1. 1
Table of Contents:
 Abstract (2)
 Introduction (3)
o Life Cycle (4)
o Diagnosis (4)
 Aim of the Study (7)
 Materials and Methods (8)
o DNA Extraction (8)
o Nested PCR (8)
 Results and Discussion (11)
 Conclusion (17)
 References (18)
 Appendix (A)
 Appendix (B)
 Appendix (C)

2. 2
Abstract:
Entamoeba moshkovskii and Entamoeba dispar are microscopically indistinguishable from the
pathogenic species Entamoeba histolytica. Though not implicated in causing direct infections, some
reports are emerging recently discussing the potential pathogenicity of the newly discovered species. A
nested polymerase chain reaction (PCR) was adapted from a preceding study developed by Khairnar et
al. The current study aimed at differentially detecting the two Entamoebas in 59 stool samples where it
detected E. moshkovskii and E. dispar infections in 9 out of 59 samples (15.36%).

3. 3
Introduction:
Entamoeba dispar and Entamoeba moshkovskii trophozoites and cysts are
morphologically identical to the pathogenic species Entamoeba histolytica. Little is
known about these newly discovered parasites but some reports discussed the
potential role of E. moshkovskii in pathogenicity (1) and some strains of E. dispar
were shown to cause liver abscesses in hamsters as some reports suggested (7,2). E.
histolytica is the causative agent of amebiasis that is a waterborne and foodborne
illness acquired by the ingestion of the infective cyst stage of the pathogenic parasite
(26). Typically associated with crowded living conditions and poor sanitation,
amebiasis is notably prevalent in tropical and subtropical areas (2) including Africa,
Far East, Indian subcontinent and Central America (7). It is estimated that around 500
million people get infected with E. histolytica worldwide. This high morbidity rate is
associated with almost 100,000 deaths annually, most particularly due to
complications such as amoebic liver abscess (7). Since the identification of two
genetically distinct yet morphologically identical nonpathogenic species of
Entamoeba; namely E. dispar and E. moshkovskii, the epidemiology of E. histolytica
necessitated a reassessment. More importantly though, it shed doubt on the reliability
of microscopy alone to identify and differentiate the organism.
E. dispar was initially proposed as a distinct species of Entamoeba by Emile
Brumpt almost 80 years ago (1). It was not until 1978 where Sargeaunt and co-
workers using isoenzyme analysis suggested that E.histolytica did indeed consist of
two species and around 1993 Diamond and Clarck have officially separated it from
the pathogen E. histolytica (25). It was obvious through this identification that the
prevalence of E. histolytica was overestimated. And from the 500 million people
infected annually, only around 10% of them are truly infected with the pathogen E.
histolytica. E. dispar clearly colonized the intestines of the remaining 90% (1) and
although this has been established, local prevalence may vary significantly (7).
E. moshkovskii is a cosmopolitan organism that has been isolated from sewage
treatment plants from different parts of the world. It was not until 1941, when
Tshalaia, L. E first described and recognized that in spite of its similarity to E.

