates, whereas Penicillin G had more resistance to all of the isolates, and the other antibiotics had more variation. Our findings lead us to recommend that patients with diabetes be empirically given imipenem.
ABSTRACT- This study was an attempt to estimate the prevalence of Antimicrobial resistance in patients attending the OPD and IPD of IIMS&R, hospital, Lucknow. Total 453 urine samples were included in this study. Urinary isolates from symptomatic UTI cases were identified by conventional methods. Of the 453 processed samples 166 samples showed significant colony count of pathogens among which the most prevalent were E. coli (49.39%) followed by Klebsiella species (7.83%). The majority of the isolates were from female (68.67%) while the remaining was from male (31.32%). Dysuria was the most common clinical presentation followed by fever and abdominal pain. Diabetes and urogenital instrumentation were the major risk factors for UTI. Among the 166 urine samples which showed significant colony count, 152 (91.56%) of specimen showed pus cells in wet film examination. Among the gram-negative enteric bacilli high prevalence of resistance was observed against Ampicillin, Cefotaxime, Ciprofloxacin, Nalidixic acid and co-trimoxazole. 44% of isolates were detected to produce ESBL among the gram negative bacteria. Carbapenemase production was seen in 13 (11.71%) isolates. Among the 32 Enterococcus isolates 14 (43.75%) were resistant to High level Gentamicin, 2 (6.25%) were resistant to High level Streptomycin while 12 (37.50%) of isolates were resistant to both of the antimicrobial drugs. Among the 16 Staphylococcus species, 8 (50%) were MRSA.
KEYWORDS- MRSA, Antimicrobial resistance, UTI, ESBL, Gram-negative bacteria
Comparative Study of the Prevalence and Antibiogram of Bacterial Isolates fro...iosrjce
The study compared the prevalence and antibiogram of bacterial isolates from the urinary and
genital tracts of pregnant women attending ante-natal clinics in Imo State. Urine and High vaginal swab (HVS)
samples were collected from across the three geopolitical zones of Imo State (Owerri, Orlu and Okigwe).
Federal Medical Centre (FMC) Owerri, Imo State University Teaching Hospital (IMSUTH) Orlu and General
Hospital Okigwe (GHO) were used as focal points. A total of 1197 samples were obtained from women and
used. Infection was significantly more with the urine samples than the HVS samples (P < 0.05) while
polymicrobial growth was more observed with the HVS samples. Escherichia coli was the predominantly
isolated organism (38.3%) from the urine samples while Staphylococcus aureus (29.1%) was the predominant
bacterial isolates in HVS. Other commonly isolated bacterial species include; Enterococcus faecalis and
Staphylococcus epidermidis, Klebsiella pneumoniae, Proteus mirabilis and Bacteriodes were solely isolated
from urine while Lactobacillus was solely isolated from HVS. Overall antibiogram showed ciprofloxacin to be
the most effective antibiotic followed by nalidixic acid and pefloxac in for both specimens. Generally, multidrug
resistance was more in urine isolates (55.7%) than vaginal isolates (53.6%) with many showing the same
resistance patterns. The rate of multi/drug resistance in both samples is high (>50%) and worrisome. These call
for routine HVS as well as urine culture to be carried out on all antenatal women to ensure holistic antenatal care/ management.
SALMONELLA ARIZOANE: AN UNCOMMON UROPATHOGEN?Nuhu Tanko
Salmonella arizonae is usually an uncommon uropathogen from many studies. But from this study, it was the second most prevalent uropathogen after E.coli.
Abstract—The aim of the study was to observe the prevalence of various microorganisms from throat swab specimens in patients attending a tertiary care hospital at Chinakakani, Guntur. Throat swab specimens were collected aseptically from 100 patients and cultured on appropriate bacteriological media. Isolates were identified by biochemical tests & antimicrobial susceptibility performed by standard methods. Out of 100 Samples, culture was positive in 25 samples. So Bacterial infection was found in 25% of Pharyngitis. Streptococcus pyogenes was the commonest isolate, followed by Staphylococcus aureus and Candida albicans. Majority of bacteria were Streptococcus pyogenes, Staphylococcus aureus and Candida albicans. In 60% it was mixed infection. The susceptibility patterns varied depending on the drugs, but most of the organisms were susceptible to penicillin, erythromycin and vancomycin. Improved personal hygiene and health education of the masses on how to care for ear, nose and throat will greatly reduce these microbial infections. This study will be useful for control strategies and for predicting pathogen prevalence in throat swabs.
