First part of the phage annotation workshop at the 2016 EMBO Viruses of Microbes Meeting (Liverpool, UK), presented on 21 July 2016 (http://events.embo.org/16-virus-microbe)
RAD: Christian J. Stockert Jr, Junmin Liuniranabey
The Penn Experience with MAGE-TAB involved loading 22 studies from various species including human, mouse, Plasmodium, and Toxoplasma into their local database using MAGE-TAB over the past year. They generated MAGE-TAB from templates and downloaded studies. Lessons learned included that providing templates with fillable areas colored was helpful for submitters, but biologists found the format difficult to understand without assistance. Their tools help with validation, loading, and visualization of MAGE documents.
The application of pooled milk for foot-and-mouth disease surveillance in Nak...EuFMD
The 2018 Open Session of the EuFMD Standing Technical Committee was held in Borgo Egnazia - Italy, 29-31 October 2018 . The session theme was on global vaccine security
The European Commission for the Control of Foot-and-Mouth Disease (EuFMD), one of FAO’s oldest Commissions, came into being on the 12th June 1954, with the pledge of the sixth founding member state to the principles of a coordinated and common action against Foot-and-mouth Disease.
Rapid, on site, diagnosis of FMD and safe and cost-effective shipment of samp...EuFMD
The 2018 Open Session of the EuFMD Standing Technical Committee was held in Borgo Egnazia - Italy, 29-31 October 2018 . The session theme was on global vaccine security
The European Commission for the Control of Foot-and-Mouth Disease (EuFMD), one of FAO’s oldest Commissions, came into being on the 12th June 1954, with the pledge of the sixth founding member state to the principles of a coordinated and common action against Foot-and-mouth Disease.
The Opera of Phantome - 2016 (presented at the EMBO Viruses of Microbes 2016 ...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012—and updated in 2015. The tools and database rely on the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
This is the fifth such presentation; this year at the EMBO Viruses of Microbes 2016 Meeting, 21 July 2016 (http://events.embo.org/16-virus-microbe)
Systems Biology and Genomics of Microbial PathogensRamy K. Aziz
Talk at SCITA-BIOFANS (02 Feb 2016), entitled
"Systems Biology and Genomics of Microbial Pathogens:
From virulence gene discovery to vaccine development and therapeutic intervention"
How to write a biomedical research paperAhmed Negida
This was the presentation of (How to write a biomedical research day workshop) given by Ahmed Negida as a part from MRGE continuous research activities in Egypt.
The course was joined by 45 medical students and seniors from different Egyptian Universities and it was more than 6 hours of exciting learning activities.
Major Learning Objectives were:
1- Structure of biomedical Research Paper
2- How to Write a conference Abstract
3- Scientific Writing Rules
4- Research Protocol
5- Referencing Using Mendeley software
6- Scientific Publication
RAD: Christian J. Stockert Jr, Junmin Liuniranabey
The Penn Experience with MAGE-TAB involved loading 22 studies from various species including human, mouse, Plasmodium, and Toxoplasma into their local database using MAGE-TAB over the past year. They generated MAGE-TAB from templates and downloaded studies. Lessons learned included that providing templates with fillable areas colored was helpful for submitters, but biologists found the format difficult to understand without assistance. Their tools help with validation, loading, and visualization of MAGE documents.
The application of pooled milk for foot-and-mouth disease surveillance in Nak...EuFMD
The 2018 Open Session of the EuFMD Standing Technical Committee was held in Borgo Egnazia - Italy, 29-31 October 2018 . The session theme was on global vaccine security
The European Commission for the Control of Foot-and-Mouth Disease (EuFMD), one of FAO’s oldest Commissions, came into being on the 12th June 1954, with the pledge of the sixth founding member state to the principles of a coordinated and common action against Foot-and-mouth Disease.
Rapid, on site, diagnosis of FMD and safe and cost-effective shipment of samp...EuFMD
The 2018 Open Session of the EuFMD Standing Technical Committee was held in Borgo Egnazia - Italy, 29-31 October 2018 . The session theme was on global vaccine security
The European Commission for the Control of Foot-and-Mouth Disease (EuFMD), one of FAO’s oldest Commissions, came into being on the 12th June 1954, with the pledge of the sixth founding member state to the principles of a coordinated and common action against Foot-and-mouth Disease.
The Opera of Phantome - 2016 (presented at the EMBO Viruses of Microbes 2016 ...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012—and updated in 2015. The tools and database rely on the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
This is the fifth such presentation; this year at the EMBO Viruses of Microbes 2016 Meeting, 21 July 2016 (http://events.embo.org/16-virus-microbe)
Systems Biology and Genomics of Microbial PathogensRamy K. Aziz
Talk at SCITA-BIOFANS (02 Feb 2016), entitled
"Systems Biology and Genomics of Microbial Pathogens:
From virulence gene discovery to vaccine development and therapeutic intervention"
How to write a biomedical research paperAhmed Negida
This was the presentation of (How to write a biomedical research day workshop) given by Ahmed Negida as a part from MRGE continuous research activities in Egypt.
The course was joined by 45 medical students and seniors from different Egyptian Universities and it was more than 6 hours of exciting learning activities.
Major Learning Objectives were:
1- Structure of biomedical Research Paper
2- How to Write a conference Abstract
3- Scientific Writing Rules
4- Research Protocol
5- Referencing Using Mendeley software
6- Scientific Publication
From Sequence to Knowledge (Tools for Phage Genome Annotation)Ramy K. Aziz
This is an introduction to the PATRIC Phage Genomics Workshop at the 24th Biennial Evergreen International Phage Meeting, Aug 6 2021.