4. 4
histolytica it possessed 2 distinctive characteristics; it multiplied at temperatures from
10°C to 37°C and it survived to hypotonic solutions (23). However, not until late
1990s that E. moshkovskii became accepted as a distinct Entamoeba species that can
live inside the human body. It has been isolated from both developing and developed
countries. Although sporadic reports are emerging implicating E. dispar and E.
moshkovskii in human intestinal disease, much remains to be known and studied about
the epidemiology and pathogenesis of both E. dispar and E. moshkovskii (1, 7).
Life Cycle:
Entamoebas in general (except for E. gingivalis) have two stages including a
motile, reproducing, feeding stage which is called the trophozoite and lives most
commonly in the lower gastrointestinal tract, and another form which is the cyst form
that is characterized by being non-motile, non-feeding and the infective stage for
humans (27). An Entamoeba infection often occurs upon ingestion of cysts, usually
after encountering fecally contaminated water and food. After ingestion, the cysts
travel through the body and settle in the ileum where excystation occurs. The neutral
to slightly alkaline environment of the intestine is apparently favored for this event,
and surviving the harsh acidic environment of the stomach is maintained by the cyst
wall (4). Excystation will result in a single tetranucleated organism that immediately
undergoes mitosis giving rise to eight trophozoites, which pass downwards to the
large intestine where they feed, grow, and reproduce (5). In a normal, asymptomatic
infection, the amebas are carried out in formed stools. In these cases, the
environmental alterations triggered by the dehydration of the fecal matter stimulate
the trophozoites to change back to the cyst form. Cysts are neither found in stools of
patients with dysentery nor formed by the amebas when they have invaded the tissues
of the host. Trophozoites passed in stools are unable to encyst (2), and they cannot
persist in the environment. The main source of infection thus is the cyst passing,
asymptomatic carriers or chronic patients (2).
Diagnosis:
Traditionally microscopy has been for years the only method for the detection
of Entamoeba infections, though it has at best 60% sensitivity (15). Differences in

5. 5
sizes of cysts and the number of nuclei inside them were accurately observed to come
up with the exact diagnosis. It took a very well trained and experienced technician to
tell the cysts of different Entamoeba apart; nonetheless it was not easy to do, due to
the fact that Entamoeba family members (E. coli, E. hartamanni, E. polecki) in
general along with other intestinal protozoa (Endolimax nana and Iodamoeba
butschlii) offer few morphological features for identification and can be easily
misidentified as well for macrophages. Yet microscopy maintained its popularity for
several decades. And with the newly emerging identical species (E. dispar and E.
moshkovskii), it became more difficult to recognize each separately. Few studies have
recently reported the presence of ingested red blood cells in E. dispar and other many
non pathogenic Entamoeba (3) thus raising questions about the reliability of the
presence of ingested red blood cells as a diagnostic criterion for the pathogenic E.
histolytica.
With all the limitations that were facing microscopy, the idea of culture was
encouraging, due to its increased sensitivity. Cultures were used for isoenzyme
analysis to differentiate between E. histolytica and E. dispar specifically. However the
whole process is time consuming and has a low success rate in most laboratories (7).
Moreover, results were negative in many microscopy-positive samples due to the fact
that samples were either delayed in processing or because of the administration of
antiamoebic therapy prior to sample collection (15). Other diagnostic methods also
used for the diagnosis of amoebiasis included serological methods such as
hemagglutination test and agar gel diffusion. Almost 80% of patients infected with
pathogenic E. histolytica develop detectable antibodies, and more than 90% of them
would have the antibodies after recovering from the infection. Those who are infected
with E. dispar do not develop anti-amoebic antibodies. However, this is not a
preferred tool, because it still can detect antibodies in people recovered from infection
long time ago, and thus gives false positive results (16). The need for more accurate
and quick methods was mounting, and attention was focused on identifying the
antigens that were the cause of pathogenicity. Enzyme Linked Immunosorbent assays
(ELISA) based techniques were implemented in different labs. It was greatly
successful in achieving high sensitivity and specificity rates for the identification of E.
histolytica. Moreover, it didn’t involve complicated preparation techniques, where it
was possible to use human fecal specimens directly and rapidly. It seemed to be the

6. 6
perfect solution for the proper identification at times where other methods (isoenzyme
analysis) were laborious, time consuming, and prone to false results, and other
methods such as polymerase chain reaction (PCR) where expensive. This technique
was faced with significant limitations when E. moshkovskii was being isolated more
often from human fecal samples. In 2007, Stark et al compared between two
commercially available kits (TechLab E. histolytica II and CELISA) for the detection
of E. histolytica, they showed poor sensitivities in the detection, but proved high
specificity and thus they could be used in the differentiation of species of Entamoeba
complex when large numbers of cysts and trophozoites are detected by microscopy.
(22).
Presently, molecular approaches are gaining more recognition in the field of
proper and exact identification of each of the three indistinguishable Entamoebas.
Currently many methods are employed in learning more about the diversity, from a
molecular point of view, within the three morphologically identical Entamoeba
species. PCR proved most efficient with remarkable results. Furthermore, E. dispar
and E. moshkovskii were being identified with no trouble. Specific genes and proteins
were easily targeted, and this helped even further classification of what is pathogenic
and what is nonpathogenic.

