Bhanu Kalra, profile picture
Uploaded byBhanu Kalra
PPTX, PDF284 views

Class 12th molecular basis new f

DNA is the genetic material present in all living cells. It is a double-stranded molecule composed of deoxyribose, phosphate groups, and nitrogenous bases. DNA replicates semi-conservatively to produce two identical copies of itself during cell division. It carries genetic information that is transcribed into mRNA which is then translated into proteins.

Embed presentation

Downloaded 10 times
1 / 123
2 / 123
Most read
3 / 123
4 / 123
5 / 123
6 / 123
7 / 123
8 / 123
9 / 123
10 / 123
11 / 123
12 / 123
13 / 123
14 / 123
15 / 123
16 / 123
17 / 123
18 / 123
19 / 123
20 / 123
21 / 123
22 / 123
23 / 123
24 / 123
25 / 123
26 / 123
27 / 123
28 / 123
29 / 123
30 / 123
31 / 123
32 / 123
33 / 123
34 / 123
35 / 123
36 / 123
37 / 123
38 / 123
39 / 123
40 / 123
41 / 123
42 / 123
43 / 123
44 / 123
45 / 123
46 / 123
47 / 123
48 / 123
49 / 123
50 / 123
51 / 123
52 / 123
53 / 123
54 / 123
55 / 123
56 / 123
57 / 123
58 / 123
59 / 123
60 / 123
61 / 123
62 / 123
63 / 123
64 / 123
65 / 123
66 / 123
67 / 123
68 / 123
69 / 123
70 / 123
71 / 123
72 / 123
73 / 123
74 / 123
75 / 123
76 / 123
77 / 123
78 / 123
79 / 123
80 / 123
81 / 123
82 / 123
83 / 123
84 / 123
85 / 123
86 / 123
87 / 123
88 / 123
89 / 123
90 / 123
91 / 123
92 / 123
93 / 123
94 / 123
95 / 123
96 / 123
97 / 123
98 / 123
99 / 123
100 / 123
101 / 123
102 / 123
103 / 123
104 / 123
105 / 123
106 / 123
107 / 123
108 / 123
109 / 123
110 / 123
111 / 123
112 / 123
113 / 123
114 / 123
115 / 123
116 / 123
117 / 123
118 / 123
119 / 123
120 / 123
121 / 123
122 / 123
123 / 123
BHANU KALRA
• Nucleic acids. • Nucleic acids are the macromolecules present in all living cell. • Freidrich Miescher was the first person isolated the nucleic acids from the pus cells. He called it as nuclein. • As it has an acidic nature, hence Altmann called it as nucleic acids. • The two types of nucleic acids found in living organisms are, 1. Deoxyribonucleic acid [DNA] 2. Ribonucleic acid [RNA].
• Deoxyribonucleic acid [DNA] • DNA is the genetic material of all living organisms. This carries the coded information from one generation to another generation. • It is a long polymer of deoxyribonucleotides. • The length of the DNA depends on, number of nucleotide pair present in it. • In eukaryotic cell DNA is found nucleus. It is the chief component of chromosomes. DNA also found in the mitochondria and chloroplasts
• Chemically DNA is composed of Deoxyribose sugar, Phosphate group and nitrogenous base . • Deoxyribose sugar: It is a pentose sugar heaving the molecular formula C5H10O4. • Phosphate group: The phosphoric acid forms the phosphate group. • its molecular formula is H3PO4. It is responsible for acidic nature of DNA.
• Nitrogenous base: Nitrogenous base are the nitrogen containing compounds. These are mainly divided in to two types as 1. Purines . 2. Pyrimidines. • Purines: Purines are the double ring heterocyclic structural compounds. The two types of purines present in the DNA are Adenine (A) and Guanine (G).
• Pyrimidine: Pyrimidines are the single ring structured compounds. The two types of pyrimidines present in the DNA are Cytosine (C) and Thymine (T). • Nucleosides: compounds formed by the combination of pentose sugar and Nitrogenous base is called nucleosides. • A nitrogen base attached to the C1 of pentose sugar by N-glycosidic linkage. • In DNA Nucleosides are formed by the combination of deoxyribose sugar and nitrogenous base .
