How To Write A Good Hook For An Persuasive Essay

How To Write A Good Hook For
An Persuasive Essay
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid
email address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete
the 10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing
style, attach a sample of your previous work.
3. Step
When seeking assignment writing help fromHelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for
your request, choose one of them based on qualifications, order history,
and feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing
services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully
met.
How To Write A Good Hook For An Persuasive EssayHow To Write A Good Hook For An Persuasive Essay

The Effect of Divorce on Parent and Child Essay
Divorce is a plague that is destroying numerous families across the United States of America.
Sadly, when husbands and wives divorce, the children are often caught directly in the middle.
Throughout the years divorce has been becoming more and more common. In the 1920 s it was a
rare find to know a person whom had been divorced, today it is a rarity not to know of one who has
been, or will be divorced. Divorcehas numerous effects on the structures of families, and many
devastating effects on the children that must experience it, although sometimes necessary, divorce
radically changes the lives of adolescents and adults alike.
Explaining Divorce
Parents frequently tell me they believe that to explain too much about the end of ... Show more
content on Helpwriting.net ...
Sometimes divorce may be the only way to solve the various problems a family may have.
Custody
When parents become divorced there are many decisions that they must come to an agreement
upon. How will are possessions be divided? and What will happen to the children? are often the
most asked questions when divorce occurs. Custody is almost always the largest battle when
husband and wife become divorced. Custody includes all duties a parent owes a child including,
food, shelter, protection discipline, education, and even a child s religious beliefs (Martin 32).
Often, a judge must make custody decisions for the parents. There are several types of custody, but
the most common are sole custody, joint legal custody, and joint physical custody.
In sole custody, a single parent provides shelter and makes all important decisions for the child. In
joint legal custody, the child lives with a single parent but decisions are agreed upon by both.
Finally, in joint physical custody the child lives with each parent for equal periods of time and
important decisions may be made by either one, or both parents (Furstenberg 32).
Sole custody children often live with the custodial parent for two week periods and live with the
non custodial parent for two day time periods (Wolchik 164). This gives the child a stable home to
live in while also allowing the child to have a relationship with both parents. Of all different types
... Get more on HelpWriting.net ...

Aeromodel Guidelines
SAEINDIA SAE
Student Convention
Welcome to Aero modeling using Paper Wings!
Paper Airplane models for college students!
Enjoy Learn and align with Curriculum
September 2008
Paper Wings Guidelines
This may look ridiculous and appear to be a child s play. As you use the kit and build your first
plane, you will realize that it is not all that simple. Soon you will learn to make the plane to fly
and discover the joy of flying. In the process you will learn the nuances of flying intuitively. This
document will provide you with the essential hints to make the planes and fly them. Follow the
guidelines and experience the joy of flying. At the divisional level, you will be expected to design
your own Paper Wing plane. In the finals you will ... Show more content on Helpwriting.net ...
Use a blank piece of scrap paper and make sure that no print on the paper comes into contact with
the glued parts. Since glue has the power to dissolve printing ink, the ink could smear onto the
assembled plane. Spread several layers of large scrap per over a desk or other flat surface for
protection. Set the newly glued main wing and fuselage on the papers to dry for at least 5 to 6
hours. On for speedier drying, place stands of folded paper under the glued parts as shown in the
figure. This permits improved air circulation to the underside of the glued parts. When building a
layered fuselage, it is helpful to place books on top of the fuselage as a weight after gluing in
order to maintain a solid and uniform body.
the Challenge Ahead!
Meeting
SAEINDIA Student Activities SAE
Page 4 of 31
SAEINDIA SAE
Student Convention
Enjoy Learn and align with Curriculum

September 2008
Paper Wings Guidelines
When assembling the main wing is mentioned we are referring to gluing the reinforcement piece
(B) to the main wing (A) The center line for piece (B) extends about 3mm (1/8 ) in front and in
back of the cutting lines when cutting out piece (B) you will notice in the figure that the left and

African American Contributions to American History
Many blacks contributed to the success of our country in every war that we as a people have
ever fought. In order to properly thank them for their heroic effort, I as a Hispanic Caucasian must
give credit where credit is due. In order to properly do so, I must begin with the contributions of
Black America beginning with the American Revolution and continue up until the World War II.
Make no mistake blacks made contributions well past World War II, but in the interest of time and
accuracy I must stay within the confines of our earlier history. One main aspect that should be
analyzed is the fact that no matter how hard the struggle, blacks have always overcome adversity no
matter what the cost. Of course, contributions made by blacks... Show more content on
Helpwriting.net ...
Some became the founders of the British colony of Sierra Leone in West Africa. Even though
the British offered slaves a better deal, many blacks served on the American side. They made up
a sizeable share of the men in the Continental navy, state navies and the large force of American
privateers. Blacks had long been in the labor force on ships and at seaports. On the water, then as
now, skill counted for more than politics. The precise role of blacks in the revolution is difficult to
quantify. Blacks in those days generally did not write. The people who did write early histories of
the revolution were whites and concentrated on the efforts of white men. Also, many participants in
the revolution were not specifically identified by race in the documents of the time and historians
now have no way of knowing whether they were black. When blacks were allowed to serve in
the American military, they often did work as laborers, sometimes in addition to regular soldier
duties. Usually they were privates, though a few rose to command small groups of men. The
words of the Declaration of Independence were taken literally by blacks and some whites. In,
1780, Pennsylvania became the first colony to pass a law phasing out slavery. Children born to
slaves after that date were granted their freedom when they reached 28. Other northern states
followed. The Superior Court of Massachusetts held in 1783 that slavery violated the

Anne Rice Research Paper
To write something, you have to risk making a fool of yourself. Anne Rice, American author of
supernatural fiction and erotica has had to take many risks to get where she is now. Anne was
born into the Howard family in New Orleans, Louisiana on October 4, 1941. She had a troubled
childhood but still managed to find the passion to write. Anne s early life, obstacles, and success all
play into her writing and uniqueness.
Anne Rice, born Howard Allen O brien, was born to Howard O brien and Katherine Allen O
brien. She has three sisters, one older and two younger. In the first grade she decided she wanted to
go by the name Anne instead. Her family was exceedingly religious and passed on their Christian
faith to her. However, she later gave up the religion. Growing up, Anne had to deal with her mother
s alcoholism and poverty. She attended Richardson High School before moving to Texas for
college. While attending college at North Texas State College, she encountered financial problems
and had to work extra jobs and take night classes. Her writing career did not begin until 1976 with
the debut of her novel Interview with a Vampire . Furthermore, some of Anne s influences were
Charles Dickens, William Shakespeare, and Charlotte BrontД“. Anne was inspired to write the ...
Show more content on Helpwriting.net ...
Her work first became popular for Interview with a Vampire which developed a cult following
for the character Lestat and made 1 million dollars in movie and paperback rights. The concept
of immortality brought popularity to her books. Anne s books are considered revolutionary
because she was the first to introduce vampires as major characters with families and lovers
instead of the antagonists. Also, Anne s work has received many recognitions. She won the Bram
Stroker Award for Lifetime Achievement in 2003. The award is given to people who write in the
horror genre. Overall, Anne was persistent and did not let any obstacles get in her