A cross sectional study on Bacteriological profile and antibiogram of cholecy...Innspub Net
Cholecystitis is the most common disease of gastro intestinal tract contributing for 10% disease burden. Most of the time it is infective in origin. In view of the emerging multi drug resistance organisms, there is a need for guidance in empirical antimicrobial therapy in every clinical setting. To study the bacteriological profile and their antimicrobial susceptibility pattern in cholecystitis and cholelithiasis patients. A cross sectional study was conducted at Mamatha General Hospital, Kammam over a period of 2 years from September 2010 to September 2012. A total number of 62 clinically diagnosed cases of cholecystitis and cholelithiasis subjected to elective cholecystectomy were included in the study. Bile and gall stone samples were collected and processed aerobically, anaerobically according to standard microbiological techniques. Antimicrobial susceptibility testing was performed on all isolates by Kirby-bauer disc diffusion method and susceptibility pattern were recorded. A total number of 62 cases of cholecystitis were included in the study shows female preponderance of disease. Maximum number of cases belongs to 41 to 50 years age group. Out of 62 patients 62 bile samples and 58 gall stones specimen were collected and analyzed. Bile culture was positive in 24 cholelithiasis cases (41.37%), Gallstone culture was positive in 9 cases (15.51%). The two bile samples yielded anaerobic growth. Escherichia coli was the predominant organism in both samples. Bacterial isolates showing maximum susceptibility to ampicillin-sulbactum (100%), amikacin (80%). To optimized empirical antimicrobial therapy in cholecystitis and cholelithiasis patients prior knowledge of the prevalence of various bacteria and their antimicrobial susceptibility pattern in is required.
Trends in Antibiotic Resistance of Vibrio Cholerae Isolates in Kenya (2006 - ...paperpublications3
Abstract: The evolution of antibiotic resistance was studied among revived Vibrio cholerae strains which were previously archived at -800c between 2006 and 2015. Antibiotic susceptibility testing (AST) on 12 antimicrobials; ampicillin (10µg), cefpodoxime (10 µg), ceftazidime (30 µg), cefotaxime (30 µg), amoxicillin- clavulanic acid (10/ 100 µg ratio) nalidixic acid (30 µg), tetracycline (30 µg), ciprofloxacin (10 µg), SXT (sulphamethoxazole -30 µg trimethoprim -5.2 µg), streptomycin (25 µg), gentamycin (10 µg) and chloramphenicol (30 µg) was carried out using Kirby-Bauer disc diffusion method. AST results revealed susceptibility to tetracycline, which is the drug of choice in Kenya administered as doxycycline during cholera outbreaks, among all isolates. Resistance to βeta-lactams and ciprofloxacin emerged in latter years while a decline in resistance to SXT, Chloramphenicol and Streptomycin was noted. This study gave a clear indication that there were changes in the resistance patterns whereby resistance to some antimicrobials declined and others emerged over the ten year period. In order to slow down the emergence and spread of resistance strains, care should be taken by health professionals when prescribing antimicrobials to patients suffering from cholera disease and should be restricted to only severe cases. It is also recommended that antimicrobial susceptibility testing should be done before giving antimicrobials in management of cholera cases.
Keywords: Antimicrobial resistance, Evolution, Kenya, Vibrio cholera.