• Adenine + deoxyribose sugar = Deoxyadenosine • Guanine + deoxyribose sugar = Deoxygaunosine. • Cytosine + deoxyribose sugar = Deoxycytidine. • Thymine + deoxyribose sugar =Deoxythymidine
• Nucleotides: The compound formed by the combination of phosphate groups with nucleosides is called nucleotides. • The four types of nucleotides present in the DNA are, 1. Deoxyadenosine monophosphate. 2. Deoxygaunosine monophosphate. 3. Deoxycytidine monophosphate. 4. Deoxythymidine monophosphate.
• Polynucleotide strand: Number of nucleotides linked each other by phospho-di-ester bond and forms a long chain of molecule called polynucleotide strand. • The phospho-di-ester bond forms between 5th and 3ed carbon atom position of pentose sugar. Therefore polynucleotide strand contains 5th and 3ed end.
Structure of DNA or Double helix structure of DNA • J.D.Watson and F.H.C.Crick first proposed the structural model of DNA in 1953. • They got the Nobel Prize for their work in 1962. • According to Watson and Crick model of DNA, ‘The DNA contains two polynucleotide strands coiled together in helical manner’. Hence the name Watson and Crick double helix structure of DNA is given.
James Dewey Watson: April 6th, 1928 Nobel prize winner at the age of 34 (1962)
Francis Harry Compton Crick: (8 June 1916 – 28 July 2004)
• The structure of DNA is as fallows, • The DNA is a double stranded polynucleotide molecule. • Sugar and phosphate forms the backbone . The bases projected to inside. • The two strands are coiled each other and arranged antiparallely. I.e. if one strand has 5th to 3ed and other has 3ed to 5th in direction. • The two strands of DNA have the common diameter of 20 0A. • Adenine of one strand pairs with Thymine of another strand by two hydrogen bonds and vice versa. • Guanine of one strand pairs with Cytosine of another strand by three hydrogen bonds and vice versa..
• Because of complementary base pairing arrangement, if one strand of polynucleotide sequence is known, another can be deduced. • Ex: 5th AGCTTTACATACCGGAAAATTACAGT 3ed first strand. • 3ed TCGAAATGTATGGCCTTTTAATGTCA 5TH second strand. • The complementary strand twisted each other at the distance of 34 0A. • Each twist of DNA contains 10 base pair. • The distance between these two base pairs are 3.4 0A.
• Central dogma • One way flow of genetic information from DNA to protein is called central dogma. • DNA→ RNA→ Protein. • Packaging of DNA in prokaryotes: • Prokaryotes do not have definite nucleus. • The DNA is not scattered throughout the cell. • It is held together with some proteins in a region is called ‘nucleoid’. • The DNA in nucleoid is organized in large loops held be proteins.
• Packaging of DNA in Eukaryotes: • In eukaryotes DNA is stabilized with positively charged, basic protein called Histones. • Histones are positively charged due to rich in basic amino acids like Lysines and arginines. • Histones are organized to form a unit of eight molecules called histone octamere.
• Negatively charged DNA wrapped around positively charged histone octamere to form a structure called nucleosome. • The nucleosomes are seen as ‘beads-on-string’ structure under electron microscope. • Nucleosome forms the repeating unit of a structure in nucleus called chromatin,
• The chromatin is packaged to form chromatin fibers. These are further coiled and condensed at metaphase stage to form chromosome. • euchromatin: In the nucleus some loosely coiled regions of chromatin (light stained) is called euchromatin. • Heterochromatin: In the nucleus more densely packed regions of chromatin (stains dark) are called Heterochromatin. • Euchromatin is transcriptionally active than heterochromatin.
• Transforming principle: • Frederich Griffith conducted experiments to show Transforming principle in bacteria • He conducted an experiment on mice and pneumonia bacteria streptococcus pneumoniae. These bacteria are found in two strains, as • 1 virulent (smooth strain) • 2 non-virulent (rough strain). • The S-strain bacteria produce capsule and is pathogenic. • The R-strain lacks capsule and is non pathogenic.
• When the R-strains are injected into the mouse, it is a non pathogenic and does not causes pneumonia. The mouse continued to live. • When the S-strains are injected into the mouse, that causes pneumonia and mouse dies. • When heat killed S-strains are injected into the mouse that does not causes pneumonia. The mouse continued to live. • When the heat killed S-strains and R-strain are mixed and injected into the mouse, that causes pneumonia and mouse dies.