It introduces the workshop outline, system, and the genome annotation workflow
The Opera of Phantome - Version 2.0 (presented at the 21st Biennial Evergreen...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012—and updated in 2015. The tools and database rely on the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
This is the fourth presentation at the Phage Genomics Workshop at the 21st Biennial Evergreen International Phage Meeting, Aug 2 2015.
Rapid automatic microbial genome annotation using Prokka
Dr Torsten Seemann presents on Prokka, a tool he developed for rapid automatic annotation of microbial genomes. Prokka uses existing gene prediction tools like Prodigal and Infernal along with database searches to identify features like protein coding genes, tRNAs, and rRNAs. Prokka aims to annotate genomes quickly in under 15 minutes while providing standardized GFF3 and Genbank output files along with provenance on the sources of annotations. Prokka has been used to annotate over 50,000 draft genomes and is an ongoing project aimed at improving accuracy, modularity, and performance.
The document discusses the Genome in a Bottle Consortium's efforts to generate reference materials and data to evaluate the accuracy of human genome sequencing and variant calling. Specifically:
- The consortium is developing reference samples with well-characterized genomes to test sequencing platforms and bioinformatics methods.
- An initial sample, NA12878, has been extensively sequenced and analyzed to generate high-confidence variant calls across 77% of the genome.
- Efforts are ongoing to expand the reference data to additional samples from different populations and integrate data from multiple sequencing technologies.
- The goal is to enable standardized evaluation, benchmarking and regulatory oversight of clinical genome sequencing.
The document discusses genotype imputation and the DNApod workflow. Genotype imputation predicts unobserved genotypes in study individuals using reference haplotypes. DNApod is a database of whole genome sequences for rice, maize and sorghum strains that can be used to find genome-wide DNA polymorphisms. A web service was constructed to allow genotype imputation using reference haplotypes through a Galaxy API, running on local PCs or supercomputers. Validation of imputation accuracy is a future plan.
The document discusses the Genome in a Bottle Consortium (GIAB) which aims to provide reference materials and data for benchmarking and assessing sequencing technologies and bioinformatics pipelines. The GIAB analyzed multiple sequencing datasets for the NA12878 genome and established a high confidence call set for variants through integration. Quality assessment found the call set to have near 100% sensitivity and specificity compared to other datasets in high confidence regions. The NA12878 data serves as an important reference for validation studies.
The document discusses updates to the PRIDE Cluster project. PRIDE Cluster analyzes mass spectrometry proteomics data stored in the PRIDE database by clustering peptide spectra. The latest implementation clustered over 256 million spectra using Apache Hadoop. This resulted in 28 million clusters, including clusters with inconsistent identifications, clusters linking identified and unidentified spectra, and large clusters of consistently unidentified spectra that could help identify new peptides and post-translational modifications. The PRIDE Cluster provides a public resource for data mining the large collection of proteomics datasets in PRIDE.
The Genome in a Bottle Consortium is developing reference materials, reference methods, and reference data to assess confidence in human whole genome variant calls. The Consortium is characterizing several human genomes including the NA12878 genome, an Ashkenazi Jewish trio, and a Chinese trio from the Personal Genome Project. Data generated for these genomes includes various sequencing technologies from Illumina, Complete Genomics, PacBio, BioNano, and others. The Consortium is developing high-confidence variant calls for SNPs, indels, structural variants, and phasing. Individual datasets and integrated variant calls will be made publicly available on the GIAB FTP site.
This document provides information about UniProt, a hub for protein knowledge that includes several databases. It summarizes the main UniProt databases: UniProtKB contains manually annotated Swiss-Prot and automatically annotated TrEMBL sections; UniParc is an archive of all protein sequences and UniRef clusters similar sequences. The document outlines the process of automatic annotation in TrEMBL and manual annotation in Swiss-Prot. It also describes search, alignment and retrieval tools on the UniProt website and options for downloading protein data.
Cassavabase general presentation PAG 2016solgenomics
CASSAVABASE is a central data store for genomic and phenotypic data from the NEXTGEN CASSAVA project, which aims to accelerate breeding of African cassava through genomic selection. It currently contains over 80,000 accessions and 2.5 billion phenotypic observations. CASSAVABASE allows users to search, manage, analyze and visualize diverse data types to support cassava breeding. Ongoing work involves developing new analysis tools, improving existing tools, and establishing mirror sites for African users.
Examining gene expression and methylation with next gen sequencingStephen Turner
Slides on RNA-seq and methylation studies using next-gen sequencing given at the University of Miami Hussman Institute for Human Genomics "Genetic Analysis of Complex Human Diseases" course in 2012 (http://hihg.med.miami.edu/educational-programs/analysis-of-complex-human-diseases/genetic-analysis-of-complex-human-diseases/)
Mining the hidden proteome using hundreds of public proteomics datasetsJuan Antonio Vizcaino
The document discusses mining hidden proteomics data using public proteomics datasets. It describes how the PRIDE Cluster tool clusters over 250 million spectra from the PRIDE Archive, including over 190 million previously unidentified spectra. This clustering identified inconsistent clusters that could be reanalyzed, inferred identifications for 9.1 million originally unidentified spectra contained within reliable identification clusters, and consistently unidentified clusters that could be targeted for further analysis to identify unknown peptides. The clustering took 5 days on a 340-core system and generated 28 million clusters.