7. 7
Aim of the Study:
The present study was aimed at differentially detecting the two
morphologically identical species of Entamoeba; E. dispar and E. moshkovskii, using
nested PCR from stool samples. Another objective of the study was to determine the
rate of infection of both Entamoeba species in our study group.

8. 8
Materials and Methods:
A total of 59 stool samples were collected from Sharjah municipality. The
samples belonged to adult individuals (20 to 52 years) of both sexes and from
different nationalities including Ethiopia, Egypt, Philippines, India, Pakistan,
Bangladesh, Nepal, Sri Lanka and Afghanistan. It is important though to mention that
none of the individuals suffered any gastrointestinal symptoms and they were not
seeking medical treatment.
Samples that were not to be processed immediately were stored at -20°C, or
else, aliquots of 0.2 grams of fresh unpreserved stool sample were weighed and stored
at -20°C for further extraction by QIAGEN kit for DNA purification.
DNA Extraction:
Extraction was performed using QIAGEN kit for DNA purification from stool
samples (QIAGEN, Helden, Germany) according to the manufacturer's instructions.
Eventually, around 200 µL of pure DNA is eluted from the spin column, and is ready
for direct use in less than one hour. Purification requires no phenol-choloroform
extraction or alcohol precipitation. DNA is eluted in low-salt buffer and is free of
protein, nucleases, and other impurities and inhibitors. The QIAamp DNA Stool Mini
Kit contains InhibitX tablets that insure the removal of any inhibitor compound that
can degrade DNA and interfere with the PCR results. The purified DNA is ready for
use or it can be stored at -20°C for later use (20).
Two standard strains were used in this study as positive control, E. dispar
SAW 760 and E. moshkovskii Laredo. The standard strains were obtained from Dr. G.
Clark from the London School of Hygiene and Tropical Medicine

9. 9
Nested Polymerase chain reaction (PCR):
The nested PCR applied in this study was adapted from a previous study
conducted by Khairnar et al (2007) where a nested multiplex PCR was used for the
differential detection of the three morphologically Entamoeba species; E. histolytica,
E. dispar, and E. moshkovskii (8). However, in this study nested PCR was performed
separately.
The initial PCR reaction mixture contained 25µL of volume in total. It
consisted of 20µL distilled water, 2.5 µL of buffer and 0.5µL of the following;
dNTP's, DNA (from samples or standard strains for positive controls), Primer E-1,
Primer E-2 (genus specific primers), and Taq polymerase enzyme.
The reaction mixture was set to react according to the following conditions;
initial denaturation step at 95°C for 2 minutes, 30 cycles each consisting of 1 minute
denaturation step at 92°C, one minute annealing step at 56°C, and one minute
extension step at 72°C. At the end, one cycle at 72°C for 7 minutes is added to insure
extension (8).
In the nested PCR, the same conditions were used except for the annealing
temperature that changed to 52°C and the number of cycles was increased to 40. Two
different thermocyclers were used along the period of the study; Techne, Techgene,
and Eppendorf- mastercycler personal.
The nested PCR contained 25 µL of volume including 18 µL of distilled
water, 2.5 µL of buffer and DNA that was obtained from PCR I, and 0.5 µL of
dNTPs, species specific primers 1 and 2 (ED 1 and ED 2, or EM 1 and EM 2), and
Taq enzyme. Both positive and negative controls were included in each run. In the
negative control, distilled water was added to the initial reaction mixture instead of
the DNA.