• Conclusion of experiment: • R – Strain bacteria had been transformed by the heat killed S-Strain bacteria. • The transformation of R-Strain to S-Strain is due to transfer of Genetic material. • The biochemical nature of genetic material was not defined from his experiment.
• Biochemical characterization of transforming principle: • Oswald Avery, Colin Macleod and Maclyn McCarty. (1933-44) worked to determine the biochemical nature of the ‘transforming principle’ of Griffith’s experiment. • They purified biomolecules (proteins, DNA and RNA) from the heat killed S strain. They added digestive enzyme of each, to see which one could transform live R cells to S cells.
• Heat killed S-Strain + protease + Live R-Strain → transforms R strain to S strain. • Heat killed S-Strain + RNase + Live R-Strain → transforms R strain to S strain. • Heat killed S-Strain + DNase + Live R-Strain → unable to transforms R strain to S strain.
• Conclusion of the experiments: • Protein of heat killed S-Strain is not the genetic material • RNA of heat killed S-Strain is not the genetic material. • DNA of heat killed S-Strain is the genetic material. – Because DNA digested with DNase mixed with R-strain unable to transform R-Strain to S-Strain. • But all biologist are not convienced.
• The Genetic Material is DNA: • ‘DNA is the genetic material’ is proved by Alfred Hershey and Martha Chase (1952). • They worked on the virus that infects bacteria called bacteriophage. • During infection the bacteriophage first attaches the bacteria cell wall. It inserts its genetic material into the bacterial cell.
• The viral genetic material became part of the bacterial genome. It manufactures more virus particle using host content. • Hershey and Chase worked to discover whether it was protein or DNA from the viruses that entered the bacteria. • Experiment :( blenders experiment) • They grew some viruses on a medium having radioactive phosphorus . Some others on medium having radioactive sulfur. • Viruses grown in radioactive Phosphorus have radioactive DNA but not radioactive protein. Because Phosphorus present in DNA not in protein. • Viruses grown in radioactive sulfur have radioactive protein not radioactive DNA. Because sulfur present in protein but not in DNA.
• radioactive phages were allowed to infect E.coli bacteria. The phages transfer the genetic material to the bacteria. • The viral coats were separated from the bacteria surface by blender. • The virus particles were separated from the bacteria by centrifuge machine. • Observation: • Bacteria infected with viruses that had radioactive DNA were radioactive. No radioactivity in the supernatant. • Bacteria infected with viruses that had radioactive protein were not radioactive. But radioactivity found in the supernatant. • Conclusion of Experiment: • DNA is the infecting agent that made the bacteria radioactive hence DNA is the genetic material not the protein.
• Criteria for genetic material: • It should be able to generate its replica (replication) • It should be chemically and structurally stable. • It should provide slow changes (mutation) that required for evolution. • It should be able to express itself in the form of ‘Mendelian Character’. • Protein dose not fulfill the criteria hence it is not the genetic material. • RNA and DNA fulfill the criteria.
• Replication of DNA: • “It is the process by which DNA produces the exact copies of the original DNA." • In eukaryotes, DNA is double stranded. The two strands are complementary to each other because of their base sequences. • Semi-conservative method of DNA replication • It is the most common method of DNA replication. • It takes place in the nucleus where the DNA is present. • Replication takes place in the S-phase of cell cycle. • Deoxyribose nucleotides needed for formation of new DNA strands are present in nucleoplasm.
• At the time of replication two strands of DNA separates. • Each strand acts as a template for the formation of a new strand. • A new strand is constructed on each old strand by complementary base pairing. • Hence two exactly identical double stranded DNA molecules are formed. • In each new DNA molecule, one strand is old while the other is newly formed. Hence, Watson and Crick described this method as semi-conservative replication. .
Semi conservative nature of DNA Mathew Messelson and Franklin start.
Semi conservative nature of DNA Mathew Messelson and Franklin stahl. • They grew E. coli on 15 NH4Cl culture medium. 15N is the heavy isotope of nitrogen • Both strands of DNA have 15N (15N 15N). • These bacteria are Shifted to 14NH4Cl culture medium • DNA extracted subjected to [Cesium Chloride (CsCl)] CsCl density gradient centrifugations. • Hybrid/ Intermediate type of DNA (15N 14N) • After next generation equal amount of light DNA (14N 14N) and hybrid DNA (15N 14N) are formed.