This document describes a DNA sequencing process. It begins with DNA extraction from an insect sample, followed by PCR and gel electrophoresis to amplify and isolate the target DNA fragment. The DNA is then sequenced using the dideoxy sequencing method. The sequenced DNA can be used for tasks like identifying the insect species, performing forensics analysis, or providing genetic information for medical insurance purposes. Bioinformatics tools are used to analyze the sequenced DNA data.
We all must do whatever is in our hands to prevent all kinds of cancer, which is the cause of millions of deaths every year. Work on your health-related presentations with the help of these editable Google Slides and PowerPoint templates.
New technology and workflow for integrated collection, stabilization and puri...QIAGEN
Research into non-invasive prenatal testing (NIPT) and circulating tumor DNA (ctDNA) testing based on circulating cell-free DNA (ccfDNA) is rapidly expanding. However, detection and quantification of ccfDNA is compromised by the release of genomic DNA (gDNA) from lymphocytes due to mechanical lysis or apoptosis during blood collection, storage and transport. PreAnalytiX has developed the PAXgene Blood ccfDNA System, consisting of the PAXgene Blood ccfDNA Tube, a plastic blood collection tube with a unique, non-crosslinking chemistry that preserves extracellular levels of ccfDNA and prevents the release of intracellular DNA from cells into the plasma, and the QIAsymphonyPAXgene Blood ccfDNA Kit for automated ccfDNA extraction from up to 5 ml of plasma. In this slidedeck, this new technology development is presented in comparison to other existing technologies.
WikiPathways: how open source and open data can make omics technology more us...Chris Evelo
This document discusses WikiPathways, an open source pathway database. It began in 2007 with the goals of having an online platform by March 2007 and gaining a first unknown user by January 2008, both of which were successes. WikiPathways has grown significantly since, now containing over 400 human pathways and 6,200 unique human genes. It receives over 1 million pageviews annually. The document advocates for opening up data and code to make omics technology more useful. It describes WikiPathways' various features including its BioPAX format, REST services, and integration with Cytoscape. It also discusses professionalizing open source and collaborating with existing communities and tools rather than trying to change the world alone.
"The Opera of PhAnToMe": Phage Annotation Tools at the 20th Biennial Evergree...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012 using the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
Third presentation at the Phage Genomics Workshop at the 20th Biennial Evergreen International Phage Meeting
The Genome in a Bottle Consortium aims to develop reference materials, reference methods, and reference data to assess confidence in human whole genome sequencing variants. This will enable performance assessment of clinical sequencing. The consortium has released a pilot genome reference material (RM 8398) and is working to characterize additional genomes from diverse populations. Efforts include developing high-confidence calls for SNPs, indels, and structural variants; evaluating analysis methods; and establishing benchmarking tools to define performance metrics. The consortium seeks to support the use of reference materials for analytical validation and regulated clinical applications of genome sequencing.
An introduction to PATRIC and its use in phage annotationRamy K. Aziz
The document summarizes the Bacterial Bioinformatics Resource Center (BRC), which merges several bioinformatics resources to support infectious disease research. The BRC contains over 130,000 microbial genomes with uniform annotations across genes, proteins, pathways, and more. It also includes curated data on antimicrobial resistance for over 15,000 genomes. The BRC enables users to analyze genomes, perform comparative analyses, and has deployed machine learning to predict antimicrobial resistance phenotypes from genomic data.
The Opera of Phantome - 2017 (presented at the 22nd Biennial Evergreen Phage ...Ramy K. Aziz
This document provides an overview of the PhAnToMe database and annotation tools for phage genomics. It discusses the history and development of PhAnToMe, an NSF-funded project involving multiple research centers. It describes the PhAnToMe toolbox and annotation tools like RAST, PhAST, myRAST, RASTtk, and PATRIC. Steps are outlined for optimizing RASTtk for phage, using command-line RASTtk, browsing genomes, exploring protein pages, aligning proteins, and acknowledging the community contributions that improve annotations.
More Related Content
Similar to From Sequence to Knowledge: The Art and Science of Phage Genome Annotation
From Sequence to Knowledge (Tools for Phage Genome Annotation)Ramy K. Aziz
This is an introduction to the PATRIC Phage Genomics Workshop at the 24th Biennial Evergreen International Phage Meeting, Aug 6 2021.
It introduces the workshop outline, system, and the genome annotation workflow
The Opera of Phantome - Version 2.0 (presented at the 21st Biennial Evergreen...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012—and updated in 2015. The tools and database rely on the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
This is the fourth presentation at the Phage Genomics Workshop at the 21st Biennial Evergreen International Phage Meeting, Aug 2 2015.
Rapid automatic microbial genome annotation using Prokka
Dr Torsten Seemann presents on Prokka, a tool he developed for rapid automatic annotation of microbial genomes. Prokka uses existing gene prediction tools like Prodigal and Infernal along with database searches to identify features like protein coding genes, tRNAs, and rRNAs. Prokka aims to annotate genomes quickly in under 15 minutes while providing standardized GFF3 and Genbank output files along with provenance on the sources of annotations. Prokka has been used to annotate over 50,000 draft genomes and is an ongoing project aimed at improving accuracy, modularity, and performance.
The document discusses the Genome in a Bottle Consortium's efforts to generate reference materials and data to evaluate the accuracy of human genome sequencing and variant calling. Specifically:
- The consortium is developing reference samples with well-characterized genomes to test sequencing platforms and bioinformatics methods.
- An initial sample, NA12878, has been extensively sequenced and analyzed to generate high-confidence variant calls across 77% of the genome.
- Efforts are ongoing to expand the reference data to additional samples from different populations and integrate data from multiple sequencing technologies.