10. 10
Two sets of enzymes were used in the study; Promega Taq DNA polymerase
(100u, 5u/µL) and Finzyme DyNAzyme polymerase (1u/µL) along with their buffers.
Primers were provided from Alpha DNA with a working solution of 25picomol.
Primer sequences used in the PCR were as follows:
E-1: 5'TAAGATGCACGAGAGCGAAA
E-2: 5'GTACAAAGGGCAGGGACGTA
Mos-1: 5'GAAACCAAGAGTTTCACAAC
Mos-2: 5'CAATATAAGGCTTGGATGAT
ED-1: 5'TCTAATTTCGATTAGAACTCT
ED-2: 5'TCCCTACCTATTAGACATAGC
Ten micro liters of the amplification products were separated by electrophoresis
through 1.2% agarose gel (Agarose LE, Analytical Grade, Promega, Madisson, USA)
in 1X TAE buffer. Visualization was possible by ethidium bromide staining under UV
light for bands of DNA of appropriate sizes. Positive and negative control reactions
were included with each batch of samples analyzed by nested multiplex PCR (fig.A).
A 100bp DNA ladder (Promega, Madisson, USA) and 1 Kb one (Bio labs, New
England) were used in the current study.

11. 11
Fig. (A)
Fig (A): 1.2% ethidium bromide stained garose gel in 10X TAE buffer;
Lane-1; 100 bp Ladder, Lane-3; positive E. moshkovskii control (500 bp),
Lane-5; negative control,
Lane (7-15); samples 9-19 negative for E. moshkovskii excluding 13 & 17
Results and Discussion:
The designed primers used in the current study amplified the positive controls
E. dispar SAW 760 and E. moshkovskii Laredo giving bands of 174 and 553 bp
respectively under UV light.
59 stool samples were tested by nested PCR to detect for both E. dispar and E.
moshkovskii. The overall rates of infection of the two parasites in the study were
found to be 15.36% (9/59), excluding E. histolytica figures, having E. dispar as more
prevalent than E. moshkovskii; 6 out of the 59 samples were positive for E. dispar
(10.16%) and 3 were positive for E. moshkovskii (5.1%); 3 out of the 6 E. dispar
infections were mixed, one of them was with E. moshkovskii, and the other two were
with E. histolytica (data not shown). No mixed infections of E. moshkovskii and E.
histolytica were detected. Results of E. histolytica infections in these 59 samples were
compared against those from a previous study conducted under the same nested PCR
protocol to determine the rate of infection of the pathogenic parasite. It was important
though to compare current results with those obtained for E. histolytica to have an
overall picture of the prevalence of Entamoeba complex mixed infections in these
samples.
135715

12. 12
(B)
(C)
Differential detection of E. dispar and E. moshkovskii by nested PCR on stool samples under UV
light. The E. dispar (ED) and E. moshkovskii (EM) bands were 174 and 553 bp respectively.
Fig (B): Lane-1, 1 Kb DNA ladder (Biolabs, New England); Lane-2, E. dispar positive control (174
bp); Lane-3, negative control; Lane-7, sample No 42 positive for E. dispar. Other wells contained
negative results for E. dispar.
Fig (C): Lane-1, 100 bp DNA (Promega, Madisson, USA); Lane-2, E. moshkovskii positive control
showed a smear including a band of size 500 bp; Lane-3, negative control; Lane- 9, 11, 13 referring to
samples 25, 27, and 29 respectively positive for E. moshkovskii.
ED (174bp)
Well No 7
positive for
ED
Well no 9,
11,13 were
positive for
EM
EM (553 bp)
13 11 9 3 2 1
1 2 3 7