Title: Trends in Antibiotic Resistance of Vibrio Cholerae Isolates in Kenya (2006 - 2015)
Author: Penina Muthoni Kung’u, Samuel Njoroge, John Kiiru, Paul Okemo, Samuel Kariuki
ISSN 2349-7823
International Journal of Recent Research in Life Sciences (IJRRLS)
Paper Publications
Richard's aventures in two entangled wonderlandsRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Multi-source connectivity as the driver of solar wind variability in the heli...Sérgio Sacani
The ambient solar wind that flls the heliosphere originates from multiple
sources in the solar corona and is highly structured. It is often described
as high-speed, relatively homogeneous, plasma streams from coronal
holes and slow-speed, highly variable, streams whose source regions are
under debate. A key goal of ESA/NASA’s Solar Orbiter mission is to identify
solar wind sources and understand what drives the complexity seen in the
heliosphere. By combining magnetic feld modelling and spectroscopic
techniques with high-resolution observations and measurements, we show
that the solar wind variability detected in situ by Solar Orbiter in March
2022 is driven by spatio-temporal changes in the magnetic connectivity to
multiple sources in the solar atmosphere. The magnetic feld footpoints
connected to the spacecraft moved from the boundaries of a coronal hole
to one active region (12961) and then across to another region (12957). This
is refected in the in situ measurements, which show the transition from fast
to highly Alfvénic then to slow solar wind that is disrupted by the arrival of
a coronal mass ejection. Our results describe solar wind variability at 0.5 au
but are applicable to near-Earth observatories.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
identification and characterization of Staphylococuss. aureus from ready to eat food samples and clinical sampls
1. Characterization of Staphylococcus aureus and assessment of tst1 gene
from different clinical and ready-to-eat food samples
UNDER THE SUPERVISON OF
DR. INDU SHARMA
ASSISTANT PROFESSOR
DEPARTMENT OF MICROBIOLOGY
ASSAM UNIVERSITY, SILCHAR
PRESENTED BY:
RUHELY NATH
ROLL: 041614 NO: 22180118
REGISTRATION NO: 18-140061953 OF
2015-2016
DEPARTMENT OF MICROBIOLOGY
ASSAM UNIVERSITY, SILCHAR
2. INTRODUCTION:
• What is Staphylococcus aureus?
Discovered in Aberdeen, Scotland in 1880 by the surgeon Sir Alexander Ogston in pus from surgical
abscesses.
How does S.aureus affect?
S.aureus is one of most common causes of infection which cause variety of manifestations, including
life-threating blood infections such as, (TSS) Toxic Shock Syndrome.
TOXIC SHOCK SYNDROME:
Toxic shock syndrome toxin 1 (TSST-1) is an exotoxin produced by Staphylococcus aureus . It is thought
to play a central role in the pathogenesis of toxic shock syndrome (TSS). TSS is a multi-system illness
characterized by fever, hypotension or shock, skin rash, desquamation of both hands and feet skin, and
multiorgan involvement
Staphylococcal TSS may manifest in two general forms, menstrual or non-menstrual.
The toxins multiply and spread into blood stream.
Infections usually occurs when bacteria enter your body through an opening in your skin such as a cut,
sore or other wound.
3. METHODS
1. COLLECTION OF SAMPLES
Coagulase slide test and coagulase tube test both are positive
for S.aureus ,because S.aureus known to produce coagulase
enzyme.
3. Microscopic observation:
Gram staining is done for all isolates
5. PHENOTYPICALLY CONFIRMATORY TEST FOR
S.aureus
6. ANTIBIOTIC SUSCEPTIBILITY TEST:
PCR screening were done for all the coagulase positive samples for
the detection of tst1 gene.
4. BIOCHEMICAL REACTIONS
2. ISOLATION & IDENTIFICATION OF CLINICALAND FOOD SPECIMENS
Disc diffusion method is used for isolates
7. PCR ASSAY:
TOTAL 96 SAMPLES
CLINICAL SAMPLE:42 Clinical samples were collected in sterile containers from community-acquired and private diagnostic laboratory(SRL Silchar)
FOOD SAMPLES: 54 samples were collected aseptically from different areas of Silchar city.
IMViC tests and rapid biochemical tests i.e., catalase &
oxidase were done for the isolates
4. OBJECTIVES OF THE PRESENT STUDY:
• Identification and biochemical characterization of Staphylococcus aureus
from clinical and ready to eat food samples.
• Antibiotic susceptibility test for coagulase positive Staphylococcus aureus.
• Detection of tst1 gene from isolates identified as Staphylococcus aureus.