Myth Of The Frog
In this story, the frog that lived in the well was raised in an environment where he believed his
well was the end all be all and no other options outside of it existed. He obviously was not privy
to the fact that the world has many different environments of different shapes and sizes. Once he
met the frog from the sea that fell in the well and heard that there was a possibility of another
environment being much larger than his, he challenged it. The frog from the sea has had the
opportunity of experiencing more than one environment, so he in fact had a little more knowledge
about different environments than the frog raised in the well. Given this information, the frog from
the well could only speak on what he knew, and all he knew was... Show more content on
Helpwriting.net ...
The differences in these churches are that the Baptist Church believes the authority of the church
lies within the believer and the Lords Supper (communion) as their actions of faith. Our Lady of
Angels Catholic Church members live their lives around the seven sacraments. These sacraments
are a religious ceremony regarded as a visible sign of grace. The seven sacraments are Baptism,
Confirmation, Eucharist, Penance, anointing of the sick, Matrimony and Holy Orders. The
Catholic Church also believes the authority of the church lies within the hierarchy of the church.
The Church of Jesus Christ of Latter day Saints believes that in addition to the Bible, the Doctrine
and Covenants, and the Pearl of Great Price compliment the Bible. They also believe they can
become a God by obeying the commandments of God.
All three churches identify and Christians and believe that the Bible is God s word. They also
accept Jesus Christ as the God, the Son, and the Holy Spirit. Both the Baptist Church and the Latter
day Saint Church believed that God died, was buried, and rose again on the third day and then
went to heaven. They also both believe in Jesus Christ and that Baptisms are performed for the
remission of sins, although the age and decision process is

Color blind by the Counting Crows Essay
I am colorblind
Coffee black and egg white
Pull me out from inside
I am ready (repeat 3 times)
I am taffy stuck and tongue tied
Stutter shook and uptight
I am fine
I am covered in skin
No one gets to come in
I am folded and unfolded and unfolding
I am colorblind
Coffee black and egg white
I am fine (repeat 3 times)
The song Colorblind by The Counting Crows nothing less than perfect for the scene it was chosen
for in the film Cruel Intentions . It was played was one of the film s main characters lost her
virginity to another character. Though it was a... Show more content on Helpwriting.net ...
A taffy is a relatively sticky substance. This a clear representation of how stuck he is in terms of
his ambivalent feelings towards letting go of the pains of the past in order to enjoy the potential
happiness of the future. Tongue tied is a phrase frequently associated with the feeling of confusion,
and there is no better phrase for the situation. Stutter shook is exactly what it sounds like. It is an
indication of how shook up by the situation the writer is. Uptight is also has a direct meaning in the
sense of his general apprehension towards the situation.
The following four lines are repetition of previous lines and generally have the same meaning
behind them. quot;I am covered my skin, / No one gets to come in, / Pull me out from inside
quot;(10 12); these three lines by far has to be the most touching part of the song. It is actually
sort of self explanatory in a sense. By saying he is covered in skin it is analogous to having a
wall of defense up that no one can penetrate, hence the next line No one gets to come in (12). The
next line, I am folded and unfolded and unfolding (13). This shows that he has decided to open up
and shed the pain of the past and move on. The next lines are simply repetition and have the same
meaning as previously explained.
There are several poetic elements within the context of this song. Most notably is the most common
poetic element

Gospel Of Mark Odyssey
This narrative criticism was completed using online resources, comparative biblical texts including
the New King James Bible, New Living Translation, Revised Standard and American Standard
Version Bibles. The Gospel of Mark has no authorship specifically mentioned in its book, but is
traditionally attributed to Mark ,an associate of Peter, around AD 60 70 , it is also confirmed by
Church fathers around AD 140, although there is still some continued question as to its authorship.
Written to early Christian communities, most likely Gentile Christians in Rome, based on the
explanations of Jewish customs and the reference to Roman time system.
Mark 5:1 20, takes place around the Sea of Galilee. It is after Jesus begins his Galilean ministry. ...
They do not want the demonic possession in them and are willing to run off the cliff than be
possessed. This could be symbolism representing even the lowest of people, or those who are
seemingly lost and disconnected also recognize that they would rather die than live in a sinful
state. The disciples are also in this story, we see that they have no interaction with the man or his
situation but are observers. We also see that when the people reject Jesus presence the disciples
follow without any words. Some people are only meant to be observers of the miracle that takes
place in someone else s life as a means of increasing their faith in Jesus and what he can do. The
herdsmen also have a voice in the story, they were on a nearby hill with their swine grazing. They
lost their cash flow when this man was delivered from his demonic possession. This voice
symbolizes those around you who must also sacrifice for your breakthrough, willingly or
unwillingly.
Additionally, the crowd of people that were frightened by the exorcism and the subsequent
drowning of the swine also have a voice. These individuals were not witnesses to the miracle, nor
did they have the belief in what had happened or who performed the miracle to accept him in their
presence. Some people will never be a witness to the miracle that Jesus performs. These individuals
are left with the reality that they are not privy to the change that can

Club Med Research Paper
Vacation is a period of recreation, one spent away from home. My family and I take our
vacations in the summer when school ends because I do not like missing work that I will have to
make up in school. I adore ending school in June and then contemplating where I am going to
spend my summer vacation. Every year, my parents take my siblings and I to Disney World in
Florida, but this year we decided to travel somewhere divergent. We all decided to stay in Florida
and go to a captivating area called Port Saint Lucie. We stayed at a location called Club Med, which
includes a resort and many activities for people of all ages to do like volleyball, tennis; you name
it. Club Med was a magnificent experience for my familysince we all appreciate outdoor

Reflection Of Malcolm X s Autobiography Of Malcom X
Malcolm X (also known as el Hajj Malik el Shabazz) was born on the 19th of May 1925 in Omaha,
Nebraska and died on the 21st of February 1965 in New York. He was an American black Muslim
minister and a one time speaker for the National party of Islam. He also founded the Muslim
Mosque and the Afro American Unity which was an organization whose aim was to help black
people. In the autobiography, there are many episodes of his life but there are also many
reflections and part of his speeches, many focusing on white people. His opinion of the white part
of the society is detailed and precise and helps readers fully understand his ideas. Different racial
representations can have different types of languages depending also on the historical context in
which the text(s) are set in. The Malcolm X s autobiography is a great example of how language
can change in different terms and this will be discussed in this critical essay.
Malcolm X s autobiography represents white society in various different ways. The tone used
when referring to this race is usually ironic, the same he often used during his speeches that were
directed to people interested in race equality. Malcom X portrays the white part of society very
differently from the black one. For instance, the black part of the society is often treated in a better
way, they are often treated almost as a superior race than the whites because, reading this quotation,
they ... Show more content on Helpwriting.net ...
At that time these words could be used. In addition, the author of the autobiography, Malcolm X,
was an African Americanand so he was in a sense allowed to use them. Nowadays, in our society
these words cannot be used anymore. Interestingly, in the case of the whites, the words used can
still be used nowadays. This is because the word white is not considered racist since it is very
simple and it does not contain any diminutive or any type of insult like nigger or

The Legacy of NWA Essay
During the 80s a controversial group of rappers came together and changed the game of Hip Hop
for generations to come. Niggas with Attitude, otherwise known as N.W.A, was comprised of the
rappers; Ice Cube, MC Ren, Easy E, Yella, and Dr. Dre. Theses rappers spoke the truth about life in
the streets; the hustling, the trapping, the sexual encounters, the gang life, and the most important,
the racism. They shined a light on these issues in a violent, sexually explicit, yet intelligent and
revolutionary way. The Facebook page, *N.W.A* creates an environment that connects people of
all races, backgrounds, and ages; with the goal of immortalizing, and spreading the original
message of the group. How does one pay homage to such a... Show more content on Helpwriting.net
...
This album is revolutionary, just like all the best art has always been; revealing the truth. (Post
2) This portrays the true purpose of this page, to bring together different races and age group
with music while showing appreciate to the group that brought light to an important issue. From
her comment one can only assume that this lady was never a witness to any form of segregation
or racism where she grew up from. Perhaps she assumed that the way she was raised was the
same for everyone around the world. She writes how the group, NWA, woke her up. To what
exactly? The truth, which she wrote was revealed in her comment. The truth which she talks
about, refers to the harsh reality of life expressed in NWA s lyrics throughout each of their
albums. This page is an avenue for fans to come and share, how this group inspired them, and
introduced them to the truth. The woman mentioned in the quote did not grow up in Compton, or
Harlem. She wasn t raised in the hood/ghetto , she never had to deal with racism based on the
mere fact that she is a minority; yet she was able to relate to the lyrics, to find the truth behind the
words. That is the beauty of this Facebook page, connecting people from different backgrounds and
opposite sides of the earth with one common interest. Evolution is a principle that has been around
since the beginning of time. Majority of the things that we see, and use has