13. 13
Table (1) : % of total E. dispar and E. moshkovskii infections in tested stool samples using
PCR
Types of Entamoeba
Species
Nested PCR results (%)
E. moshkovskii 3/59 5.1%
E. dispar 6/59 10.17%
Table (2): Rate of mixed infections in the studied samples
Mixed Entamoeba infections Results of nested PCR
E. dispar + E.moshkovskii (mixed) 1/59
E. dispar + E. histolytica (mixed) 2/59
E. histolytica + E.moshkovskii (mixed) 0/59
The present study adopted a nested PCR assay for species-specific detection
and differentiation of E. moshkovskii and E. dispar directly from stool samples (8).
The study showed that the rate of mono-infection with E. dispar was higher than that
of E. moshkovskii, and that mixed infections of E. dispar and E. histolytica were the
highest, as well. Although the sample size was rather small to come up with a
generalized consensus, but other studies conducted in different countries yielded the
same results (10, 9, 11, 16 and 8).
It is of highest importance to know the actual prevalence of each of the three
morphologically identical Entamoebas; E. histolytica, E. dispar and E. moshkovskii
and to be able to determine the epidemiological figure of each species, especially the
pathogenic E. histolytica. The differential detection is also critical to the medical
management of patients. However data emerging recently from several parts of the
world suggest that E. dispar is 10 times more prevalent in asymptomatic patients than
E. histolytica in regions of endimicity (1, 9).

14. 14
Because they are newly discovered, little is known about pathogenicity of the
two organisms. A recent study from Bangladesh (11) targeting pre-school children, 4
of them were found to suffer from diarrhea, indicating a high prevalence of E.
moshkovskii; however 73% of these infections were associated with either one of the
two identical Entamoeba species (E. dispar and E. histolytica). Surprisingly, one of
these 4 children was found to be positive for E. moshkovskii and co-infected with E.
dispar. The reason for diarrhea was not determined and since there were no enough
data, it wasn't possible to attribute the symptoms to infection with the two parasites.
Another report coming from turkey (12) discussed two symptomatic cases (diarrhea,
fatigue, and weight loss) that were co-infected with E. moshkovskii and E. histolytica.
However, these two cases were negative by microscopy for any Entamoeba species.
Moreover, only one was detected by PCR as positive for E. histolytica, while both
were positive for the pathogenic parasite using Tech lab E. histolytica test (12). Both
studies confirmed that humans are true hosts for this parasite and not just transiently
infected (11).
E. moshkovskii was also found as a common infection in HIV infected
individuals. A study in Tanzania reported high E. moshkovskii mono-infections (13)
and suggested as well that it is "low-burden", since all of the E. moshkovskii
infections were identified by PCR and not by microscopy.
In the study conducted by Stark et al (2007) in Australia (9), all patients
infected with E. moshkovskii were symptomatic; however, the link was not
established because more information is needed. The same study reported that 97% of
tested individuals who were confirmed positive for the E. complex were men, mostly
homosexuals’. These facts concur with other published reports which confirmed a link
between E. complex infections and this particular population. Between 1977 and
1978, amebiasis was recognized as a sexually transmitted disease posing a major
health problem in New York City, particularly among gay men (2). Other particular
groups which demonstrated high prevalence of the E. complex include individuals in
mental hospitals or orphanages (2).

15. 15
Various PCR techniques are being pursued in an attempt to simplify the
protocols and to save time without affecting the high sensitivity and specificity that
were characteristics of PCR. Based on these facts, many approaches were adapted to
differentially detect the three Entamoebas, including real time PCR, as well as
conventional and nested PCRs.
One of the greatest advantages of nested multiplex PCR is the ability to detect
more than one template in a mixture by adding more than one set of oligonucleotides
primers (19), and thus reducing the work load tremendously.
Furthermore, since the main objective is to reduce time, a single round PCR
was developed lately by Hamzah et al (10) to detect and differentiate among the three
identical Entamoebas. They were able to detect one E. histolytica infection and six E.
dispar infections in 30 clinical samples and no E. moshkovskii infections in the Thai
populations. However, they assumed that negative results were mostly due to the
small sample size; especially that E. moshkovskii has been isolated from different
parts of the world including Australia, Tunisia, Bangladesh, India, and Turkey (9, 14,
11, and 12). Further, it has been established that the human body is a natural host for
the free living organism.
Nested PCR was used in this study because it increases sensitivity and
specificity, where the primers used in the first round of amplification are replaced for
the second and subsequent cycles of amplification (19). Thus, if the DNA product of
the first PCR was in too low concentrations to be detected by ethdium bromide stain,
the second PCR would increase the concentration and compensate for the effects of
inhibitors found in clinical samples (8).
As a result, microscopy was proved not to be the best method for
differentiation of E. dispar and E. moshkovskii from the pathogenic E. histolytica. In
many studies, the percentage of positive E. histolytica infections by microscopy or
culture was much higher than the percentage obtained by PCR (8, 9, 10 and 12),
pointing the fact that not all E. histolytica patients should be treated with anti-amoebic
drugs if the infection was detected by microscopy alone. This reality necessitates the
implementation of PCR based methods for the accurate identification of the three