- The goal is to enable standardized evaluation, benchmarking and regulatory oversight of clinical genome sequencing.
The document discusses genotype imputation and the DNApod workflow. Genotype imputation predicts unobserved genotypes in study individuals using reference haplotypes. DNApod is a database of whole genome sequences for rice, maize and sorghum strains that can be used to find genome-wide DNA polymorphisms. A web service was constructed to allow genotype imputation using reference haplotypes through a Galaxy API, running on local PCs or supercomputers. Validation of imputation accuracy is a future plan.
The document discusses the Genome in a Bottle Consortium (GIAB) which aims to provide reference materials and data for benchmarking and assessing sequencing technologies and bioinformatics pipelines. The GIAB analyzed multiple sequencing datasets for the NA12878 genome and established a high confidence call set for variants through integration. Quality assessment found the call set to have near 100% sensitivity and specificity compared to other datasets in high confidence regions. The NA12878 data serves as an important reference for validation studies.
The document discusses updates to the PRIDE Cluster project. PRIDE Cluster analyzes mass spectrometry proteomics data stored in the PRIDE database by clustering peptide spectra. The latest implementation clustered over 256 million spectra using Apache Hadoop. This resulted in 28 million clusters, including clusters with inconsistent identifications, clusters linking identified and unidentified spectra, and large clusters of consistently unidentified spectra that could help identify new peptides and post-translational modifications. The PRIDE Cluster provides a public resource for data mining the large collection of proteomics datasets in PRIDE.
The Genome in a Bottle Consortium is developing reference materials, reference methods, and reference data to assess confidence in human whole genome variant calls. The Consortium is characterizing several human genomes including the NA12878 genome, an Ashkenazi Jewish trio, and a Chinese trio from the Personal Genome Project. Data generated for these genomes includes various sequencing technologies from Illumina, Complete Genomics, PacBio, BioNano, and others. The Consortium is developing high-confidence variant calls for SNPs, indels, structural variants, and phasing. Individual datasets and integrated variant calls will be made publicly available on the GIAB FTP site.
This document provides information about UniProt, a hub for protein knowledge that includes several databases. It summarizes the main UniProt databases: UniProtKB contains manually annotated Swiss-Prot and automatically annotated TrEMBL sections; UniParc is an archive of all protein sequences and UniRef clusters similar sequences. The document outlines the process of automatic annotation in TrEMBL and manual annotation in Swiss-Prot. It also describes search, alignment and retrieval tools on the UniProt website and options for downloading protein data.
Cassavabase general presentation PAG 2016solgenomics
CASSAVABASE is a central data store for genomic and phenotypic data from the NEXTGEN CASSAVA project, which aims to accelerate breeding of African cassava through genomic selection. It currently contains over 80,000 accessions and 2.5 billion phenotypic observations. CASSAVABASE allows users to search, manage, analyze and visualize diverse data types to support cassava breeding. Ongoing work involves developing new analysis tools, improving existing tools, and establishing mirror sites for African users.
Examining gene expression and methylation with next gen sequencingStephen Turner
Slides on RNA-seq and methylation studies using next-gen sequencing given at the University of Miami Hussman Institute for Human Genomics "Genetic Analysis of Complex Human Diseases" course in 2012 (http://hihg.med.miami.edu/educational-programs/analysis-of-complex-human-diseases/genetic-analysis-of-complex-human-diseases/)
Mining the hidden proteome using hundreds of public proteomics datasetsJuan Antonio Vizcaino
The document discusses mining hidden proteomics data using public proteomics datasets. It describes how the PRIDE Cluster tool clusters over 250 million spectra from the PRIDE Archive, including over 190 million previously unidentified spectra. This clustering identified inconsistent clusters that could be reanalyzed, inferred identifications for 9.1 million originally unidentified spectra contained within reliable identification clusters, and consistently unidentified clusters that could be targeted for further analysis to identify unknown peptides. The clustering took 5 days on a 340-core system and generated 28 million clusters.
This document describes a DNA sequencing process. It begins with DNA extraction from an insect sample, followed by PCR and gel electrophoresis to amplify and isolate the target DNA fragment. The DNA is then sequenced using the dideoxy sequencing method. The sequenced DNA can be used for tasks like identifying the insect species, performing forensics analysis, or providing genetic information for medical insurance purposes. Bioinformatics tools are used to analyze the sequenced DNA data.
We all must do whatever is in our hands to prevent all kinds of cancer, which is the cause of millions of deaths every year. Work on your health-related presentations with the help of these editable Google Slides and PowerPoint templates.
New technology and workflow for integrated collection, stabilization and puri...QIAGEN
Research into non-invasive prenatal testing (NIPT) and circulating tumor DNA (ctDNA) testing based on circulating cell-free DNA (ccfDNA) is rapidly expanding. However, detection and quantification of ccfDNA is compromised by the release of genomic DNA (gDNA) from lymphocytes due to mechanical lysis or apoptosis during blood collection, storage and transport. PreAnalytiX has developed the PAXgene Blood ccfDNA System, consisting of the PAXgene Blood ccfDNA Tube, a plastic blood collection tube with a unique, non-crosslinking chemistry that preserves extracellular levels of ccfDNA and prevents the release of intracellular DNA from cells into the plasma, and the QIAsymphonyPAXgene Blood ccfDNA Kit for automated ccfDNA extraction from up to 5 ml of plasma. In this slidedeck, this new technology development is presented in comparison to other existing technologies.