The Book Thhief By Sylvia Plath
Death is inevitable. Sylvia Plath, author of 1962 confessional poem, Lady Lazarus and Markus
Zusak author of 2005 historical fiction novel, The Book Thief explore the idea that a range
influences ultimately determine a person s final destiny. Zusak and Plath discuss this common idea
by utilising various literary techniques complementing the conventions of their respective text
types. Both authors highlight a range of key ideas such as, the idea that patriarchal standards within
society impact the protagonist s fate, the social influence relationships have on individuals and the
effect this has on their fate and the inevitable role death plays and the controlling influence death
has on life within their respective pieces.
Sylvia Plath and Markus Zusak both challenge the idea that patriarchal standards within society
influence the protagonist s fate in their texts. Sylvia Plath s Lady Lazarus is a reaction to the
oppressive nature of the patriarchy surrounding Plath during the early sixties. Lady Lazarus
reveals Plath s feelings of resentment in this semi autobiographical poem that grew from her
feeling trapped in a cyclical and oppressive environment. Plath employs allusion to the biblical tale
of Lazarus where she describes a, grave cave where she felt, at home. This captures Plath s
resentment towards the patriarchy as she feels that if she does not succumb to her desire to commit
suicide and thus control her fate, she will have to conform to the patriarchal

My Neighborhood
When I tell other students from New York City that I live in Bensonhurst, they often tell me they
have never heard of it. Often, I have never heard of the neighborhood they live in, even though
we all live in the same city. I think we all live in and interact in our respective bubbles, and
besides the periods we spend at work or school, we tend to keep ourselves exclusive to people
outside of them. There is nothing wrong with being selective with who you interact with, but those
self isolating behaviors encourage ignorance, especially during periods of rapid change in the
neighborhood.
My neighborhood is actually very aesthetically pleasing. The name of my neighborhood,
Bensonhurst, is actually shortened from Bensonhurst by the Sea, which is what a developer
named the resort neighborhood in order to sell more beachfront property. The aforementioned
sea is the Atlantic Ocean, though the sandy bay almost every avenue in the neighborhood has in
its street name (e.g. Bay Parkway) has been paved over to make roads and sidewalks (Frishberg).
Still, there are remnants of its coastal retreat past; there are benches, trees, walkways, and parks
right near the ocean. There are also playgrounds by every elementary school, and a city park or
green space if there are no elementary schools right nearby. Backyards, privately owned plots of
nature, also play an important role in my community. Most families in my neighborhood have
backyards, front yards, or both, and place value in

The Human Brain Is An Interesting Artifact
There has only ever been one animal that has ever had dominion over all biodomes in the Earth.
They re all over the world, and have been since nearly the beginning of time. It seems like
wherever and whenever you look, this animal is there. Please allow for the introduction of the...
DRAGON!!! Dragons are seriously everywhere. But why? Why is it that nearly every culture
developed the dragon individually? Well, since they ve been around so long, it could, be argued
that the dragon has been hardwired into the human mind. The human brain is an interesting artifact.
It can over complicate the simple and make a mockery of the convoluted. It can understand
something as easy as one two three and as crazy as those confounding emotions. Speaking of
which, what is emotion? Specifically, what is fear? What makes someone feel fear? Scientifically
speaking, ...fear is controlled by a small, almond shaped structure called the amygdala.
(Zielinski) Okay, so this little gland has the ability to make anyone suddenly lose control of their
cognition? Not quite, and not always. In a study done by Justin Fienstein, John Wemmie, and a
team of other graduate students from the University of Iowa, 3 patients who had suffered from a
disease called Urbach Wiethe Disease were put to the test of feeling fear. Urbach Wiethe damages
the Amygdala, causing those who suffer from this disease to not feel fear the way most people do.
Even after having a patient do things that would make most everyone s

Transformational Leadership Is Developing And Transforming...
As discussed in the text, transformational leadership is characteristic of a leader that helps bring
about major, positive changes by moving group members beyond their self interests and toward the
good of the group, organization, or society. The essence of transformational leadership is
developing and transforming people (Dubrin) . A perfect portrayal of this leadershipstyle is Walt
Disney. Walt Disney transformed the hearts and minds by setting forth a visionary reality. Walt
knew that by taking his visionary strengths and working with his brother to complement each other
s strengths that they would be able to foster a group of followers and visionary leaders working
with them. Walt led with four key tenants: Chase your dream, believe... Show more content on
Helpwriting.net ...
The second characteristic is enthusiasm. Walt motivated his employees and encouraged them to
inspire achievement. An enthusiastic leader keeps the employees engaged and more likely to keep
them of a positive mindset.
The third characteristic is confidence. Disney is famous for his quote It takes people to make the
dream a reality . Disney was confident in his ideals and his vision, and he was confident in the
people he had working with him to make it happen. He worked hard to instill that confidence in
those people around him. It takes true confidence in oneself to feel connected to and truly engaged
because not only do you know that those around you believe in you, but most importantly that you
believe in you. When a leader is confident those that work under that leader are more likely to
perform better because they are assured of a confident future.
The fourth characteristic is courage. Disney historian Craig Hodgkins said of Walt that he was
completely focused on his product and his goals, not on himself (ISU). By being able to do this,
the leader s energy is honed into the mission and not reflective of how one looks or appears and
exclusively about the brand.
The fifth characteristic is persistence. The things that are worthwhile are hard work. Walt
understood this and was persistent to the end. He set out to finish what he started. This is an
extremely important

Benign Prostatic Hyperplasia
Benign prostatic hyperplasia (BPH) is an enlarged prostate. The prostate goes through two main
growth periods. The first occurs early in puberty and the second begins around the age of 25 and
continues during most of the man s life ( Urology care foundation What is benign prostatic
hyperplasia (bph)?, 2016). BPH normally occurs during the second growth phase. As the prostate
enlarges it squeezes down on the urethra. The bladder wall becomes thicker and eventually
weakens losing the ability to empty completely. This causes urine to be left in the bladder. The
narrowing of the urethra and urinary retention cause many of the problems associated with BPH. It
is common in men and almost half of the men 51 to 60 have it while almost... Show more content on
Helpwriting.net ...
Since BPH cannot be cured treatment is focused on reducing symptoms. Deciding how to treat BPH
depends on how bothersome the symptoms are. The American Urological Association symptom
index is an interactive questionnaire that can help to identify how bad the patient s symptoms are
and guide treatment. Symptoms that are mild or do not bother the patient may benefit from just
watching them. Treatment of moderate to severe symptoms depends on how bothersome they are
to the patient. For those who feel their symptoms are bothersome, surgery maybe an option or less
invasive therapies such as transurethral microwave therapy or transurethral needle ablation.
Complications of BPH such as inability to urinate, urinary tract infection, bladder stones, kidney
damage, or ongoing blood in the urine should be treated with surgery. Alpha blockers relax the
muscles of the prostate and bladder improving urine flow and can be used in men with moderate to
severe BPH. Men with very large prostate glands may benefit from 5 alpha reducatase inhibitors
which block the production of dihydrotestosterone. Combination therapy maybe used for patients
with overactive

Rhetorical Analysis Of Patrick Henry
In the Patrick Henry s speech at the Virginia Convention Patrick Henry tries to persuade the
colonist to fight a war against the English, he does this through several main rhetorical strategies,
imagery, emotional appeal, and allusion. Patrick Henry uses imagery to get the listeners attention,
as he relates the to the dumb sailors who would get killed by the sirons cause they would be
caught in their beauty and singing. Patrick Henry uses emotional appeal to get the listeners on his
side, by bringing up slavery because if they do not fight back they can become slaves. Patrick
henry uses allusion so he can get the listeners to fight back, he butters them up and gives them a
couple reasons on why they should not fight back but then hit them with the news saying that they
have to fight back. Patrick Henrys speech was good because he used Imagery, Emotional appeal,
and allusion and that really grabbed the listeners attention and made them go to war.... Show more
He relates them as a dumb sailor that would get led into a trap by the beautiful sirons who would
get their attention by singing and when the sailors get close the sirons would attack them and kill
them. The listeners are the sailors because they are not willing to fight back for their freedom and
even their life. This makes the people put themselves in the sailors position and think about what
they are doing and they will soon come to realize that they will have to fight back. Patrick Henry
using imagery is really powerful in the speech because this is what made the people understand that
they have to go to