16. 16
morphologically identical Entamoebas. Still to overcome, is the affordability issue so
that it can be applied in all diagnostic labs especially in countries of higher
endimicity.
Conclusion:
Speed, accuracy, precision, and simplicity, all are factors that helped the molecular
diagnostic methods field to prosper into this revolution we are witnessing nowadays.
The present study reports the utilization of an adopted nested PCR protocol to
differentiate and detect E. moshkovskii and E. dispar DNA extracted from stool
samples. PCR techniques are also recommended in epidemiological studies due to its
increased sensitivity as this would help in giving accurate figures on the distribution
of these three morphological identical Entamoebas in different parts of the world.

17. 17
References:
1. Bobby S. Pritt & C. Graham Clarck. Amebiasis 2008
2. Foundations of Parasitology, Gerald D. Schmidt & Larry S. Robert's, Sixth
edition
3. Medical Parasitology, Markell and Voge, Eighth edition
4. Human Parasitology, Burton J. Bogitsh, Clint E. Carter, Thomas N. Oeltmann,
third edition
5. Jawetz, Melnick & Adelberg's Medical Microbiology, 24th
edition
6. Infection, Genetics and Evolution; Molecular nature of virulence in
Entamoeba histolytica. 2009
7. Ibne Karim M. Ali, C. Graham Clark, William A. Petri Jr (2008) Molecular
Epidemiology of Amoebiasis. USA & UK
8. Krinsha Khairnar and Subhash C Parija (2007); A novel nested multiplex
polymerase chain reaction (PCR) assay for differential detection of
Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples.
9. R. Fotedar, D. Stark, N. Beebe, D. Marriott, J. Ellis, and J. Harkness (2007);
PCR detection of Entamoeba histolytica, Entamoeba dispar and Entamoeba
moshkovskii in Stool Samples from Sydney, Australia.
10. Zulhainan Hamzah, Songsak Petmitr, Mathirut Mungthin, Saovanee
Leelayoova, and Porntip Chavalitshewinkoon-Petmitr (2006); Differential
Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba
moshkovskii by Single-Round PCR Assay.
11. Ali IK, Hossain MB, Roy S, Ayeh-Kumi PF, Petri WA Jr, Haque R, Clark CG
(2003); Entamoeba moshkovskii infections in children, Bangladesh.
12. Mehmet Tanyuksel*, Mustafa Ululikanligil, Zeynep Guclu, Engin Araz,
Ozgur Koru, and William A. Petri, JR. (2008); Two Cases Of Rarely
Recognized Infection With Entamoeba moshkovskii.
13. David L. Beck, Nihal Doagn, Venance Maro, Noel E. Sam, John Shao, Eric R.
Houpt (2008); High Prevalence of Entamoeba moshkovskii in a Tanzanian
HIV population.
14. Soumaya Ben Ayed, Karim Aoun, Nadia Maamouri, Rym Ben Abdallah, and
Aïda Bouratbine (2008); First Molecular Identification of Entamoeba
moshkovskii in Human Stool Samples in Tunisia.

