SlideShare a Scribd company logo
Health Decision
Support Systems

     Prof. Dr. Ir. Bart De Moor

     ESAT-SCD K.U.Leuven / IBBT

                                  1
Outline


-Trends

-Context

-Opportunities and challenges

-What to do ?




                                2
Trends


I. Exponential evolution in ICT, medical and bio-technology

II. Tsunami of data

III. Inter-, cross-, and multi-disciplinarity

IV. Societal demands

V. Translational gap




                                                              3
Gordon Moore’s law


                                  6 10 9                                 ‘Understand’ ?

                                  5 10 9                                   LUI




              Operations/second
                                  4 10 9

                                                                   3D games
                                         9
                                  3 10



                                  2 10 9



                                  1 10 9
                                                                   Video
                                                 Audio
                                      Bookkeeping
                                      0
                                      1975   1980   1985   1990    1995   2000   2005   2010

                                                                  Year                     4
Broad band capacity




                      5
Making sense of the 1000 $ genome ?

                                     1,00E+11
                                     1,00E+10

•   Human genome project             1,00E+09
                                     1,00E+08
                                                                                                               Cost per base pair
                                                                                                               Genome cost

     – Initial draft: June 2000
                                     1,00E+07
                                     1,00E+06
                                     1,00E+05

     – Final draft: April 2003       1,00E+04
                                     1,00E+03

     – 13 year project
                                     1,00E+02
                                     1,00E+01
                                     1,00E+00

     – $300 million value             1,00E-01
                                      1,00E-02
                                                  1990   1995    2000   2002   2005   2007       2010   2015

       with 2002 technology           1,00E-03
                                      1,00E-04


•
                                      1,00E-05
    Personal genome                   1,00E-06
                                      1,00E-07

     – June 1, 2007
     – Genome of James Watson,                   Year              Cost per base pair              Genome cost
       co-discoverer of DNA double                        1990                           10                          3E+10
       helix, is sequenced                                1995                               1             3.000.000.000
         • $1.000.000                                     2000                           0.2                   600.000.000
         • Two months                                     2002                          0.09                   270.000.000

•   €1000-genome                                          2005                          0.03                    90.000.000

     – Expected 2012-2020                                 2007                 0.000333333                       1.000.000
                                                          2010                 3.33333E-06                            10000
                                                          2015                   0.0000001                               300

                                                                                                                                6
Moore versus Carlson




                       7
Tsunami of data

-New technologies generate more data

-Increased spatial and temporal resolution

-More studies per patient, more datasets per study




   Virtual colonoscopy from CT
              images
   with automatically detected                  subtraction CT angiography
               polyps
                                                                             8
ACACATTAAATCTTATATGC
TAAAACTAGGTCTCGTTTTA
GGGATGTTTATAACCATCTT
TGAGATTATTGATGCATGGT
TATTGGTTAGAAAAAATATA
CGCTTGTTTTTCTTTCCTAG
GTTGATTGACTCATACATGT
GTTTCATTGAGGAAGGAAC
TTAACAAAACTGCACTTTTT
TCAACGTCACAGCTACTTTA
AAAGTGATCAAAGTATATCA
AGAAAGCTTAATATAAAGAC
ATTTGTTTCAAGGTTTCGTA
AGTGCACAATATCAAGAAG
ACAAAAATGACTAATTTTGT
TTTCAGGAAGCATATATATT
ACACGAACACAAATCTATTT
TTGTAATCAACACCGACCAT
GGTTCGATTACACACATTAA
ATCTTATATGCTAAAACTAG
GTCTCGTTTTAGGGATGTTT
ATAACCATCTTTGAGATTAT
TGATGCATGGTTATTGGTTA
GAAAAAATATACGCTTGTTT
TTCTTTCCTAGGTTGATTGA




 genome                 transcriptome proteome   metabolome   interactome



  GS-FLX Roche
  Applied Science 454
                                             Prometa

                                                                      9
Microarray data: genetic fingerprints




                                        10
Text mining




       By 2010, 1/3 of all world data bases will consist of biomedical data
                                                                       11
Analysis bottlenecks

Interpretability
                             Complexity




                                            # Genetic data

       Analysis bottleneck




                                          Price pbp




                                                             12
Transdisciplinary integration




Materials, energy, IT    Ubiquitous           Ambient intelligence
                         computing




                                                     POTS




                                         wireless
                                                     Cellular


                                                      WLAN
Embedded intelligence   Neuron on chip              Rehabilitation engineering
Smart pills                                         Monitoring
                                                    Sensors: EEG, glucose,blood, DNA,
                                                                                 13
                                                    Add-ons: vision, hearing, implants, …
Rationales for eHealth
   -Improve quality performance of health decision/diagnosis systems
         -Support individual medical doctor
               -Avoid/decrease number of medicial errors
               -Web portal for Evidence Based Medicine
                      -Organised access to literature
                      -Examples: UK, Norway, Sweden, Finland
         -Information sharing among doctors
               -avoid/monitor patient (s)hopping behavior
               -Global Medical File per patient
               -Interoperability
   -Deal with ‘empowerment of the patient’: Patient-centric health care
         -Medical care in 4P: personalized, preventive, predictive, participatory
         -Increasing trend for ‘customized’’personalized’ medicine
         -Improve transparancy and consistency
         -Deal/cope with ‘professional’ (chronical) patients (heart, diabetes, cancer,…)
         -Improve patient mobility
   -Cost effectiveness of the health care system
         -Ageing population:
               -EU 2050: 65+  +70%; 80+  +180%
               -Vl. 2012: 60+  25 % of Vl.
         -Monitor overconsumption
         -Improve transparancy
         -Detect abnormalities in diagnosis/therapy/…
   -Cope with tsunami of available information and data (clinical, population, ….)
                                                                                           14
Translational medicine: bed bench