• Mechanism of DNA replication: • The process of DNA replication takes place by number of substance, enzymes and proteins. They are, • Substance: Deoxyribonucleotides. • Enzymes: DNA Helicase. DNA Polymarase III, II, I. RNA Primase. DNA ligase. • Protein: SSB [ single strand binding protein]
• Mechanism of replication starts at a specific point of DNA molecule called point of ori. • At origin, DNA strand unwinds by breaking hydrogen bonds. This takes place with the help of an enzyme DNA Helicases. • At the point separation it appears like a fork or a Y- shape. It is called replication fork. • Each old DNA strand acts as a template for the synthesis of new strand. • SSB protein attaches to un-winded strand and prevents rejoining. • the synthesis of new DNA strand on old strand takes place by an enzymes DNA polymerase III. It adds new nucleotides through complementary base pairing.
• DNA polymerase III always synthesis new strand in 5 to 3 direction. • The synthesis of new strand for the parent templet strand heaving 3 to 5 end is continuous. This strand is called leading strand. • The synthesis of new strand for the parent templet strand heaving 5 to 3 end is discontinuous. It forms by small segments of DNA called Okazoki fragments. This strand is called lagging strand . • During the formation of okazoki fragment RNA primase first synthesis RNA primer
• DNA polymarase III continuous the synthesis of okazoki fragment in 5 to3 direction. • At the end RAN primer are replaced by deoxyribonucleotides with the help of enzyme DNA polymarase I. • The okazoki fragments joins together with the help of an enzyme DNA ligase. • DNA polymarase II once again checks and repairs the errors occurred in new strand.
Central dogma. • One way flow of information from DNA to m- RNA and from m-RNA to protein is called central dogma.
Mechanism of Transcription. • The processes of transcription takes place by 1. DNA helicase. 2. RNA polymerase II. 3. Ribonucleotides. • Ribonucleoside monophosphate activates into ribonucleoside tri phosphate by phosphorylase enzyme and phosphoric acid. Hence ATP,GTP,UTP, CTP forms.
• Transcription begins by uncoiling of DNA at specific site called promoter region of cistron. It takes place by DNA helicase. • RNA polymerase II recognizes and binds to the promoter sequence. • RNA polymerase II synthesis RNA, always from 5’ to 3’ direction. • Hence among two strands of DNA one strand 3’ to 5’ end act as a templet.
5' 3' G C A G T A C A T G T C C G T C A T G T A C A G 3' 5' coding strand template strand transcription RNAG C A G U A C A U G U C5' 3'
• The complementary base for templet strand pairs to transcribe m- RNA. • When the RNA polymerase reaches the terminator point, synthesis of RNA stops up. • Newly synthesized m-RNA in eukaryotic is called hnRNA (heterogeneous RNA). It undergoes post transcriptional process by splicing. • The eukaryotic m-RNA contains exons and introns. In splicing introns are removed and exons are joined in a defined order.
• hnRNA undergoes additional processing called as capping and tailing. • In capping an unusual nucleotide methyl guanosine triphosphate is added to the 5′-end of hnRNA. • In tailing, adenylate residues are added at 3′- end as a template independent manner. • Fully processed hnRNA, now called mRNA. It transported out of the nucleus for translation
Messenger RNA (m-RNA) • It is the RNA that carries message from DNA to the site of protein synthesis. It represents about 5 to 10% of the total RNA of cell. • It carries the genetic information in the form of triplet codons,
• m-RNA is a single stranded poly nucleotide chain. • The eukaryotic m-RNA contains a cap at 5th end composed of 7 methyl gonosine. It is absent in prokaryotic m-RNA. • Next to the cap it has non coding region called leader sequence. • Next to it has an initiator codon. AUG. It initiate the protein synthesis.
• Next to initiator codon, the coding sequence is present. It codes for specific protein. It is called exon. • Next to this terminator codon, UAA, UGA or UAG is present. It terminates the protein synthesis. • Next to this again non coding region is present. • In eukaryotic m-RNA poly A tail is present at 3’ end.
Functions of r- RNA: 1. It helps in binding of ribosomes to m-RNA. 2. It acts as an enzyme(ribozymes), helps in formation of peptide bond during protein synthesis.