18. 18
15. Rashidul Haque,1 I. K. M. Ali,1 S. Akther,1 and William A. Petri Jr.2 (1998);
Comparison of PCR, Isoenzyme Analysis, and Antigen Detection for
Diagnosis of Entamoeba histolytica Infection.
16. Amidou Samie, Larry C. Obi, Pascal O. Bessong, Suzanne Stroup, Eric Houpt,
and Richard L. Guerrant (2006); Prevalence and species distribution of E.
histolytica and E. dispar in the Venda region, Limpopo, South Africa.
17. http://kidshealth.org/parent/infections/parasitic/amebiasis.html
18. https://www.msu.edu/course/zol/316/ehisgut.htm
19. http://medical-dictionary.thefreedictionary.com/multiplex+PCR
20. QIAGEN QIAamp® DNA stool handbook.
21. An Introduction to PCR Inhibitors by Joseph Bessetti – Promega Corporation-
22. D. Stark, S. Van Hal, R. Fotedar, A. Butcher, D. Marriotte, J. Ellis, and J.
Harkness (2007); Comparison of Stool Antigen Detection Kits to PCR for
Diagnosis of Amebiasis.
23. Morris Goldman (1969), Entamoeba histolytica-like Amoeba Occurring in
Man
24. Windell L. Rivera, Hiroshi Tachibana, and Hiroji Kanbara (1999); Application
of the Polymerase Chain Reaction (PCR) in the Epidemiology of Entamoeba
histolytica and Entamoeba dispar Infections.
25. Diamond LS, Clark CG. (1993); A redescription of Entamoeba histolytica
Schaudinn, 1903 (Emended Walker, 1911) separating it from Entamoeba
dispar Brumpt, 1925. (Abstract)
26. http://wwwnc.cdc.gov/travel/yellowbook/2010/chapter-5/amebiasis.aspx
27. Ruth Leventhal, Russell F. Cheadle; Medical Parasitology -A Self -
Instructional Text; Fifth Edition

19. 19
Appendix (A):
(D) (E)
Fig D, E: Cysts of E. histolytica/E. dispar stained with trichrome. Two to three nuclei are visible in
the focal plane (black arrows), and the cysts contain chromatoid bodies with typically blunted ends (red
arrows). The chromatoid body in C is particularly well demonstrated.