WikiPathways: how open source and open data can make omics technology more us...Chris Evelo
This document discusses WikiPathways, an open source pathway database. It began in 2007 with the goals of having an online platform by March 2007 and gaining a first unknown user by January 2008, both of which were successes. WikiPathways has grown significantly since, now containing over 400 human pathways and 6,200 unique human genes. It receives over 1 million pageviews annually. The document advocates for opening up data and code to make omics technology more useful. It describes WikiPathways' various features including its BioPAX format, REST services, and integration with Cytoscape. It also discusses professionalizing open source and collaborating with existing communities and tools rather than trying to change the world alone.
"The Opera of PhAnToMe": Phage Annotation Tools at the 20th Biennial Evergree...Ramy K. Aziz
Tools and Methods developed under the PhAnToMe (http://www.phantome.org) project between 2009-2012 using the Subsystems Technology, the SEED (http://theseed.org) environment, and RAST server (http://rast.nmpdr.org)
Third presentation at the Phage Genomics Workshop at the 20th Biennial Evergreen International Phage Meeting
The Genome in a Bottle Consortium aims to develop reference materials, reference methods, and reference data to assess confidence in human whole genome sequencing variants. This will enable performance assessment of clinical sequencing. The consortium has released a pilot genome reference material (RM 8398) and is working to characterize additional genomes from diverse populations. Efforts include developing high-confidence calls for SNPs, indels, and structural variants; evaluating analysis methods; and establishing benchmarking tools to define performance metrics. The consortium seeks to support the use of reference materials for analytical validation and regulated clinical applications of genome sequencing.
Similar to From Sequence to Knowledge: The Art and Science of Phage Genome Annotation (20)
An introduction to PATRIC and its use in phage annotationRamy K. Aziz
The document summarizes the Bacterial Bioinformatics Resource Center (BRC), which merges several bioinformatics resources to support infectious disease research. The BRC contains over 130,000 microbial genomes with uniform annotations across genes, proteins, pathways, and more. It also includes curated data on antimicrobial resistance for over 15,000 genomes. The BRC enables users to analyze genomes, perform comparative analyses, and has deployed machine learning to predict antimicrobial resistance phenotypes from genomic data.
The Opera of Phantome - 2017 (presented at the 22nd Biennial Evergreen Phage ...Ramy K. Aziz
This document provides an overview of the PhAnToMe database and annotation tools for phage genomics. It discusses the history and development of PhAnToMe, an NSF-funded project involving multiple research centers. It describes the PhAnToMe toolbox and annotation tools like RAST, PhAST, myRAST, RASTtk, and PATRIC. Steps are outlined for optimizing RASTtk for phage, using command-line RASTtk, browsing genomes, exploring protein pages, aligning proteins, and acknowledging the community contributions that improve annotations.
From Sequence to Knowledge (Phage Genomics Workshop Intro at the 22nd Biennia...Ramy K. Aziz
This is an introduction to the Phage Genomics Workshop at the 22nd Biennial Evergreen International Phage Meeting, Aug 6 2017.
It introduces the workshop outline, system, and the genome annotation workflow
What doesn't kill you makes you stronger!
A presentation on the constructive ways for giving and receiving feedback—adapted from: "Developing Leadership Skills", by Alfred Darmanin
This document uses football as an analogy to explain concepts from genomics and the central dogma of molecular biology. It outlines four key lessons: 1) Only a subset of players/genes are expressed during a game/cell process; 2) Expression levels can change during a game/over time; 3) The outcome of a team depends on complex interactions not just individual efforts; and 4) A player's function depends on context, like bacterial host or team, and interactions with other players/proteins.
phiRAST Tutorial - The 19th Evergreen Phage Meeting 2011Ramy K. Aziz
This document provides instructions for using PhageRAST, a web-based tool for analyzing bacteriophage genomes. The document explains that users can submit either FASTA or GenBank files containing phage genome sequences to PhageRAST for analysis. PhageRAST will then annotate and compare submitted sequences to reference databases to classify phages and identify genes.
Introduction to PhAnToMe Workshop, 19th Evergreen Phage Meeting, 2011Ramy K. Aziz
An introduction to a tutorial on using the PhAnToMe (Phage Annotation Tools and Methods) website, databases (Phage SEED, Phage Metadata), and programs: phiRAST, PhageBioBIKE, and phiSIGNs
The document discusses the benefits of exercise for mental health. Regular physical activity can help reduce anxiety and depression and improve mood and cognitive function. Exercise causes chemical changes in the brain that may help alleviate symptoms of mental illness and boost overall mental well-being.
Talk by Ramy K. Aziz in the second TWAS/BioVisionAlexandria.NXT in Alexandria- Egypt (10-11 April 2010) about "Open Acess and The Next Revolution in Scholarly Publishing".
The slides are also contributed by Mark Patterson, Björn Brembs, and Peter Binfield.
Signatures of wave erosion in Titan’s coastsSérgio Sacani
The shorelines of Titan’s hydrocarbon seas trace flooded erosional landforms such as river valleys; however, it isunclear whether coastal erosion has subsequently altered these shorelines. Spacecraft observations and theo-retical models suggest that wind may cause waves to form on Titan’s seas, potentially driving coastal erosion,but the observational evidence of waves is indirect, and the processes affecting shoreline evolution on Titanremain unknown. No widely accepted framework exists for using shoreline morphology to quantitatively dis-cern coastal erosion mechanisms, even on Earth, where the dominant mechanisms are known. We combinelandscape evolution models with measurements of shoreline shape on Earth to characterize how differentcoastal erosion mechanisms affect shoreline morphology. Applying this framework to Titan, we find that theshorelines of Titan’s seas are most consistent with flooded landscapes that subsequently have been eroded bywaves, rather than a uniform erosional process or no coastal erosion, particularly if wave growth saturates atfetch lengths of tens of kilometers.