                                      15
Academia             Health care system                   Academia



    Basic sciences          Clinical Practice          Humanities
    & technology
               CORE                               CORE
               FACIL                              FACIL

      Biomedical                                      Social health
      sciences       Experimental clinical medicine   sciences




BASIC /                        CLINICAL                   BASIC /
PRECLINICAL                                               PRECLINICAL

                                                                      16
Imaging in translational research
Molecular imaging:
translational research from animal models to clinical applications


     In vitro    Cell culture            Ex vivo                       In vivo                      Patient

                              Animal model         Molecular imaging             Clinical studies



 Animal model       Patient                                                                                   A: PET
                                                                                                              B: CT
    Neurodegenerative diseases
                                                                                                              C: US
                                                                                                              D: SPEC
                                                                                                              E: MR

                                                                                                     C        F: BLI

                                                               Animal models
                                                              of human disease


        Chemotherapy
                                                                                              D


                                                                                                               17
Outline


-Trends

-Context

-Opportunities and challenges

-What to do ?




                                18
Context



-VRWB cluster analysis
   -Cluster 2: ICT and Health Care
   -Cluster 5: New business models

- VRWB, 2008: De uitbouw van het translationeel onderzoek in Vlaanderen

- VR 30/04/2009: Oprichting van een Centrum voor Translationele Biomedische
    Innovatie / m.i.v. 8 mio euro voor biobank

- VIB, IBBT, Universities

- eHealth platform




                                                                          19
Obama
But in order to lead in the global economy and to ensure that our businesses can grow and innovate, and
our families can thrive, we're also going to have to address the shortcomings of our health care system.

The Recovery Act will support the long overdue step of computerizing America's medical records, to
reduce the duplication, waste and errors that cost billions of dollars and thousands of lives. But it's
important to note, these records also hold the potential of offering patients the chance to be more
active participants in the prevention and treatment of their diseases. We must maintain patient
control over these records and respect their privacy. At the same time, we have the opportunity to offer
billions and billions of anonymous data points to medical researchers who may find in this
information evidence that can help us better understand disease.

History also teaches us the greatest advances in medicine have come from scientific breakthroughs,
whether the discovery of antibiotics, or improved public health practices, vaccines for smallpox and polio
and many other infectious diseases, antiretroviral drugs that can return AIDS patients to productive lives,
pills that can control certain types of blood cancers, so many others.

Because of recent progress –- not just in biology, genetics and medicine, but also in physics,
chemistry, computer science, and engineering –- we have the potential to make enormous
progress against diseases in the coming decades. And that's why my administration is committed to
increasing funding for the National Institutes of Health, including $6 billion to support cancer research --
part of a sustained, multi-year plan to double cancer research in our country. (Applause.)

        http://www.whitehouse.gov/blog/09/04/27/The-Necessity-of-Science/
                                                                                                        20
Need for investments



-RIZIV: 23 mia euro / year

-Cumulative R&D funding Flanders (FWO, IWT, IBBT, VIB, IMEC,…)
    human health: 150 mio euro/year

- Need for new funding federal / communities / regions on
        Innovation in Health Care

-FOD Volksgezondheid: 16 a 17 mio euro / year for IT Hospitals




                                                                 21
Outline


-Trends

-Context

-Opportunities and challenges

-What to do ?




                                22
Opportunities: Decision support systems



 -Advanced Health Decision Support Systems based
           on integration of heterogeneous data sources

 -Policy Decision Support Systems

 -Embedded Decision Support Systems




                                                          23
Multimodal image data integration
 Assessment of myocardial infarction and residual viability:
 multimodal characterization of function, perfusion and metabolism
MR
      Cine MRI    CE-MRI      Perfusion MRI




PET                                       US
                                                          Baseline
NH3                                            DSE   40

perfusion                                            0

                                                     40                           10 g

                                                     0

FDG                                                  40
                                                                                  20 g

metabolism
                                                     0                                   24
                                                                     Strain [%]
Heterogenous data source gene prioritization
         High-throughput                  Data analysis              Candidate
         genomics                                                    genes




      Validation
                    Candidate prioritization
                                               Information sources
                                                                       ?