6. Morphological characterization of the isolates:
MORPHOLOGICAL TEST RESULTS
GRAM SATINING
GRAM CHARACTERSTICS
GRAM POSITIVE
GRAM POSITIVE, PURPLE
COLOR, COCCI IN SHAPE
CULTURAL
CHARACTERSTICS
RESULTS
MANITOL SALT AGAR PLATES
BLOOD AGAR PLATES
Shape: circular
Elevation: convex
Size: large
Appearance: shinny
Pigmentation: golden yellow
Shape: circular
Elevation: pin head
Size: large
Appearance: shiny
Pigmentation: white creamy β
hemolysis
7. Biochemical characterization:
Biochemical test Results
Oxidase test negative
Catalase test positive
Indole production test negative
Methyl Red test positive
Voges Proskauer test positive
Citrate utilization test positive
Urease test positive
Triple Sugar (TSI) agar test A/A ; G(-), H2S(-ve)
Phonotypical confirmatory test for S.aureus:
Coagulase test results
Slide coagulase positive
Tube coagulase positive
9. Molecular characterization
• PCR ASSAY
• A genotype detection of tst1 gene was made by polymerase chain reaction for all the 96 test isolates. Among all the
isolates those 52 (34 clinical samples and 18 from food samples) phenotypically confirmed isolates of S.aureus were also
found to be tst1 gene positive 1 2 3 4 5 6 control
819 bp 800 bp
Primer pairs Sequence(5’- 3’) Amplified product size Reference
Tst1-f
Tst1-r
ACGTTTACACATTTGAATGAAGG
CGTTATAAAGATAAAAGGGAGAACG 819BP
Moneckeet et al., 2007
10. DISCUSSION
• The objective of this study was the screening of clinical and food samples for the identification of coagulase positive
s.aureus strains and detection of tst1 gene, obtained from different local areas of silchar city, India. Staphylococcus
aureus is a one of the most important and significant human pathogens,
• Out of 42 clinical samples, 34(80.9%) samples were positive for slide coagulase and tube coagulase. Whereas, 18 food
samples were coagulase positive out of 53 samples(33.9%). Coagulase positive strains produce a variety of toxins and
are therefore potentially pathogenic.
• The key factor for the success of s.aureus as a pathogen is its remarkable capacity to acquire antibiotic resistance
the present study showed that susceptibility against Vancomycin (11.4%) was highest followed by Teicoplanin (7.14%)
then Gatifloxacin (14.2%) and cefepime (4.28%) are intermediate, whereas Erythromycin (99.99%) resistant for
staphylococcus strain. Hence, the prevalence and degree of antimicrobial resistance are increasing worldwide
• Thus, the current study indicates that although the presence of tst1 gene is less positive in food samples but currently
the major problem that physicians have to face when treating S.aureus infections is antibiotic resistance
• Thus, based on the present and limited study data attention should be paid to the occurrence of multi-drug resistant
Staphylococcus aureus, the current results also shows that due to the large phenotypic switching and altering capability
in its gene expression the reservoirs for S.aureus is increasing its field so, that foods which are ready to eat might be
also potential hazardous source of Staphylococcus aureus.
• This study reveals that the presence of the high virulence toxic gene in food samples and the pathogenicity of S.aureus
which exists in local areas of Silchar city. Thus strict control measures must be applied to minimize the contamination in
food
11. Conclusion:
• This variations in prevalence of S. aureus may be due to poor hygienic measures taken by food handlers
(Zakaryet al., 2011). As the reservoirs of S.aureus are humans and contaminated fomins, therefore the
foods which are prepared, it should be under proper hygienic conditions for the better health of the
consumers. This study revealed that the resistance of S.aureus is increasing & dominating its virulence
factors in different environments even though things are maintained in pasteurized conditions.
FUTURE SCOPE:
The finding of this study gives some important areas of future research which are outlined below.
The mechanism behind the occurrence of S.aureus in packed food, also the genetics behind TSS caused by
direct consumption of contaminated food remains to be clarified.(Schlievert in 2001)
TSST-1 is common among invasive S.aureus strains, especially methicillin resistant and need to develop
vaccines (Michie c et al., 2002) Investigation whether vaccination with nontoxic mutant toxic shock
syndrome toxin 1 (Mtsst-1) can protect against S.aureus infection, (Mckenney D et al., 1999) and
therapeutic approaches regarding to S.aureus require further study.
12. References:
• Cruickshank, R., J.P Duguid, B.p. Marmion and R.H.A. Swain, 1975. medical
microbiology. 12th ed., vol. ii chruchill livingstone edinburg london and new york
• Crass, B.A. and bergdoll, MS. 1986. toxin involvement in toxic shock syndrome. J. infect.
DIS 153,918
• Dinges mm, orwin pm, schlievert pm. Exotoxins of staphylocoocs aureus. Clinical
microbiol- rev 2000; 13:16-34
• Martin m 13.1.16-34. 2000. clin microbiol. Rev 2000,13(1):16.doi.
• Sorum h, sunde m (2001) resistance to antibiotic in the normal flora of animals vet.res.
13:227-241