Anti-Universe And Emergent Gravity and the Dark UniverseSérgio Sacani
Recent theoretical progress indicates that spacetime and gravity emerge together from the entanglement structure of an underlying microscopic theory. These ideas are best understood in Anti-de Sitter space, where they rely on the area law for entanglement entropy. The extension to de Sitter space requires taking into account the entropy and temperature associated with the cosmological horizon. Using insights from string theory, black hole physics and quantum information theory we argue that the positive dark energy leads to a thermal volume law contribution to the entropy that overtakes the area law precisely at the cosmological horizon. Due to the competition between area and volume law entanglement the microscopic de Sitter states do not thermalise at sub-Hubble scales: they exhibit memory effects in the form of an entropy displacement caused by matter. The emergent laws of gravity contain an additional ‘dark’ gravitational force describing the ‘elastic’ response due to the entropy displacement. We derive an estimate of the strength of this extra force in terms of the baryonic mass, Newton’s constant and the Hubble acceleration scale a0 = cH0, and provide evidence for the fact that this additional ‘dark gravity force’ explains the observed phenomena in galaxies and clusters currently attributed to dark matter.
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...Advanced-Concepts-Team
Presentation in the Science Coffee of the Advanced Concepts Team of the European Space Agency on the 07.06.2024.
Speaker: Diego Blas (IFAE/ICREA)
Title: Gravitational wave detection with orbital motion of Moon and artificial
Abstract:
In this talk I will describe some recent ideas to find gravitational waves from supermassive black holes or of primordial origin by studying their secular effect on the orbital motion of the Moon or satellites that are laser ranged.
PPT on Direct Seeded Rice presented at the three-day 'Training and Validation Workshop on Modules of Climate Smart Agriculture (CSA) Technologies in South Asia' workshop on April 22, 2024.
Mending Clothing to Support Sustainable Fashion_CIMaR 2024.pdfSelcen Ozturkcan
Ozturkcan, S., Berndt, A., & Angelakis, A. (2024). Mending clothing to support sustainable fashion. Presented at the 31st Annual Conference by the Consortium for International Marketing Research (CIMaR), 10-13 Jun 2024, University of Gävle, Sweden.
PPT on Alternate Wetting and Drying presented at the three-day 'Training and Validation Workshop on Modules of Climate Smart Agriculture (CSA) Technologies in South Asia' workshop on April 22, 2024.
PPT on Sustainable Land Management presented at the three-day 'Training and Validation Workshop on Modules of Climate Smart Agriculture (CSA) Technologies in South Asia' workshop on April 22, 2024.
Microbial interaction
Microorganisms interacts with each other and can be physically associated with another organisms in a variety of ways.
One organism can be located on the surface of another organism as an ectobiont or located within another organism as endobiont.
Microbial interaction may be positive such as mutualism, proto-cooperation, commensalism or may be negative such as parasitism, predation or competition
Types of microbial interaction
Positive interaction: mutualism, proto-cooperation, commensalism
Negative interaction: Ammensalism (antagonism), parasitism, predation, competition
I. Mutualism:
It is defined as the relationship in which each organism in interaction gets benefits from association. It is an obligatory relationship in which mutualist and host are metabolically dependent on each other.
Mutualistic relationship is very specific where one member of association cannot be replaced by another species.
Mutualism require close physical contact between interacting organisms.
Relationship of mutualism allows organisms to exist in habitat that could not occupied by either species alone.
Mutualistic relationship between organisms allows them to act as a single organism.
Examples of mutualism:
i. Lichens:
Lichens are excellent example of mutualism.
They are the association of specific fungi and certain genus of algae. In lichen, fungal partner is called mycobiont and algal partner is called
II. Syntrophism:
It is an association in which the growth of one organism either depends on or improved by the substrate provided by another organism.
In syntrophism both organism in association gets benefits.
Compound A
Utilized by population 1
Compound B
Utilized by population 2
Compound C
utilized by both Population 1+2
Products
In this theoretical example of syntrophism, population 1 is able to utilize and metabolize compound A, forming compound B but cannot metabolize beyond compound B without co-operation of population 2. Population 2is unable to utilize compound A but it can metabolize compound B forming compound C. Then both population 1 and 2 are able to carry out metabolic reaction which leads to formation of end product that neither population could produce alone.
Examples of syntrophism:
i. Methanogenic ecosystem in sludge digester
Methane produced by methanogenic bacteria depends upon interspecies hydrogen transfer by other fermentative bacteria.
Anaerobic fermentative bacteria generate CO2 and H2 utilizing carbohydrates which is then utilized by methanogenic bacteria (Methanobacter) to produce methane.
ii. Lactobacillus arobinosus and Enterococcus faecalis:
In the minimal media, Lactobacillus arobinosus and Enterococcus faecalis are able to grow together but not alone.