Zeitoun
In the book Zeitoun, the main character is a Syrian man from the Middle East who is Muslim.
He already has a hard time since 9/11 occurred and he is in the south, which is known for its
racism. His name is Abdulrahman Zeitoun. In this story, he starts off being strong, supporting
his family of six. He stays when the hurricane hits and everything in his life slowly spirals out of
his control. Zeitoun is a middle aged Syrian American that owns a painting and contracting
company with his wife. He is caring, helpful, prideful, and a trouper. Growing up in Syria, he
faced unworldly events, so moving to America seemed like an easy step in the beginning, away
from danger. Zeitoun is a man who perseveres and tries to never break a promise or be unreliable.

Certified Medical Assistant Dissemination Plan
Dissemination Plan The staff will be will be notified of the new pilot project to hire and only
have Certified Nursing Assistant and Medical Assistant administer medication, this program will
begin April 1, 2016. The current MEDT Techs that are not Certified Nursing Assistance or
Medical Assistance will have 1 year to obtain their certification for either field. The purpose of the
program is to ensure adequate learning skills and to have someone with foundational knowledge
of skills such as vital signs, basic knowledge of recognizing medical concerns and being able to
make notification to the appropriate person and then completing the directed tasks. The purpose of
this objective is to utilize this new research or evidence based information... Show more content on
Helpwriting.net ...
The ideal situation is to introduce the team to program and have someone in from a practicing
group someone on the staff s level of understanding that can share their thought about the
program that has already been practiced at a like facility, the group who is practicing will be
able to explain the program and can explain on their staff s level of understating (Melnyk Fineout
Overholt, 2005). Individual barriers can vary based on the audience, some staff members may
be less than forth coming do to their skill sets, their lack of confidence and their complaints of
doing more for less pay. It can be a challenge yet having them be a part of the decision making
will validate their concerns and verify where we should begin (Thompson, Bell Prevost, 1999). Just
keep the EBP positive and be willing to share the results (Melnyk and Fineout Overholt,

Understanding Loan Tranches And Mechanics ( Credit...
[The Credit Agreement]
[The Loan]
1.Amount and Terms of the Loans; Letters of Credit
2.Understanding Loan Tranches and Mechanics (Credit Agreement)
3.Tranches of Loans
A borrower will generally have various financing needs for its business, some of which may be
more appropriately met with a revolving credit facility and others more appropriately met with a
term loan facility. Revolving credit facilities permit the borrower to borrow, repay and reborrow
loans from time to time during the life of the credit facility, up to an agreed cap amount, so long
as the conditions to each borrowing are met. Term loan facilities are generally drawn all at once
and may not be reborrowed once repaid. For a borrower s ongoing business operations, a
revolving facility that allows it to borrow and repay as needed may make more sense than
receiving a one time term loan, while a borrower may want a term loan to fund an acquisition
where they will need to have the full purchase price available on the acquisition date.
In many financing transactions the borrower will want access to both a revolving facility and a
term loan. For example, to finance an acquisition, the borrower will likely want a term loan to
finance all, or a portion of, the purchase price for the target company and after the acquisition, the
borrower will likely need a revolving facility for working capital. To meet these needs, credit
agreements and facilities are often divided into multiple tranches each

Case Study Of American Airlines
Introduction Being the world s largest airlines regarding revenue and fleet size, American Airlines
operates extensive networks both the local and international. The company has its headquarters
based in Fort Worth, Texas. United Airlines is the biggest airline in the United States by some
destinations served. American Airlines becomes the second largest Airline regarding the number of
destinations served. It has a vast area of operation, operating from its main hub at Fort Worth to
Washington D.C. other hubs of operation are at, Los Angeles, Charlotte, Chicago O Hare, Miami,
New York JFK, York LaGuardia, Philadelphia, and Phoenix (McNally et al, 2013). The main
maintenance base for the American Airlines is at Tulsa International Airport. Environmental forces
that created the opportunity Many environmental factors created opportunities for American
Airlines, Inc. the first factor is increasing travel in general. Despite the many airlines that existed...
The first lesson that can be learned from the case study is that an organization should train its
employees. Training of employees helps the company to have a competitive advantage over other
businesses. The employees are competent and are advanced in technology. Another lesson from
the case study is a corporation should not focus only on the results. They should concentrate on the
quality of work instead of focus on the results. When people focus on the quality of work, they
will produce efficient work. When people focus on the results only, they work just to finish the
work but do not focus on the quality of the work. Individuals in an organization should concentrate
on the quality of the work instead of an emphasis on the end results. The final lesson is that
technology is important for an organization. A well advanced company regarding technology has an
added advantage over the other businesses that are far behind regarding

The Central Nervous System Cns
Impulses are transmitted from one neuron to the next through chemical and electrical conduction.
Presynaptic neurons conduct impulses toward the synapse while postsynaptic neurons conduct
away from the synapse. The electric impulse move from the first neuron, along the axon, to the
synapse at the synaptic knobs. Secretion of chemical transmitter into the synaptic nerve depolarizes
the membrane of the subsequent neuron. In its unexcited state, a neuron retains a resting membrane
potential. When the membrane potential is excited, the arrival of an action potentialat the synaptic
knob allows the neurotransmitters released into synaptic cleft to trigger an action potential in the
postsynaptic neuron (McCance Huether, 2014).
The central nervous system CNS is the main control center of the body that receives sensory input,
organizes and synthesizes it then provides instructions for motor output to the rest of the body. It
constitute of the brain and spinal cord. The brain consist of the cerebrum which regulates high level
functioning such as thinking, and the cerebellum which maintains coordination. The midbrain,
pons and medulla are part of the brain stem and they control lower level functioning such as
respiration. The spinal cord joins the body s main receptors, and functions as a channel for sensory
input and motor output.
The peripheral nervous system (PNS) constitute of the cranial and spinal nerves. The PNS provides
the connection between internal or external stimuli

Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus.
In order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The
results for my DNA was not able to be determined through sequencing. The DNA samples of the
class recorded that 62% of the participants were tasters (carries the allele at the TAS2R38 locus)
and 38% of the participants were non tasters (does not carry the allele at the TAS2R38 locus).
Objective: The objective of the project is to be able to determine which alleles are carried at the
TAS2R38 locus and verify if the genotype reflects the expected phenotype. Methods:... Show more
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a
flavor and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng
/ВµL (6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/ВµL DNA /100 ВµL H2O). The DNA
sample was divided by 100 ВµL instead of 25 ВµL of H2O because the sample was diluted 4
times. Experiment 3: The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The
reverse primer found is 5 ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work
for my obtained DNA as there was no evidence of movement of the DNA. PCR did work for lab
numbers 33 and 12. The size of my fragment could not be determined and cannot compare to the
size that was expected. The negative control was clean as there was no traces of movements.
Experiment 6: The DNA concentration after TAS2R38 PCR purification and quantification was
0.344 ng/ВµL (34.4 ng/mL). My genotype at the TAS2R38 locus was not determined by the
sequencing. The genotypic frequencies of the class obtained by sequencing: 0.4 (40%) TT, 0.4
(40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class obtained by sequencing: 0.6 (60%) T
and 0.4 (40%)