Aerts et al, Nature Biotechnology, 2006

                                                                             25
Clinical decision support




                            26
27
28
What to do ?
                            Translational

               5-10 years ahead
               of deployment

   Hospital      Decision                   Fundamental
 information     support                    Clinical
   Systems                                  Research
               Patient Health
  Invoicing      Decision                   Pathogenesis
                Support &
                 Disease
               management                   Biomarkers
   RIZIV
               Policy Decision
                   Support                  Target/drug
                                            discovery
                 Embedded
                  Decision
                  Support                                  29
Information security aspects

-Multilateral security for community-centric healthcare IT platforms

-System and software security of critical community (e-health) infrastructures

-Enabling technologies for collaborative work in the e-health sector

-Policy negotiation, enforcement and compliance

-Privacy preserving data-mining and statistical databases

-Body Area Networks (implanted devices, wearable devices,…) and
  Personal Area Networks

- E-government : identity management, delegation, controlled data exchange




                                                                            30
Policy decision support



-Population based mining
    -Spatial-temporal modelling
    - geography, age clusters, consumption profiles, longitudinal time series

-Clustering, classification, modelling, prediction, trends, seasonalities

-Outlier detection

-Federaal Kenniscentrum Gezondheidszorg




                                                                                31
Embedded decision support systems


-Assistive health and welness management systems

-Health telematics

-Intelligent environments, ambient intelligence, smart homes, home networks

-Home health monitoring and intervention

-Health vaults: personal medical data collection and processing

-Wearable sensor signal processing/wireless registration of physiological
   parameters




                                                                              32
Advanced Signal Processing




 PR
               Normal QRS

          QT                Left Bundle
                            Branch Block


  QRS width
                                           33
Outline


-Trends

-Context

-Opportunities and challenges

-What to do ?




                                34

More Related Content

Viewers also liked

I Minds2009 Amy Shuen What Is Web 2 0
I Minds2009 Amy Shuen   What Is Web 2 0I Minds2009 Amy Shuen   What Is Web 2 0
I Minds2009 Amy Shuen What Is Web 2 0imec.archive
 
02 Levenslang Wonen In Levensbestendige Woonwijken
02  Levenslang Wonen In Levensbestendige Woonwijken02  Levenslang Wonen In Levensbestendige Woonwijken
02 Levenslang Wonen In Levensbestendige Woonwijkenimec.archive
 
Brokerage2006 wim dewaele ibbt een overzicht van 2 jaren werking & onze plan...
Brokerage2006 wim dewaele  ibbt een overzicht van 2 jaren werking & onze plan...Brokerage2006 wim dewaele  ibbt een overzicht van 2 jaren werking & onze plan...
Brokerage2006 wim dewaele ibbt een overzicht van 2 jaren werking & onze plan...imec.archive
 
I Minds2009 Wishbone
I Minds2009 WishboneI Minds2009 Wishbone
I Minds2009 Wishboneimec.archive
 
2008 brokerage 06 multimodal logistics [compatibility mode]
2008 brokerage 06 multimodal logistics [compatibility mode]2008 brokerage 06 multimodal logistics [compatibility mode]
2008 brokerage 06 multimodal logistics [compatibility mode]imec.archive
 
Kathleen Heireman - Maple
Kathleen Heireman - MapleKathleen Heireman - Maple
Kathleen Heireman - Mapleimec.archive
 
I Minds2009 Proeftuinen In Vlaanderen Dr Pieter Ballon & Dr Lieven Demarez...
I Minds2009 Proeftuinen In Vlaanderen  Dr  Pieter Ballon & Dr  Lieven Demarez...I Minds2009 Proeftuinen In Vlaanderen  Dr  Pieter Ballon & Dr  Lieven Demarez...
I Minds2009 Proeftuinen In Vlaanderen Dr Pieter Ballon & Dr Lieven Demarez...imec.archive
 
Bart Meekens - rmoni wireless @ iLab.t
 Bart Meekens - rmoni wireless @ iLab.t Bart Meekens - rmoni wireless @ iLab.t
Bart Meekens - rmoni wireless @ iLab.timec.archive
 
31032010 we bbt workshop agiledevelopment
31032010 we bbt workshop agiledevelopment31032010 we bbt workshop agiledevelopment
31032010 we bbt workshop agiledevelopmentimec.archive
 
бизнесрекомендаций1
бизнесрекомендаций1бизнесрекомендаций1
бизнесрекомендаций1TVIRICH
 
Benoit Felten - The Universal Connectivity Revolution
Benoit Felten - The Universal Connectivity RevolutionBenoit Felten - The Universal Connectivity Revolution
Benoit Felten - The Universal Connectivity Revolution
imec.archive
 
Modal Verbs
Modal VerbsModal Verbs
Modal Verbs
Emerson Macedo
 
Brokerage2006 jan callewaert option - the innovation game
Brokerage2006 jan callewaert  option - the innovation gameBrokerage2006 jan callewaert  option - the innovation game
Brokerage2006 jan callewaert option - the innovation gameimec.archive
 
Jos van Sas - Testimonial Alcatel-Lucent Bell Labs
Jos van Sas - Testimonial Alcatel-Lucent Bell LabsJos van Sas - Testimonial Alcatel-Lucent Bell Labs
Jos van Sas - Testimonial Alcatel-Lucent Bell Labsimec.archive
 