The synergistic relationship between E. faecalis and L. arobinosus occurs in which E. faecalis require folic acid
Immersive Learning That Works: Research Grounding and Paths ForwardLeonel Morgado
We will metaverse into the essence of immersive learning, into its three dimensions and conceptual models. This approach encompasses elements from teaching methodologies to social involvement, through organizational concerns and technologies. Challenging the perception of learning as knowledge transfer, we introduce a 'Uses, Practices & Strategies' model operationalized by the 'Immersive Learning Brain' and ‘Immersion Cube’ frameworks. This approach offers a comprehensive guide through the intricacies of immersive educational experiences and spotlighting research frontiers, along the immersion dimensions of system, narrative, and agency. Our discourse extends to stakeholders beyond the academic sphere, addressing the interests of technologists, instructional designers, and policymakers. We span various contexts, from formal education to organizational transformation to the new horizon of an AI-pervasive society. This keynote aims to unite the iLRN community in a collaborative journey towards a future where immersive learning research and practice coalesce, paving the way for innovative educational research and practice landscapes.
Immersive Learning That Works: Research Grounding and Paths Forward
From Sequence to Knowledge: The Art and Science of Phage Genome Annotation
1. From Sequence to Knowledge:
The Art & Science of Phage
Genome Annotation
Ramy K. Aziz – Cairo University
2. From Sequence to
Knowledge:
PhAnToMe, RAST, and the
Ultimate Kropinski Toolkit
A helping hand through
The Annotation Bottleneck
Compiled by: Andrew Kropinski and Ramy Aziz
3. Online material
• Data & links:
– http://egybio.net/tutorial
• Slides
– http://bit.ly/annotation2016
– http://bit.ly/phantome4
– Old tutorials (more detailed, but missing latest ):
• Evergreen 2011: http://slidesha.re/phantome1
• http://slidesha.re/phiRAST1 (Karin)
• Evergreen 2013: http://bit.ly/phantome2
• Evergreen 2015: http://bit.ly/phantome3
21 July 2016 Phage Genomics - VoM 2016
5. “The analysis bottleneck”
• Observation:
– We generate more data than we can analyze.
– We generate sequence data faster than
we can analyze them.
• Opinion:
– Bottlenecks are not
created equal!
– It is important to define the question(s)
before working on the answer(s)!
21 July 2016 Phage Genomics - VoM 2016
8. Quick group activity
Defining the question(s):
• How many of you have annotated a
genome?
• How many phage genomes have you
sequenced (or are in the process of
sequencing)?
a) None b) 1-5 c) 5-50 d) > 50
• What is the single most pressing question
you want to answer from genome analysis?
21 July 2016 Phage Genomics - VoM 2016
10. What You Want
The goal:
complete
accurate
Incomplete:
genome
termini Faulty assembly
Frameshift
chimeric
fragments21 July 2016 Phage Genomics - VoM 2016
11. A process of reconstruction
21 July 2016 Phage Genomics - VoM 2016
12. Annotation Reconstruction
from genome from metagenome
21 July 2016 Phage Genomics - VoM 2016
Incomplete
frameshift
- complete
- accurate
Credit: Andrew Kropinski Credit: Bas Dutilh
faulty assembly
13. Annotation Reconstruction
from genome from metagenome
21 July 2016
Incomplete faulty assembly
frameshift
- complete
- accurate
Phage Genomics - VoM 2016
Credit: Andrew Kropinski Credit: Bas Dutilh
14. A process of reconstruction
• Experimentally
DNA
TGATTGTGTGTTTGCGCAATGCG
ATGTGTATATATAGTGAGCTTGCCC
GTCTCTCTNNNTCTCTTG
TGATTGGTCTNNNTCTCTTGCGCAATGCG
21 July 2016 Phage Genomics - VoM 2016
15. A process of reconstruction
• Experimentally
• Computationally
TGATTGTGTGTTTGCGCAATGCG
ATGTGTATATATAGTGAGCTTGCCC
GTCTCTCTNNNTCTCTTG
TGATTGGTCTNNNTCTCTTGCGCAATGCG
21 July 2016 Phage Genomics - VoM 2016
DNA
TGATTGTGTGTTTGCGCAATGCG
ATGTGTATATATAGTGAGCTTGCCC
GTCTCTCTNNNTCTCTTG
TGATTGGTCTNNNTCTCTTGCGCAATGCG
16. Assembly
Gene finding/
ORF calling
tRNA calling
Annotation
(Assigning
functions)
orienting
Validation (segmenter)
Fixing frameshifts
Introns and Inteins Subsystem
assignment
Refinement/
Secondary
annotation
loop
Special purpose:
toxins, morons, integrases,
lifestyle prediction
Regulatory elements
(promoters, terminators)
Output: files and graphics
From Sequence to Knowledge
From raw sequence data to
genome submission/ publication
19. General outline
• Part I: The “Kropinski toolkit”
– Tools approved and recommended by Andrew
Kropinski (http://molbiol-tools.ca): from seq to pub
• Part II: SEED-based tools:
– The RAST family
– The PhAnToMe database/portal
21 July 2016 Phage Genomics - VoM 2016
21. What we want, according to Andrew
Well characterized genome, in which, ideally we
know:
the location & function of all the genes
the location of promoters & terminators
the correct taxonomy
PstI PstI
20
21
22
23
24
25
26
26A
27 28 29
30
31
32
33
30.0 kb
Viruses; dsDNA viruses, no RNA stage; Caudovirales; Siphoviridae;
T1virus
21 July 2016 Phage Genomics - VoM 2016
22. Desired outcome: Create GenBank
submission
• Complete, accurate description of the
genome and its taxonomy
Good title
25. Desired outcome (4)
Protein products of concern, particularly
for those interested in phage therapy:
Integrases
Toxins
PstI PstI
20
21
22
23
24
25
26
26A
27 28 29
30
31
32
33
30.0 kb
21 July 2016 Phage Genomics - VoM 2016
26. Processes and Steps
I. Primary analysis
(QC/ pre-annotation proofreading: e.g., orient with BLASTN)
II. Genome annotation
– Gene finding (ORF calling)
– Automated annotation
– Massaging (edition, functional assignment)
III. Second dimension (regulatory elements)
IV. Comparative genomics
V. Metadata
VI. Visualization
21 July 2016 Phage Genomics - VoM 2016
27. Assembly
Gene finding/
ORF calling
tRNA calling
Annotation
(Assigning
functions)
orienting
Validation (segmenter)
Fixing frameshifts
Introns and Inteins Subsystem
assignment
Refinement/
Secondary
annotation
loop
Special purpose:
toxins, morons, integrases,
lifestyle prediction
Regulatory elements
(promoters, terminators)
Output: files and graphics
From Sequence to Knowledge
From raw sequence data to
genome submission/ publication
29. RAST (subsystems-based tools)
• Will be the major focus of this short
tutorial…
• The goal is:
1. Quick demo how to use RAST
2. Quick preview batch annotation in RAST
3. Optimize RAST for phage annotation
4. Demonstrate & discuss how to improve
RAST output
21 July 2016 Phage Genomics - VoM 2016
31. The Kropinski wisdom
1. Always use more than one tool
2. Never blindly trust any automated (or manual)
process
3. Use your eyes and hands: visual inspection/
manual proofreading, re-annotation
– Every apparently complicated file is still editable on
your favorite text editor (e.g., NotePad)
4. If you don’t know a gene’s function (if you
can’t convince your grandma), better keep it
unnamed than contribute to error propagation
2 Aug 2015 Phage Genomics - Evergreen 2015
32. What do I call my gene product
(i.e. protein)?