Red Dog Research Paper
I have been seen many of family movies and animal movies that quite fun to watch but there is
one remarkable and very excellent family movie that I just watch a month ago. The movie that I
just recently watch called Red Dog . Red Dog is a movie that very clever, funny ,very entertaining
and I can watch it over and over again.
The tale of the Red Dog captured the imagination of many people. Based on the Louis De
Berniere book and then the story was adapted into the Australia film RED DOG that was
released in 2011. I haven t yet read the book but I am recently searching to buy it online thought
the internet. In this movie, the star of the film was Koko , a stray Kelpie who portrayed RED
DOG . Red Dog is the most popular Australian movie of the past year. The family drama movie
about a hitchhiking that live and work in Western Australia community in the 1970s, a variety of
tough guys relate how the Red Dog became a local legend around the remote coastal town of
Dampier and brought together a community of lonely working men.
The Red Dog steals my heart, he don t have to dance or do much thing in the movie like another
animal movies but Red Dog can has expression that make me follow his story and the town. This
movie is very cleaver and very interesting that all the man in town talking about the story of Red ...
It will bring laughter to everyone too. The stories on how Red dog by everyone that impacted
their lives and the lives in the mining town, and how the town got changed through their red
friend was emotional and the film has it quirky characters and comedic situation, being funny
without really trying too hard. In the movie everything felt as natural as it can be with Red dog
and the town friendship slowly grow on. This film to me very genuinely on how the story go on.
You will laugh, you will cry and you will love to watch it

Analysis Of Eternal Sunshine Of The Spotless Mind
The film Eternal Sunshine of the Spotless Mind directed by Michel Gondry follows two ex
lovers during their breakup. The protagonist of the movie, Joel Barish, is a middle aged man
living in Long Island that lives a dull life. However, this all changes as soon as he meets a young
woman at a party named Clementine Kruczynski. Immediately drawn to her colorful personality,
clothing, and hair Joel became engulfed in her, wanting to know all of her interworking s and
emotions. It didn t take long for the two to become romantically involved and begin dating. The
pair were together a while, but they began having frequent altercations and realized that life may
be better without each other. A few weeks after the split Joel decides that he wanted to get back
together with Clementine and visits her place of work on Valentine s Day. While there, he
engages in a conversation with Clementine but to his surprise she has no recollection of him.
Soon after his encounter with Clementine, Joel learns that his ex girlfriend hired a company to
erase her memory of him. Hurt by the actions of his ex lover, Joel decides to hire the company to
do the same. The rest of the movie then follows the deletion of Clementine from Joel s memory by
revisiting all of their significant moments together while he is in a sleeplike state. Mid deletion,
Joel decides that he has made a terrible mistake and tries to do everything in his power to prevent
wiping the memories of his beloved. Unfortunately,

A Concrete Human Existence, And The Conditions Of Such...
Juan Linares
Mr. Maust
English IV AP
26 September 2015
Thematic Project Outline
Introduction
Thesis.
Existentialists focus on the question that is a concrete human existence, and the conditions of such
existence; they do not dwell on a hypothesis for human essence, instead they stress that this
essence is determined by an individual s own life choices. Although humans live in the world, a
distance is created in order to add meaning to the disinterested world; however, this meaning is
fragile and can be disturbed by tragedy or insight. When this disturbance occurs, and human s
precarious lives crumble, the true nature of the world is revealed; a nature that shows little
importance for humans; this way of thinking created the, post WWII era, worldwide explosion of
ambiguous literature, and the sensory perception of art and music; heavily influenced by the idea of
human worthlessness.
Literature Existentialism, though it had been present since the 19th century, came of age in the mid
20th Century. This was largely through the scholarly and fictional works of the French
existentialists, Jean Paul Sartre, Albert Camus and Simone de Beauvoir. The heavily influenced post
WWII movement spurred up a whole new way of thinking. Sartre made the movement popular in
that he defined Existentialism and wrote many works solely centered on his views.
Simone de Beauvoir An important existentialist who spent much of her life alongside Sartre, wrote
about feminism, and existential ethics

Costa Rica Essay
Costa Rica
Costa Rica is a Central American republic located north of Panama and possessing two seacoasts
(Pacific west, Caribbean east). The capital and largest city, San Jose, is located in the central
mountain valley. Costa Rica is notable among many Latin American countries for its long standing
democratic form of government. Costa Rica is well known for their hydroelectric plants and
agricultural goods.
I. Government:
1) Capital: San Jose
2) Country: Costa Rica
3) There are presidential elections every 4 years.
4) Costa Rica has a Democratic Republic.
a. The president of the Republic of Costa Rica is Miguel Angel Rodriguez. Which is part of the
Christian Unity Party
b. Costa Rica is constantly ... Show more content on Helpwriting.net ...
a. It s expected to double in the next few years
3) There are really only one chief language there:
a. Spanish
b. English is spoken in few of Costa Rica s provinces.
4) The main religion in Costa Rica is Christianity, 95%, but there is a small percentage of other
religions like Jewish, and Muslim.
5) After the revolution in Costa Rica in 1948, the island has become a tourist attraction and has
gotten many more cultures brought to its lands. The percentage of Costa Ricans in Costa Rica is
over 70%, but many people from the other South American countries have imported there for a
better life and education.
IV. Customs and Practices
1) There holidays are much like America s holidays:
a. They have a Christmas and New Year holiday
b. Another important holiday in Costa Rica is Semana Sante or Holy Week.
c. There national holiday is Independence Day, September 15, 1821
d. Festivals of saints are a colorful part of town life.
2) If the persons that are to be wed are Catholic the ceremonies are much like Catholic marriage
ceremonies in the US. But on many occasions they are on the beach and have more of a colorful
and fun ceremony instead of the traditional black and white wedding ceremonies.
3) Popular instruments are
a. the guitar,
b. accordion,
c. and mandolin.
V. Livelihood

1) Costa Rica s chief source of revenue is (they make 1.1

Psychosocial Interventions
In the study by Bogenschutz, Forcehimes, Pommy, Wilcox, Barbosa, Strassman (2015) the
researchers aim to show that the effects of psilocybin (magic mushrooms) on alcohol dependent
participants is an avenue worth exploring. Specifically, this paper focuses on the influence of
psilocybin on intervention outcomes. Participants took part in a 12 week program, the
administration of psychosocial interventions (2015) took 12 of the 14 sessions available. In other
words, psychologists would try to assist the participants with alcohol dependence by administering
interventions that increase their motivation to stop drinking. Among the sessions, the
administration of psilocybin was the focus of two. Results showed that the participants generally had

Comparing Linus And Lucy Van Pelt
Linus and Lucy van Pelt are two of the most iconic characters to exist in the comic universe.
They are constantly paired together, and even have a song written about them named Linus and
Lucy by Vince Guaraldi Trio, performed for A Charlie Brown Christmas. This brother and sister
dynamic duo is also known for their subtle similarities and utmost personality differences.
Despite being siblings, Linus and Lucy have extremely opposite personalities. Linus and Lucy
van Pelt are both significant characters created by Charles Schulz. Lucy was introduced in March
of 1952, while Linus was introduced in September of the same year. Lucy, the older sister of
Linus, took it as her duty to protect him from everything that could possibly happen to him. She
takes care of him to the best of her ability when he was young. Lucy does things such as place him
in front of the television (too... Show more content on Helpwriting.net ...
Lucy is known to the readers as being the crabbiest one of the bunch. She is continuously sassing
people if they disagree with her, and sometimes she just goes out of her way to annoy people. In
addition, the reader learns that Lucy has won the World s Number One Fussbudget Award three
years in a row, which just further proves how crabby she constantly is. When Schroeder
continuously denies her love, she just becomes angrier. There was one day where she was
talking with Schroeder and he was not accepting her affection, and so instead of just respecting
his opinions, Lucy made sure that everyone would know she was in a bad mood for the rest of
the day. Sometimes, Lucy is crabby just to be crabby. Linus made sure to tell her on the one
thousandth day in a row she was crabby, and there was no justifiable reason for her to be so
crabby all of those days. Lucy then contemplates whether she should continue being crabby, and
finally decides that she will continue the tradition because she does not want others to be happy
with a not crabby