Steven Logghe & Pieter Audenaert - Mobiroute
Steven Logghe & Pieter Audenaert - MobirouteSteven Logghe & Pieter Audenaert - Mobiroute
Steven Logghe & Pieter Audenaert - Mobirouteimec.archive
 
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growth
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive GrowthDirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growth
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growthimec.archive
 
Kirsten Van Gossum - privacy in relation to technology in the (health)care
Kirsten Van Gossum - privacy in relation to technology in the (health)careKirsten Van Gossum - privacy in relation to technology in the (health)care
Kirsten Van Gossum - privacy in relation to technology in the (health)careimec.archive
 
200081003 Friday Food@IBBT
200081003 Friday Food@IBBT200081003 Friday Food@IBBT
200081003 Friday Food@IBBT
imec.archive
 

Viewers also liked (20)

I Minds2009 Amy Shuen What Is Web 2 0
I Minds2009 Amy Shuen   What Is Web 2 0I Minds2009 Amy Shuen   What Is Web 2 0
I Minds2009 Amy Shuen What Is Web 2 0
 
02 Levenslang Wonen In Levensbestendige Woonwijken
02  Levenslang Wonen In Levensbestendige Woonwijken02  Levenslang Wonen In Levensbestendige Woonwijken
02 Levenslang Wonen In Levensbestendige Woonwijken
 
Brokerage2006 wim dewaele ibbt een overzicht van 2 jaren werking & onze plan...
Brokerage2006 wim dewaele  ibbt een overzicht van 2 jaren werking & onze plan...Brokerage2006 wim dewaele  ibbt een overzicht van 2 jaren werking & onze plan...
Brokerage2006 wim dewaele ibbt een overzicht van 2 jaren werking & onze plan...
 
I Minds2009 Wishbone
I Minds2009 WishboneI Minds2009 Wishbone
I Minds2009 Wishbone
 
2008 brokerage 06 multimodal logistics [compatibility mode]
2008 brokerage 06 multimodal logistics [compatibility mode]2008 brokerage 06 multimodal logistics [compatibility mode]
2008 brokerage 06 multimodal logistics [compatibility mode]
 
Kathleen Heireman - Maple
Kathleen Heireman - MapleKathleen Heireman - Maple
Kathleen Heireman - Maple
 
Vw Polo 1994 2001
Vw Polo 1994 2001Vw Polo 1994 2001
Vw Polo 1994 2001
 
Grid07 1 Dhoedt
Grid07 1 DhoedtGrid07 1 Dhoedt
Grid07 1 Dhoedt
 
I Minds2009 Proeftuinen In Vlaanderen Dr Pieter Ballon & Dr Lieven Demarez...
I Minds2009 Proeftuinen In Vlaanderen  Dr  Pieter Ballon & Dr  Lieven Demarez...I Minds2009 Proeftuinen In Vlaanderen  Dr  Pieter Ballon & Dr  Lieven Demarez...
I Minds2009 Proeftuinen In Vlaanderen Dr Pieter Ballon & Dr Lieven Demarez...
 
Bart Meekens - rmoni wireless @ iLab.t
 Bart Meekens - rmoni wireless @ iLab.t Bart Meekens - rmoni wireless @ iLab.t
Bart Meekens - rmoni wireless @ iLab.t
 
31032010 we bbt workshop agiledevelopment
31032010 we bbt workshop agiledevelopment31032010 we bbt workshop agiledevelopment
31032010 we bbt workshop agiledevelopment
 
бизнесрекомендаций1
бизнесрекомендаций1бизнесрекомендаций1
бизнесрекомендаций1
 
Benoit Felten - The Universal Connectivity Revolution
Benoit Felten - The Universal Connectivity RevolutionBenoit Felten - The Universal Connectivity Revolution
Benoit Felten - The Universal Connectivity Revolution
 
Modal Verbs
Modal VerbsModal Verbs
Modal Verbs
 
Brokerage2006 jan callewaert option - the innovation game
Brokerage2006 jan callewaert  option - the innovation gameBrokerage2006 jan callewaert  option - the innovation game
Brokerage2006 jan callewaert option - the innovation game
 
Jos van Sas - Testimonial Alcatel-Lucent Bell Labs
Jos van Sas - Testimonial Alcatel-Lucent Bell LabsJos van Sas - Testimonial Alcatel-Lucent Bell Labs
Jos van Sas - Testimonial Alcatel-Lucent Bell Labs
 
Steven Logghe & Pieter Audenaert - Mobiroute
Steven Logghe & Pieter Audenaert - MobirouteSteven Logghe & Pieter Audenaert - Mobiroute
Steven Logghe & Pieter Audenaert - Mobiroute
 
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growth
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive GrowthDirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growth
Dirk Beernaert - a European Strategy for Smart, Sustainable and Inclusive Growth
 
Kirsten Van Gossum - privacy in relation to technology in the (health)care
Kirsten Van Gossum - privacy in relation to technology in the (health)careKirsten Van Gossum - privacy in relation to technology in the (health)care
Kirsten Van Gossum - privacy in relation to technology in the (health)care
 