20. 20
Appendix (B):
Procedure 1. Weigh 180–220 mg stool in a 2 ml microcentrifuge tube (not provided) and place
the tube on ice. This protocol is optimized for use with 180–220 mg stool but can also be used
with smaller amounts. There is no need to reduce the amounts of buffers or InhibitEX matrix when
using smaller amounts of stool. For samples >220 mg, see “Protocol: Isolation of DNA from Larger
Volumes of Stool”, page 30.
If the sample is liquid, pipet 200 µl into the microcentrifuge tube. Cut the end of the pipet tip to make
pipetting easier.
If the sample is frozen, use a scalpel or spatula to scrape bits of stool into a 2 ml microcentrifuge tube
on ice.
Note: When using frozen stool samples, take care that the samples do not thaw until Buffer ASL is
added in step 2 to lyse the sample; otherwise the DNA in the sample may degrade. After addition of
Buffer ASL, all following steps can be performed at room temperature (15–25°C).
2. Add 1.4 ml Buffer ASL to each stool sample. Vortex continuously for 1 min or until the stool
sample is thoroughly homogenized.
Note: It is important to vortex the samples thoroughly. This helps ensure maximum DNA concentration
in the final eluate.
3. Heat the suspension for 5 min at 70°C. This heating step increases total DNA yield 3- to 5-fold
and helps to lyse bacteria
and other parasites. The lysis temperature can be increased to 95°C for cells that are difficult to lyse
(such as Gram-positive bacteria).
4. Vortex for 15 s and centrifuge sample at full speed for 1 min to pellet stool particles.
5. Pipet 1.2 ml of the supernatant into a new 2 ml microcentrifuge tube (not provided) and
discard the pellet.
Note: The 2 ml tubes used should be wide enough to accommodate an InhibitEX Tablet.
Transfer of small quantities of pelleted material will not affect the procedure.
6. Add 1 InhibitEX Tablet to each sample and vortex immediately and continuously
for 1 min or until the tablet is completely suspended. Incubate suspension for 1 min at room
temperature to allow inhibitors to adsorb to the InhibitEX matrix.
7. Centrifuge sample at full speed for 3 min to pellet inhibitors bound to InhibitEX matrix.
8. Pipet all the supernatant into a new 1.5 ml microcentrifuge tube (not provided) and discard the
pellet. Centrifuge the sample at full speed for 3 min.
Transfer of small quantities of pelleted material from step 7 will not affect the procedure.
9. Pipet 15 µl proteinase K into a new 1.5 ml microcentrifuge tube (not provided).
10. Pipet 200 µl supernatant from step 8 into the 1.5 ml microcentrifuge tube
containing proteinase K.
11. Add 200 µl Buffer AL and vortex for 15 s.
Note: Do not add proteinase K directly to Buffer AL. It is essential that the sample and Buffer AL are
thoroughly mixed to form a
homogeneous solution.
12. Incubate at 70°C for 10 min.
Centrifuge briefly to remove drops from the inside of the tube lid (optional).
13. Add 200 µl of ethanol (96–100%) to the lysate, and mix by vortexing. Centrifuge briefly to
remove drops from the inside of the tube lid (optional).
14. Label the lid of a new QIAamp spin column placed in a 2 ml collection tube. Carefully apply
the complete lysate from step 13 to the QIAamp spin column without moistening the rim. Close
the cap and centrifuge at full speed for 1 min. Place the QIAamp spin column in a new 2 ml
collection tube, and discard the tube containing the filtrate.
Close each spin column in order to avoid aerosol formation during centrifugation. If the lysate has not
completely passed through the column after centrifugation,
centrifuge again until the QIAamp spin column is empty.
15. Carefully open the QIAamp spin column and add 500 µl Buffer AW1. Close the cap
and centrifuge at full speed for 1 min. Place the QIAamp spin column in a new 2 ml collection
tube, and discard the collection tube containing the filtrate.
16. Carefully open the QIAamp spin column and add 500 µl Buffer AW2. Close the cap and
centrifuge at full speed for 3 min. Discard the collection tube containing the filtrate.
Note: Residual Buffer AW2 in the eluate may cause problems in downstream applications. Some
centrifuge rotors may vibrate upon deceleration, resulting in the flow-through, which contains Buffer

21. 21
AW2, contacting the QIAamp spin column. Removing the QIAamp spin column and collection tube
from the rotor may also cause flow-through to come into contact with the QIAamp spin column.
17. Recommended: Place the QIAamp spin column in a new 2 ml collection tube (not provided)
and discard the old collection tube with the filtrate. Centrifuge at full speed for 1 min.
This step helps to eliminate the chance of possible Buffer AW2 carryover.
18. Transfer the QIAamp spin column into a new, labeled 1.5 ml microcentrifuge tube
(not provided). Carefully open the QIAamp spin column and pipet 200 µl Buffer AE directly onto
the QIAamp membrane. Close the cap and incubate for 1 min at room temperature, then
centrifuge at full speed for 1 min to elute DNA.
Note: When using eluates in PCR, for maximum PCR robustness we highly recommend adding BSA to
a final concentration of 0.1 µg/µl to the PCR mixture. For maximum PCR specificity we recommend
using QIAGEN HotStarTaq PlusDNA Polymerase (see ordering information on page 39). For best
results in downstream PCR, use the minimum amount of eluate possible in PCR; the volume of eluate
used as template should not exceed 10% of the final volume of the PCR mixture. Also, note that high
amounts of template DNA may inhibit the PCR.
DNA yield is typically 15–60 µg but, depending on the individual stool sample and the way it was
stored, may range from 5 to 100 µg. DNA concentration is typically 75–300 ng/µl.
For more information about elution and how to determine DNA yield, purity, and length, see the
Appendix, page 36.
For long-term storage, we recommend keeping the eluate at –20°C.