Child-Rearing Traditions
A) Hunter gatherer/food forager is a lifestyle where people lived by foraging or killing wild
animals and collecting fruits, eggs, nuts, roots and berries for food while farming were those that
depend on agricultural practices for survival. They relied on their wits and muscles to acquire what
nature provided (page 103). Foodforager avoids food production simply because of the hard work
it involves. They tend to have more time for play and relaxation than food producers (page 107).
On the other hand city dweller/food producer/gardener works longer hours compared to most food
foragers. They have deprived themselves of more and more of the land base necessary for their
way of life, foraging has become more difficult. The competition for resources... Show more content
on Helpwriting.net ...
In my culture, children are expected to follow the rules established by our parents. There is a
punishment for behaving badly or for a doing something wrong. We can t earn what we want
until we have a family talk about what we did wrong. For example, important family decisions
must be collectively accepted and followed. Getting training from our parents helps our children
to keep potential problems under control. Within my culture, eating and sleeping habits have
changed. Watching tv, playing video games, using social media all these factors lead to less
sleep. These days we can t even have a family dinner together than we used to have without
electronics and because everyone is busy with their lives. All these factors have changed us
because life is nowadays. As for eliminating, I would probably have to say in my culture it hasn t
changed much. Culture is a major factor in our lives. Our culture may determine when we sleep,
what we wear and what we eat. It may tell us what is right and what is wrong, and how to bring
up our kids. Culture strongly influences our thoughts, opinions, attitudes and behaviors. It impacts
on the way we take care of ourselves and our loved ones, the way we dress, eat, sleep and live our

Essay On Why Was The American Colonists Justified In...
The American colonists were justified in waging war and breaking away from Britain for many
reasons. I believe this to be the truth because Great Britain did unlawful deeds against the
colonies including passing taxes, injuring the innocent, abusing their power, and not being able
to reason with the American colonist. Some of these actions were out of greed while some were
out of spite. These many wrong doings caused the Americans to build up anger. Once Britain
pushed the colonists over the edge, there was no turning back. British parliament s main goal
regarding the colonies, as stated by John Dickinson in Letters From a Farmer in Pennsylvania,
was to regulate trade. Regulating the colonial trade would suppress their economy allowing Great
Britain to take control of it. However, after the passage of the Stamp Act, it became clear that
parliaments greed had finally shown through. The reason for the Stamp Act was to allow the
British to financially benefit from the hard work of American colonists. In the year 1765 it was
hard for most colonists to provide food for their families without extra costs. After the Stamp Act
was passed, finding the means to get food became almost impossible. Passing Acts that the
American Colonists had no vote in is just one of the many wrong doings that the British did... Show
more content on Helpwriting.net ...
British parliament and King George the third sent soldiers to the colonies to protect the Americans
from various things including, but not limited to, soldiers from other countries. However, on this
one fateful day now known as the Boston Massacre, there were eleven colonial casualties. The
colonists were doing things to the British soldiers, like throwing snowballs at them, but the soldiers
had guns. A snowball won t kill somebody, but a gun can. These British soldiers took advantage of
their power that was initially used to protect the Americans (Doc

Architecture Of The Colosseum
Once the Colosseum had been built, it seems to have become the model for many, if not most, of
those that followed (Hopkins and Beard 2005, 24). The Colosseum stands proudly upon the
villainous Emperor Nero s once grand Valley of the Golden House, projecting the munificence of
Imperial Roman Architecture. Its ultimate design could be said to be formed through purpose or
function. However, this does not do justice to the importance of architecture within Roman society
(Thornton and Thornton in Lyes 1999, 2). The functions, whether it be religious or otherwise, of the
Colosseumwere irrelevant to the ultimate design of the architecture, as the architectural features
contained within the Colosseum s ultimate design created an instant archetype, a marker of
Romanness across the empire (Hopkins and Beard 2005, 25). The clever use of the classical orders
and faГ§ades, and adaptation of existing Roman architecture of the period allowed the Colosseum
to become a model for many subsequent Roman amphitheatres, whilst showing the ingenuity of
Roman architecture of the period.
The architectural vocabulary of the Colosseum saw the clever use of existing Roman design
practices to create a final structure which became a precedent for all Amphitheatres which followed.
Thus, highlighting the overriding importance of the aesthetics the ultimate design displayed. The
importance of the appearance in the final design s architecture begins with the conventions which
were used for

The US Patriot Act
Introduction Americans have always held the rights and liberties close to their hearts. Ever
since we became an independent nation. After the tragic events that happened on September
11th, 2001, Citizens of America began to ponder if some of their rights and liberties should be
sacrificed to prevent such an attack in the future. National unity took over the country and
Americans bonded and held each other up. They stood up in the face of terrorism and the
Presidents approval rating soared through the roof (from 54% to nearly a whooping 86% which
is the highest level it has ever been). Sadly, the American public rallied behind the Government
and provided support for an Act that will come to violate their freedoms that they cherish so
much. Congress drafted the US Patriot Act in only 45 days (which leads some to believe that it
was already pre made and was just a combination of a wish list that the FBI had and was waiting
for the right time to implement). Still filled with a sense of national pride and deeply scarred by the
terrorist attacks which occurred on September 11th, 2001, americans accepted the Act to blatantly
avoid being labeled unpatriotic in the eyes of their peers and government. Still, in the face of being
labeled unpatriotic , many thousands of open minded individuals who saw what this Act could in
the future openly question the Government though their cries where heard by mute ears. When the
House sent the US Patriot Act to the Senate for approval in 2001,

Constellation Monoceros In The Milky Way Galaxy
Amongst the many vast planets in our galaxies, with many different characteristics and attributes,
there is just one that stands out in the midst of all the others, Corot 7B. This planet is the smallest
exoplanet that has been found outside of our solar system that orbits another star. This fascinating
planethas a bright yellow color and is about twice the size of Earthand practically flows lava and
rocks. This planet has temperatures ranging from 3,300 to 4,700 degrees Fahrenheit, literally
making it anyone s worst nightmare. This would have to be the epitome of what hell would look
like or at least feel like.
Discovered on February the 3rd, 2009, we find a gaseous planet that is in the Constellation
Monoceros in the Milky Way Galaxy. Formed

Male Dingoes Essay
Dingoes reproduce once per year, depending on the estrus cycle of the female dingo. The estrus
cycle usually comes once a year, but can come twice although the female dingo can only become
pregnant once a year (with the second time only seeming to be pregnant).
Male dingoes in most regions are virile throughout the entire year, but usually have a lower sperm
production in the summer. During studies on dingoes from the Eastern Highlands and Central
Australia living in captivity, no breeding cycle was noticed. The breeding was only regulated by
the heat of the female dingoes. A rise in the testosterone was observed in the maledingoes during
the breeding season (1 March 30 June), but this was shown to be linked to the heat of the female
dingoes and copulation. In contrast to the captive dingoes, captured dingo male from Central
Australia did show a male breeding cycle. The captured ... Show more content on Helpwriting.net ...
During the mating season, dingoes actively defend their territory by using vocalisations, growling,
barking and dominance behaviour.
Most female dingoes living in the wild begin breeding at the age of two. Within their packs, the
alpha female goes into heat before the subordinate dingoes and suppresses mating attempts from
the other female dingoes. Male dingoes become sexually mature between the ages of one and
three. The exact beginning of breeding depends on age, seasonal conditions, geographic range and
social status. Among dingoes living in captivity, the pre estrus can last up to sixty days in the wild.
Generally, the only dingoes that can successfully breed in a pack are the alpha male and female,
so the other dingoes help to raise the dingo pups. The subordinates are actively prevented from
breeding by the alpha pair although some subordinate females have false pregnancies. If the pack
structure breaks up, low ranking or lone dingoes can successfully