200081003 Friday Food@IBBT
200081003 Friday Food@IBBT200081003 Friday Food@IBBT
200081003 Friday Food@IBBT
 

Similar to I Minds2009 Health Decision Support Prof Bart De Moor (Ibbt Esat Ku Leuven)

The Beauty of Computing with People
The Beauty of Computing with PeopleThe Beauty of Computing with People
The Beauty of Computing with People
Xavier Amatriain
 
Davidreinselppt 110304164919-phpapp01
Davidreinselppt 110304164919-phpapp01Davidreinselppt 110304164919-phpapp01
Davidreinselppt 110304164919-phpapp01MassTLC
 
Industry Day Living Foundries DARPA
Industry Day Living Foundries DARPAIndustry Day Living Foundries DARPA
Industry Day Living Foundries DARPAIlya Klabukov
 
Determine the Right Analytic Database: A Survey of New Data Technologies
Determine the Right Analytic Database: A Survey of New Data TechnologiesDetermine the Right Analytic Database: A Survey of New Data Technologies
Determine the Right Analytic Database: A Survey of New Data Technologies
mark madsen
 
European Leveraged Loan Market Analysis - Year-end 2010
European Leveraged Loan Market Analysis - Year-end 2010European Leveraged Loan Market Analysis - Year-end 2010
European Leveraged Loan Market Analysis - Year-end 2010
Leveraged Commentary & Data
 
Innovations in Medical Devices: Medtronic Advanced Energy
Innovations in Medical Devices: Medtronic Advanced EnergyInnovations in Medical Devices: Medtronic Advanced Energy
Innovations in Medical Devices: Medtronic Advanced Energy
UNHInnovation
 
David Reinsel - Entering the Era of Big IT
David Reinsel - Entering the Era of Big ITDavid Reinsel - Entering the Era of Big IT
David Reinsel - Entering the Era of Big ITChristine Nolan
 
Smart Telco in 4G
Smart Telco in 4GSmart Telco in 4G
Smart Telco in 4G
Seungyul Kim
 
N screen trend in 2012
N screen trend in 2012N screen trend in 2012
N screen trend in 2012Seungyul Kim
 
Kris Verstreken
Kris VerstrekenKris Verstreken
Kris Verstrekenceysens
 
รายงาน บริษัท ทีโอที
รายงาน บริษัท ทีโอทีรายงาน บริษัท ทีโอที
รายงาน บริษัท ทีโอทีPalm SinCere
 
Carrier Video Services: Trends and Opportunities
Carrier Video Services: Trends and OpportunitiesCarrier Video Services: Trends and Opportunities
Carrier Video Services: Trends and Opportunities
Alan Quayle
 
Innovation Challenges in the Wireless Broadband Eco-System
Innovation Challenges in the Wireless Broadband Eco-System Innovation Challenges in the Wireless Broadband Eco-System
Innovation Challenges in the Wireless Broadband Eco-System
Dr. Mazlan Abbas
 
Wim De Waele: IBBT Svz en strategie voor de toekomst
Wim De Waele: IBBT Svz en strategie voor de toekomst Wim De Waele: IBBT Svz en strategie voor de toekomst
Wim De Waele: IBBT Svz en strategie voor de toekomst imec.archive
 
LifeTechLimburg Interregio 05102011: Melotte
LifeTechLimburg Interregio 05102011: MelotteLifeTechLimburg Interregio 05102011: Melotte
LifeTechLimburg Interregio 05102011: MelotteLifeTechLimburg
 
Vanzee 1201
Vanzee 1201Vanzee 1201
Vanzee 1201asim8704
 

Similar to I Minds2009 Health Decision Support Prof Bart De Moor (Ibbt Esat Ku Leuven) (20)

The Beauty of Computing with People
The Beauty of Computing with PeopleThe Beauty of Computing with People
The Beauty of Computing with People
 
3 d ic
3 d ic3 d ic
3 d ic
 
Davidreinselppt 110304164919-phpapp01
Davidreinselppt 110304164919-phpapp01Davidreinselppt 110304164919-phpapp01
Davidreinselppt 110304164919-phpapp01
 
Industry Day Living Foundries DARPA
Industry Day Living Foundries DARPAIndustry Day Living Foundries DARPA
Industry Day Living Foundries DARPA
 
Determine the Right Analytic Database: A Survey of New Data Technologies
Determine the Right Analytic Database: A Survey of New Data TechnologiesDetermine the Right Analytic Database: A Survey of New Data Technologies
Determine the Right Analytic Database: A Survey of New Data Technologies
 
Schmettow
SchmettowSchmettow
Schmettow
 
European Leveraged Loan Market Analysis - Year-end 2010
European Leveraged Loan Market Analysis - Year-end 2010European Leveraged Loan Market Analysis - Year-end 2010
European Leveraged Loan Market Analysis - Year-end 2010
 
Innovations in Medical Devices: Medtronic Advanced Energy
Innovations in Medical Devices: Medtronic Advanced EnergyInnovations in Medical Devices: Medtronic Advanced Energy
Innovations in Medical Devices: Medtronic Advanced Energy
 