“phage hypothetical protein” – redundant
“gp87” (gp = gene product) hypothetical protein
gp200 describes radically different proteins in
Listeria, Enterococcus, Mycobacterium,
Rhodococcus, Sphingomonas, Pseudomonas,
• Bacillus and Synechococcus phage genomes
Add /note=“similar to gp43 of Escherichia coli
phage T4”
21 July 2016 Phage Genomics - VoM 2016
33. What do I call my gene product
(i.e. protein)?
/product=“UboA”; “NrdA”; “hypothetical protein
SA5_0153/152”; “ORF184” (as bad as gp184); “RNAP1”;
"32 kDa protein”
Bad because they don`t mean anything to the casual (or
informed) reader.
Unless you are a bioinformatician or biostatistician be
conservative in recording “hits.” Could you convince your
grandmda?, if not list as a “hypothetical protein” but do take
a stand “putative DNA polymerase” is cowardly
21 July 2016 Phage Genomics - VoM 2016
34. Nomenclature Sins
hypothetical protein DNA polymerase with no
or poor quality evidence is far worse than:
DNA polymerase hypothetical protein
Be cautious about using BLASTP hits in naming
gps – is there additional evidence to back the
designation up
21 July 2016 Phage Genomics - VoM 2016
35. Consistent Nomenclature
All of these describe homologs of the
product of the coliphage T4 rIIA gene!
rIIA protector from prophage-induced early lysis
protector from prophage-induced early lysis
protector from prophage-induced early lysis rIIA
membrane-associated affects host membrane ATPase
rIIA membrane-associated affects host membrane ATPase
phage rIIA lysis inhibitor
rIIA protector
rIIA
rIIA protein
membrane integrity protector
hypothetical protein
unnamed protein product !!!!!!
protein of unknown function
21 July 2016 Phage Genomics - VoM 2016
36. Bottom line:
Manual vs. Automated
• “Turtles know the road better than
rabbits… ” Khalil Gibran
• “… but they may never reach the end!”
• The best approach?
– Human expert-based annotation
2 Aug 2015 Phage Genomics - Evergreen 2015
37. Assembly
Gene finding/
ORF calling
tRNA calling
Annotation
(Assigning
functions)
orienting
Validation (segmenter)
Fixing frameshifts
Introns and Inteins Subsystem
assignment
Refinement/
Secondary
annotation
loop
Special purpose:
toxins, morons, integrases,
lifestyle prediction
Regulatory elements
(promoters, terminators)
Output: files and graphics
From Sequence to Knowledge
From raw sequence data to
genome submission/ publication
39. Genomic pairwise comparisons
EMBOSS Stretcher:http://emboss.bioinformatics.nl/cgi-
bin/emboss/stretcher N.B. genomes must be collinear
BLASTN - NCBI
ANI (Average Nucleotide Identity):http://enve-
omics.ce.gatech.edu/ani/
GGDC 2.0 (Genome to Genome Distance Calculator):
http://ggdc.dsmz.de/distcalc2.php
jSpeciesWS –
ANI:http://jspecies.ribohost.com/jspeciesws/
40. Proteomic pairwise
comparisons
CoreGenes –
(http://binf.gmu.edu:8080/CoreGenes3.0/)
TBLASTX
Remember protein sequence is more conserved
than DNA sequence; probably useful for more
distant relationships
Gp200 from Pseudomonas phage 201phi2-1 is related to phiKZ gp120 and EL gp78
"Shifting the genomic gold standard for the prokaryotic species definition" Michael Richter and Ramon Rosselló-Móra. PNAS vol. 106 no. 45 pg 19126–19131, doi: 10.1073/pnas.0906412106
JSpeciesWS is a quick and easy to use online service to measure the probability if two or more (draft) genomes belong to the same species or not by pairwise comparison of (1) their Average Nucleotide Identity (ANI) and/or (2) correlation indexes of their Tetra-nucleotide signatures.