Gender Issues Of Danish Sports Organizations
In Gertrud Pfister s article, Gender Issues in Danish Sports Organizations Experiences, Attitudes
and Evaluations, there is a discussion as to whether women are indeed treated differently in higher
positions of power in Denmark. Pfister uses statistics and studies to prove her argument that women
are indeed treated differently and presented differently in the organizations. She even begins to
touch on the fact that men and women are portrayed wrongly in the studies she talks about.
Throughout the article women are presented in a mann that suggests they could not possibly be an
ideal leader in the ways that men can nor can they deal with responsibilities of such a job.
Pfister makes Denmark s position on women being equal to men and deserving of the same
opportunities as them known but adds that they re still under represented (27).Women are free to
join the same workforces as men and partake in the same activities as men but how they are treated
within these occupations is what she finds compelling. Pfister aims to identify reasons for the
existing gender hierarchy (27) and accomplishes this by using the results of quantitive surveys
on Danish sports leaders performed by herself, her peers and those who have wished to
investigate this topic as well. We as readers can see for ourselves that throughout the world the
power appears to be in the hands of men (27). For example, how many world leaders do we see that
are of the female sex? According to Time Magazine there

The Importance Of The Fourth Amendment
A The Fourth Amendment in the Bill of Rights was ratified on December 15, 1791. This
Amendment protects people from the police searching their homes and private property without
a properly executed search warrant. The right of the people to be secure in their persons, houses,
papers, and effects, against unreasonable searches and seizures, shall not be violated, and no
Warrants shall issue, but upon probable cause, supported by Oath or affirmation, and particularly
describing the place to be searched, and the persons or things to be seized ( Annenberg
Classroom, 2006). B The Fourth Amendment protects people against unreasonable searches and
seizures by government officials. A search can mean everything from a frisking by a police
officer to a blood test to a search of an individual s home or car. A seizure occurs when the
government takes control of an individual or something in his or her possession. Items that are
seized often are used as evidence when the individual is charged with a crime ( Annenberg
Classroom, 2006). This amendment is meant for agents of the government, it does not apply to
people who do not belong to the government.... Show more content on Helpwriting.net ...
But it does not restrict all searches. For example, courts have ruled that school officials may
search school lockers and require that students who participate in extracurricular activities undergo
random drug testing ( Annenberg Classroom, 2006). This amendment gives people a right to
privacy. This amendment can be bypassed by police if they have a reasonable cause to search,
which is typically when people feel like their rights are being

What I Will Talk About
What I will talk about:
Introduction
Changes over time: o Maori s depicted as brave warriors o Now depicted as dangerous, violent,
druggy s, drunks
Stereotypes
Text 1: Once Were Warriors o Negative representation to Maori s o Term Warrior has changed over
time o Violence
Troubled Heke family
(25.29 25.48: Jake abuses his wife: Shows that Maori s are violent. The kids look scared.)
Diagetic sound in the house makes viewers understand more what the trouble is like to live in the
troubled Heke familiy s house.
Text 2: Legend Drunk Driving Advertisement o Negative representation to Maori s o Maori was
foolish to even consider driving home
Text 3: Cartoon
Conclusion
Oral:
Q: Why did the Maori cross the road on ... Show more content on Helpwriting.net ...
Perhaps you think of New Zealand and you think about the culture of the Maori s. Or... maybe you
think about somebody extremely violent, dangerous, lazy, big, dumb. Maybe you think about them
doing drugs, smoking and drinking. These negative words that I have just said have been made
into Maori stereotypes over the years. The jokes I started this presentation with show a few of these
Maori stereotypes. I will be exploring these stereotypes and the representations of the Maori s
through different texts.
Many years ago, the Maori s were seen as brave warriors. Through films, advertisements,
cartoons, jokes, books and even stamps, the Maori s have been made to be viewed in a negative
light. The texts that I will be exploring include the film Once Were Warriors , the Legend Drunk
Driving ad and also a cartoon.
In society and the media, the Maori s are rarely given good impressions. Also, what is shown
regarding the Maori s is actually quite limited. However, when we do see them, we see them
shown in a negative way, and, therefore, we feel obliged to believe that the negative stereotypes
portrayed are all that the Maori s are.
My first text that I will be showing you, is a great representation of this. Once Were Warriors is a
film that was made in New Zealand in 1994. It is about the Maori life and it shows this by
following the troubled life of the Heke family. The message of the film is to show viewers how the
definition of a warrior has

Comparison Essay Beowulf
In beowulf there are three major battles that Beowulf participate in. The first battle is the battle
against grendel which is then followed up by the battle against Grendel s mother, and then finally
the last battle takes place against the Dragon. In all three of these battles Beowulf shows great
courage and manages to defeat all of these monsters. Although beowulfwas able to defeat these
three monsters they were different in some ways but also had some similarities. The first battle
takes place against Grendel. Grendel is a demon who descended from Cain. He is a very evil
monster who kills many people before beowulf hears about what has taken place. When he finds
out beowulf travels to the town to put an end to this monster. He waits in the mead hallfor Grendel
to strike again. At first no one believes that beowulf was strong enough but in fact he was. Unlike
when beowulf was fighting grendel s mom, beowulf puts aside his armor and sword to fight with
just his hands. Grendel proves to be no match for beowulf as he easily defeats the the monster.
This is where the first two fights different from one another. In the first fight beowulf for the most
part easily defeats grendel but when grendel s mother finds out and seeks revenge beowulf has to
put up a much harder fight because grendel s mother is much stronger... Show more content on
Helpwriting.net ...
The first major difference is that the dragon has no relation to grendel and grendel s mother
whereas they did. The fight with the dragon also occurs much later whereas the fight with grendel
and his mom happened within days of each other. These differences were major but not the biggest
and most dramatic difference between the three. In the other two stories beowulf shows confidence
that he will prevail without dying. In the third story beowulf prepares to die in battle. He knows
that the dragon is the strongest of all three of the monsters and knows that he will not make it

Analysis Of Disney s Disneyland Paris Essay
Assessment 1
Buyer Behavior MKT 220 Student Name: Lutoosha Oza
ID No: 14095225B
Stream B
Date: 11/05/2015
Tutor Name: Anika Vats
PART A
Question 1 : Which strategic action Disney took in terms of consumer focused initiative? Give
examples.
Walter Elias Walt Disney (December 5, 1901 December 15, 1966) was an American entrepreneur,
cartoonist,animator, voice actor, and film producer. He and his staff created numerous famous
fictional characters including Mickey Mouse, Donald Duck, and Goofy. These cartoon characters
became so famous that he designed theme park for the entertainment of children and family in
U.S.A. Disney then thought to spread the theme parks around the world. Therefore Disney theme
parks were opened first in Tokyo, Japan called Disney Resort which became sucuessful by luck.
The second theme park was opened in Paris called Disneyland Paris which became unsuccessful
because of the cultural differences between U.S and Paris. Keeping this problem in mind, Disney
opened third theme park in Hong Kong called Hong Kond Disneyland which became successful.
Here Disney had strategic plan in terms of consumer focused initiative. A consumer initiative often
includes steps for a company to increase sales by differentiating products in the marketplace,
marketing goods or services to new demographics or creating a new customer service function to
handle customer requests.
Paris
When Disney had project to open theme park in Paris in 1992, they were

unit 20 p3 level 2 business
Describe financial products and services appropriate to self.
Features:
Although there are many types of financial product, there are a few features that are common to
several of them.
Borrowing several products enable customers to borrow money these include loans from banks and
finance companies, overdrafts, credit cards and mortgages. All loans have specific requirements
such as interest to be paid and a timescale to repay the amount borrowed.
Saving/ investing this is where money is deposited in an account and is available for later
withdrawal. Normally interest is paid
Risk some type of savings, such as company shares, involve the risk that some or even all of the
money invested could be lost.
Current accounts: ... Show more content on Helpwriting.net ...
This means that after this period you will have to pay your monthly mortgage repayments yourself.
Credit and store cards it generally pays off a percentage of your outstanding balance or the
minimum payment each month for up to a year. Check which option is being offered. This means
that you may still have to pay any balance left after this time. The insurance typically only provides
cover for the amount you owe when you make a claim, and not any balance you build up after this.
Loans it covers your monthly repayments for the loan, generally for 12 or 24 months. After this
period you will have to pay your monthly loan repayments yourself.
If the insurance for any of these products contains life insurance, then the cover will generally pay
off the balance of the debt covered if you die. If the claim is for disability, the monthly repayments
may be paid to the end of the life of the loan.
You should read the key policy information that comes with any policy you take out. This sets out,
amongst other things, the main features and benefits of the policy as well as any significant or
unusual exclusions and how long the cover lasts. If unclear ask the salesperson to go through it
with you and make sure you re happy before you take it out.
Life assurance:
There is an important difference between life insurance and life assurance. In the case of life
insurance, in return for a premium the insurer will pay an agreed amount if the insured person dies
within