David Reinsel - Entering the Era of Big IT
David Reinsel - Entering the Era of Big ITDavid Reinsel - Entering the Era of Big IT
David Reinsel - Entering the Era of Big IT
 
Smart Telco in 4G
Smart Telco in 4GSmart Telco in 4G
Smart Telco in 4G
 
N screen trend in 2012
N screen trend in 2012N screen trend in 2012
N screen trend in 2012
 
Kris Verstreken
Kris VerstrekenKris Verstreken
Kris Verstreken
 
รายงาน บริษัท ทีโอที
รายงาน บริษัท ทีโอทีรายงาน บริษัท ทีโอที
รายงาน บริษัท ทีโอที
 
Lte asia 2011 s niri
Lte asia 2011 s niriLte asia 2011 s niri
Lte asia 2011 s niri
 
Carrier Video Services: Trends and Opportunities
Carrier Video Services: Trends and OpportunitiesCarrier Video Services: Trends and Opportunities
Carrier Video Services: Trends and Opportunities
 
Innovation Challenges in the Wireless Broadband Eco-System
Innovation Challenges in the Wireless Broadband Eco-System Innovation Challenges in the Wireless Broadband Eco-System
Innovation Challenges in the Wireless Broadband Eco-System
 
Dth Technology
Dth TechnologyDth Technology
Dth Technology
 
Wim De Waele: IBBT Svz en strategie voor de toekomst
Wim De Waele: IBBT Svz en strategie voor de toekomst Wim De Waele: IBBT Svz en strategie voor de toekomst
Wim De Waele: IBBT Svz en strategie voor de toekomst
 
LifeTechLimburg Interregio 05102011: Melotte
LifeTechLimburg Interregio 05102011: MelotteLifeTechLimburg Interregio 05102011: Melotte
LifeTechLimburg Interregio 05102011: Melotte
 
Vanzee 1201
Vanzee 1201Vanzee 1201
Vanzee 1201
 

More from imec.archive

iMinds-iLab.o, Open Innovation in ICT
iMinds-iLab.o, Open Innovation in ICTiMinds-iLab.o, Open Innovation in ICT
iMinds-iLab.o, Open Innovation in ICTimec.archive
 
Accio presentation closing event
Accio presentation closing eventAccio presentation closing event
Accio presentation closing event
imec.archive
 
PRoF+ Patient Room of the Future
PRoF+ Patient Room of the FuturePRoF+ Patient Room of the Future
PRoF+ Patient Room of the Future
imec.archive
 
Results of the Apollon pilot in homecare and independent living
Results of the Apollon pilot in homecare and independent livingResults of the Apollon pilot in homecare and independent living
Results of the Apollon pilot in homecare and independent living
imec.archive
 
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
imec.archive
 
NMMU-Emmanuel Haven Living Lab
NMMU-Emmanuel Haven Living LabNMMU-Emmanuel Haven Living Lab
NMMU-Emmanuel Haven Living Lab
imec.archive
 
The Humanicité workshops
The Humanicité workshopsThe Humanicité workshops
The Humanicité workshops
imec.archive
 
A Real-World Experimentation Platform
A Real-World Experimentation PlatformA Real-World Experimentation Platform
A Real-World Experimentation Platform
imec.archive
 
ENoLL @ AAL Forum 2012
ENoLL @ AAL Forum 2012ENoLL @ AAL Forum 2012
ENoLL @ AAL Forum 2012
imec.archive
 
ENoLL 6th Wave Results Ceremony (Jesse Marsh)
ENoLL 6th Wave Results Ceremony (Jesse Marsh)ENoLL 6th Wave Results Ceremony (Jesse Marsh)
ENoLL 6th Wave Results Ceremony (Jesse Marsh)imec.archive
 
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...imec.archive
 
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value  Apollon-23/05/2012-9u30- Parallell session: Living Labs added value
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value imec.archive
 
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across bordersApollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
imec.archive
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
imec.archive
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
imec.archive
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
imec.archive
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
imec.archive
 
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across bordersApollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
imec.archive
 
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation EcosystemsApollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
imec.archive
 
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation EcosystemsApollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
imec.archive
 

More from imec.archive (20)

iMinds-iLab.o, Open Innovation in ICT
iMinds-iLab.o, Open Innovation in ICTiMinds-iLab.o, Open Innovation in ICT
iMinds-iLab.o, Open Innovation in ICT
 
Accio presentation closing event
Accio presentation closing eventAccio presentation closing event
Accio presentation closing event
 
PRoF+ Patient Room of the Future
PRoF+ Patient Room of the FuturePRoF+ Patient Room of the Future
PRoF+ Patient Room of the Future
 
Results of the Apollon pilot in homecare and independent living
Results of the Apollon pilot in homecare and independent livingResults of the Apollon pilot in homecare and independent living
Results of the Apollon pilot in homecare and independent living
 
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
Delivery of feedback on Health, Home Security and Home Energy in Aware Homes ...
 
NMMU-Emmanuel Haven Living Lab
NMMU-Emmanuel Haven Living LabNMMU-Emmanuel Haven Living Lab
NMMU-Emmanuel Haven Living Lab
 
The Humanicité workshops
The Humanicité workshopsThe Humanicité workshops
The Humanicité workshops
 
A Real-World Experimentation Platform
A Real-World Experimentation PlatformA Real-World Experimentation Platform
A Real-World Experimentation Platform
 
ENoLL @ AAL Forum 2012
ENoLL @ AAL Forum 2012ENoLL @ AAL Forum 2012
ENoLL @ AAL Forum 2012
 
ENoLL 6th Wave Results Ceremony (Jesse Marsh)
ENoLL 6th Wave Results Ceremony (Jesse Marsh)ENoLL 6th Wave Results Ceremony (Jesse Marsh)
ENoLL 6th Wave Results Ceremony (Jesse Marsh)
 
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...
The Connected Smart Cities Network and Living Labs - Towards Horizon 2020 - K...
 
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value  Apollon-23/05/2012-9u30- Parallell session: Living Labs added value
Apollon-23/05/2012-9u30- Parallell session: Living Labs added value
 
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across bordersApollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
 
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future InternetApollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
Apollon - 22/5/12 - 16:00 - Smart Open Cities and the Future Internet
 
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across bordersApollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
Apollon - 22/5/12 - 11:30 - Local SME's - Innovating Across borders
 
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation EcosystemsApollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
 
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation EcosystemsApollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
Apollon - 22/5/12 - 09:00 - User-driven Open Innovation Ecosystems
 

I Minds2009 Health Decision Support Prof Bart De Moor (Ibbt Esat Ku Leuven)