Nonverbal Communication Journal Analysis
While I was reading chapter 6, nonverbal communication, it was interesting reading about how
much people communicate without using words. Before reading this chapter, I had no idea that
there are so many types of nonverbal communication. One of the major ways that we nonverbally
communicate is through facial expressions. Personally, I have never considered touching someone
as communication, but it really is. For example, if someone is sad and are given a hug it is telling
that person that they care about them. The three terms that I will be addressing in my journal are
emoji, gesticulation, and personal distance. The first term that I will be addressing is emoji. The
textbook defines emoji as cartoon depictions of faces and other objects .... Show more content on
Helpwriting.net ...
Although my friend was deaf, that didn t stop him from having a normal life and having friends
because he had sign language. When I sent text messages I tend to use a lot of emoji s because it
puts fun into plain old texting. Out of these terms I think that personal distance is on that I can
relate to more. Although I don t mind it when people stand close to me, when I am trying to
complete something and someone stands over the top of me I can feel them saying hurry

The Battle Of Lancaster And The House Of York Ending The...
The battle of Bosworth was the last battle of major significance for the House of Lancaster and
the House of York ending the civil Wars of the Roses. [5] Henry Tudor, Earl of Richmond
brought in the house of Tudor closing the Plantagenet dynasty.[5] The ending of the wars put to
rest the feudalism because of the great loss of property and lives of the nobles making it difficult
to protest against the strength of the Tudor monarchy. The problem came about from financial and
social trouble that followed the hundred years of war, along with the weak ruler ship of Henry VI.
Richard in his first and only parliament wanted three main areas of legislation to be covered: the
ratification of himself as king, passing of acts of attainder... Show more content on Helpwriting.net
...
David s.[3] A struggle between the House of Yorkand the house of Lancaster broke out; which
became a series of wars known as The War of the Roses. The kingship was based on the royal
bloodline and the kings relied upon the support of the powerful Lords to keep their position. [5]
Both Henry Tudor and Richard III believed each had claims to the English throne as they were
both descended from Edward III.[2] Henry Lancastrian s claim to the throne was from Edward
III s son, John of Gaunt, 1st Duke of Lancaster.[2] In 1339 Henry of Bolingbroke; John s son
imprisoned, Richard II who was the son of Edward, the Black Prince..[2] Henry IV became king,
passing his crown to his son Henry V who passed the crown to Henry VI. Henry VI was becoming
unpopular, due to corruption within his government, his policy of peace with France and the
economic situation in

Destruction Of Anti-Intellectualism In The United States
Intellectuals Destruction
Anti Intellectualism is defined as a person opposed to or hostile toward intellectuals and the modern
academic, artistic, social, religious, and other theories associated with them. Anti intellectualism
defines a person who believes that intellect and reason are less important than actions and emotions
in solving practical problems and understanding reality. Anti Intellectualism is an epidemic worth
acknowledging; its prevalence in America is one of the nations most major hindrances to solving
the problems it faces collectively. Anti intellectualsentiment has its basis mostly in
misunderstanding, but a persistent stream of misinformation spewed by the impassioned yet
hollow rhetoric of shallow politicians and self proclaimed orators has only served to maintain
ignorance. Here I hope to explain the history and causes of anti intellectual belief as it has
manifested and grown in the United States of America and to demonstrate the detrimental effect it
has had and will have on our nation, continuing on to encourage whoever might view this essay to
reverse this trend by embracing objective problem solving and developing an interest in critical
thinking and the sciences.
America, although still young, has grown further into industrialization and exceeded in momentous
discoveries in science and mathematics; yet still harbors ill will against intellectuals and
knowledge. The population of America was still largely rural in the 19th century, agricultural

The Setting for Thomas Hardy s The Withered Arm and Other...
The Setting for Thomas Hardy s The Withered Arm and Other Wessex Tales
In the following essay I seek to show evidence of how Thomas Hardy was acutely aware of the
social status of people, how village and town life was conducted, how men and women reacted to
their own sex and to each other and the part religion played in people s daily lives.
Social class is raised a lot in Hardy s pieces. Even though these stories were all written at a different
time and then put together, you can see it is a strong theme in the book.
In the Withered Arm, there is instantly a strong sense of upper and lower class. You learn of a
milkmaid named, Rhoda Brook, and hear of her story among gossipers at the farm. She ... Show
more content on Helpwriting.net ...
This also shows that Mr. Twycott really cares for Sophy, as marrying someone from a lower class
is like, Social suicide.
Sophy and Mr. Twycott move to London where people would not know of their sin, Mr. Twycott
dies, leaving Sophy a large sum of money, a son and in a higher class. London is described as a
snobbish place and the people living there do not get on with Sophy because of the way she
speaks, Гўв‚¬В¦but she still held confused ideas on the use of was and were , which did not beget
a respect for her among the few acquaintances she made. This shows the city folk to be of a
higher class compared to the lower class country folk, and how they are snobbish and vain. In
country life it does not matter the way you speak, but who you are inside.
A big comparison has been made in this story between men and women. Even though Sophy was
older and the one to inherit her husband s belongings, the son takes charge, She was left no
control over anything that had been her husband s beyond her modest personal income. Her own
child would soon take over being the man of the house, The completion of the boy s course at the
public school, to be followed in due time by Oxford and ordination, has been all provisioned and
arranged. This shows that in these times a woman s job was none at

Essay On Performing Enhancing Drugs
Performing Enhancing Drugs and the World of Sports Sports has become one of the most
impactful and influential parts of our culture. Sports has cemented itself as a standard part of
society. In fact, taking a look back on myself and coming from an athletic background, growing up
my mom would always put me in a variety of sports. When I reached high schoolage something that
was always drilled into me by my coaches was the aspect of hard work. During my high school
sporting career there was a multitude of setbacks and failures Coach Hosner who was my coach at
the time, would always give me some sort of motivational snippet on hard work, and with it how
anything could be accomplished. However, in today s professional sportsworld there... Show more
Firstly, taking a look at high school athletes PED s can market themselves to high school athletes
as a quick and easy way to increase their strength and athleticism. Correspondingly a survey was
taken on high school students, and their relationship with steroids found that Researchers
reviewed rates of performance enhancing substances from survey data collected from 67,200
students. The sources of the data included Monitoring the Future, the Partnership Attitude
Tracking Study, and the Youth Risk Behavior Surveillance System. Overall, between 3.2 and 7
percent of students report trying, at least once, anabolic steroids, a slight increase from the 5
percent reported in 2012 (Krans). All in all it s clear that when it comes to the high school level
there is a clear increase in the experimentation of PED s. For the high school athlete the usage of
illegal drugs such as anabolic steroids has the potential to turn into a deadly cycle as they can
become solely reliable on the drugs and not their training or coaching. In contrast, the use of PED s
could help the high school athlete propel themselves to play at

How To Write A Good Hook For An Persuasive Essay

Recommended

Recommended

More Related Content

Similar to How To Write A Good Hook For An Persuasive Essay

Similar to How To Write A Good Hook For An Persuasive Essay (20)

More from Mary Bettin

More from Mary Bettin (20)

Recently uploaded

Recently uploaded (20)

How To Write A Good Hook For An Persuasive Essay