  • 1. Health Decision Support Systems Prof. Dr. Ir. Bart De Moor ESAT-SCD K.U.Leuven / IBBT 1
  • 3. Trends I. Exponential evolution in ICT, medical and bio-technology II. Tsunami of data III. Inter-, cross-, and multi-disciplinarity IV. Societal demands V. Translational gap 3
  • 4. Gordon Moore’s law 6 10 9 ‘Understand’ ? 5 10 9 LUI Operations/second 4 10 9 3D games 9 3 10 2 10 9 1 10 9 Video Audio Bookkeeping 0 1975 1980 1985 1990 1995 2000 2005 2010 Year 4
  • 6. Making sense of the 1000 $ genome ? 1,00E+11 1,00E+10 • Human genome project 1,00E+09 1,00E+08 Cost per base pair Genome cost – Initial draft: June 2000 1,00E+07 1,00E+06 1,00E+05 – Final draft: April 2003 1,00E+04 1,00E+03 – 13 year project 1,00E+02 1,00E+01 1,00E+00 – $300 million value 1,00E-01 1,00E-02 1990 1995 2000 2002 2005 2007 2010 2015 with 2002 technology 1,00E-03 1,00E-04 • 1,00E-05 Personal genome 1,00E-06 1,00E-07 – June 1, 2007 – Genome of James Watson, Year Cost per base pair Genome cost co-discoverer of DNA double 1990 10 3E+10 helix, is sequenced 1995 1 3.000.000.000 • $1.000.000 2000 0.2 600.000.000 • Two months 2002 0.09 270.000.000 • €1000-genome 2005 0.03 90.000.000 – Expected 2012-2020 2007 0.000333333 1.000.000 2010 3.33333E-06 10000 2015 0.0000001 300 6
  • 8. Tsunami of data -New technologies generate more data -Increased spatial and temporal resolution -More studies per patient, more datasets per study Virtual colonoscopy from CT images with automatically detected subtraction CT angiography polyps 8
  • 10. Microarray data: genetic fingerprints 10
  • 11. Text mining By 2010, 1/3 of all world data bases will consist of biomedical data 11
  • 12. Analysis bottlenecks Interpretability Complexity # Genetic data Analysis bottleneck Price pbp 12
  • 13. Transdisciplinary integration Materials, energy, IT Ubiquitous Ambient intelligence computing POTS wireless Cellular WLAN Embedded intelligence Neuron on chip Rehabilitation engineering Smart pills Monitoring Sensors: EEG, glucose,blood, DNA, 13 Add-ons: vision, hearing, implants, …
  • 14. Rationales for eHealth -Improve quality performance of health decision/diagnosis systems -Support individual medical doctor -Avoid/decrease number of medicial errors -Web portal for Evidence Based Medicine -Organised access to literature -Examples: UK, Norway, Sweden, Finland -Information sharing among doctors -avoid/monitor patient (s)hopping behavior -Global Medical File per patient -Interoperability -Deal with ‘empowerment of the patient’: Patient-centric health care -Medical care in 4P: personalized, preventive, predictive, participatory -Increasing trend for ‘customized’’personalized’ medicine -Improve transparancy and consistency -Deal/cope with ‘professional’ (chronical) patients (heart, diabetes, cancer,…) -Improve patient mobility -Cost effectiveness of the health care system -Ageing population: -EU 2050: 65+  +70%; 80+  +180% -Vl. 2012: 60+  25 % of Vl. -Monitor overconsumption -Improve transparancy -Detect abnormalities in diagnosis/therapy/… -Cope with tsunami of available information and data (clinical, population, ….) 14
  • 15. Translational medicine: bed bench 15
  • 16. Academia Health care system Academia Basic sciences Clinical Practice Humanities & technology CORE CORE FACIL FACIL Biomedical Social health sciences Experimental clinical medicine sciences BASIC / CLINICAL BASIC / PRECLINICAL PRECLINICAL 16
  • 17. Imaging in translational research Molecular imaging: translational research from animal models to clinical applications In vitro Cell culture Ex vivo In vivo Patient Animal model Molecular imaging Clinical studies Animal model Patient A: PET B: CT Neurodegenerative diseases C: US D: SPEC E: MR C F: BLI Animal models of human disease Chemotherapy D 17
  • 19. Context -VRWB cluster analysis -Cluster 2: ICT and Health Care -Cluster 5: New business models - VRWB, 2008: De uitbouw van het translationeel onderzoek in Vlaanderen - VR 30/04/2009: Oprichting van een Centrum voor Translationele Biomedische Innovatie / m.i.v. 8 mio euro voor biobank - VIB, IBBT, Universities - eHealth platform 19
  • 20. Obama But in order to lead in the global economy and to ensure that our businesses can grow and innovate, and our families can thrive, we're also going to have to address the shortcomings of our health care system. The Recovery Act will support the long overdue step of computerizing America's medical records, to reduce the duplication, waste and errors that cost billions of dollars and thousands of lives. But it's important to note, these records also hold the potential of offering patients the chance to be more active participants in the prevention and treatment of their diseases. We must maintain patient control over these records and respect their privacy. At the same time, we have the opportunity to offer billions and billions of anonymous data points to medical researchers who may find in this information evidence that can help us better understand disease. History also teaches us the greatest advances in medicine have come from scientific breakthroughs, whether the discovery of antibiotics, or improved public health practices, vaccines for smallpox and polio and many other infectious diseases, antiretroviral drugs that can return AIDS patients to productive lives, pills that can control certain types of blood cancers, so many others. Because of recent progress –- not just in biology, genetics and medicine, but also in physics, chemistry, computer science, and engineering –- we have the potential to make enormous progress against diseases in the coming decades. And that's why my administration is committed to increasing funding for the National Institutes of Health, including $6 billion to support cancer research -- part of a sustained, multi-year plan to double cancer research in our country. (Applause.) http://www.whitehouse.gov/blog/09/04/27/The-Necessity-of-Science/ 20
  • 21. Need for investments -RIZIV: 23 mia euro / year -Cumulative R&D funding Flanders (FWO, IWT, IBBT, VIB, IMEC,…) human health: 150 mio euro/year - Need for new funding federal / communities / regions on Innovation in Health Care -FOD Volksgezondheid: 16 a 17 mio euro / year for IT Hospitals 21
  • 23. Opportunities: Decision support systems -Advanced Health Decision Support Systems based on integration of heterogeneous data sources -Policy Decision Support Systems -Embedded Decision Support Systems 23
  • 24. Multimodal image data integration Assessment of myocardial infarction and residual viability: multimodal characterization of function, perfusion and metabolism MR Cine MRI CE-MRI Perfusion MRI PET US Baseline NH3 DSE 40 perfusion 0 40 10 g 0 FDG 40 20 g metabolism 0 24 Strain [%]
  • 25. Heterogenous data source gene prioritization High-throughput Data analysis Candidate genomics genes Validation Candidate prioritization Information sources ? Aerts et al, Nature Biotechnology, 2006 25
  • 27. 27
  • 28. 28
  • 29. What to do ? Translational 5-10 years ahead of deployment Hospital Decision Fundamental information support Clinical Systems Research Patient Health Invoicing Decision Pathogenesis Support & Disease management Biomarkers RIZIV Policy Decision Support Target/drug discovery Embedded Decision Support 29
  • 30. Information security aspects -Multilateral security for community-centric healthcare IT platforms -System and software security of critical community (e-health) infrastructures -Enabling technologies for collaborative work in the e-health sector -Policy negotiation, enforcement and compliance -Privacy preserving data-mining and statistical databases -Body Area Networks (implanted devices, wearable devices,…) and Personal Area Networks - E-government : identity management, delegation, controlled data exchange 30
  • 31. Policy decision support -Population based mining -Spatial-temporal modelling - geography, age clusters, consumption profiles, longitudinal time series -Clustering, classification, modelling, prediction, trends, seasonalities -Outlier detection -Federaal Kenniscentrum Gezondheidszorg 31
  • 32. Embedded decision support systems -Assistive health and welness management systems -Health telematics -Intelligent environments, ambient intelligence, smart homes, home networks -Home health monitoring and intervention -Health vaults: personal medical data collection and processing -Wearable sensor signal processing/wireless registration of physiological parameters 32
  • 33. Advanced Signal Processing PR Normal QRS QT Left Bundle Branch Block QRS width 33