Difference between DNA and RNA DNA • Has high molecular weight. • Double stranded poly nucleotide chain. • Deoxy ribose sugar is the pentose sugar. • Thymine is present. • Unusual nitrogen bases are absent • Genetic material of living organism. RNA • Has very low molecular weight. • single stranded poly nucleotide chain. • ribose sugar is the pentose sugar. • Uracil is present. • Unusual nitrogen bases are present. • Genetic material of some virus.
Note: • RNA polymerase is also called DNA dependent RNA polymerase. • RNA polymerase I is found in nucleolus and helps in synthesis of r- RNA. Hence nucleolus is called ribosome factories of cell. • RNA polymerase II helps in synthesis of m-RNA. • RNA polymerase III helps in synthesis of t-RNA. • Ribosomal RNA is the insoluble RNA. • Pribnow box: It is a DNA sequence found in the promoter region of genes in prokaryotes. It has the sequence of TATAATG. • TATAbox: The TATAbox (Goldberg-Hogness box) is a DNA sequence found in the promoter region of genes in eukaryotes. It has the sequence of TATAAAT.
Concept of gene. • Gene is the basic unit of inheritance that express specific character. • 1857 - Gregor Johann Mendel conducted hybridization experiments with pea plants. He called them as factors. • 1909 - Danish botanist Johannsen proposed that each portion of a chromosome that controls a phenotype is called a “gene” (Greek: “to give birth to”). • 1941 - George W.Beadle and Edward L. Tatum discovered that genes control the production of enzymes. They proposed One gene one enzyme hypothesis.
• 1944 - Oswald T. Avery announced that DNA is the substance responsible for heredity. • 1950’s – Watson and Crick discover chemical structure of DNA, • The gene is made up of a specific sequence of DNA nucleotides. • Symer Benzer proposed modern concept of gene, while working on Ecoli and T4 bacteriophage. • According to him gene is , 1. Cistron. 2. Recon. 3. Muton. 4. Replicon
• Cistron: It is the structural gene. It is functional unit of DNA molecule that codes for specific protein. • Recon: It is the unit of DNA that undergoes recombination. • Muton: It is the unit of DNA that capable to undergo mutation. • Replicon: It is the unit of DNA that undergoes preplication.
• Genetic code: The three specific nucleotide sequence that codes for specific amino acid present in DNA is called genetic code. • Codon: The three specific nucleotide sequence that codes for specific amino acid present in m-RNA is called codon. • Anti codon: The three specific nucleotide sequence that codes for specific amino acid present in anticodon arm of t-RNA is called anticodon. • Anticodons are complementary to codons.
General features of genetic code. • The genetic code is triplet: Each codon is made up of three specific nucleotides. • Genetic code is universal: each codon codes for specific amino acid in all living organism. • Genetic codons are no over lapping: Adjacent codon never shares there nucleotides. • Genetic code is comma less: There is no gap between neighboring codon. • Genetic codon is degenerative in nature: more than one codon codes for single amino acid. • Ex GUA, GUG, GUC,GUU codes for valine.
• Initiator codon: AUG is the initiator codon that initiates the protein synthesis. It codes for amino acid methionine. • Terminator codon: Among 64 codon, three codon UAG, UGA, UAA does not codes for any amino acids. These are called terminator codon or non-sense codon. • Genetic code is unambiguous: Each codon codes for specific amino acid, and only one amino acid. • Ex: The codon UUU codes for the amino acid phenyl alanine only. • Genetic code is unidirectional: codon reads only in 5’ to 3’ direction. • Wobble base: In each codon third nitrogenous base is less specific. • Ex: GUA, GUC, GUG, GUU codes for valine.
Transfer RNA (t-RNA) • The RNA that carries and transports activated amino acid to the site of protein synthesis is called t-RNA. • It represents about 10 to 15% of the total RNA in the cell. • The polynucleotide chain is folded on itself to have the shape of a cloverleaf. • Cloverleaf model of t-RNA was proposed by American biochemist Robert Holley in 1965. He shared the Nobel Prize in Physiology in 1968 1922 - 1993
Structure of t- RNA. • t- RNA is a single stranded polynucleotide chain. It folds in some region and resembles as trifoliate leaf of clover plant. • It contains 4 arms as, 1. Amino acid binding site or acceptor arm. 2. T ѰC arm and loop. 3. DHU arm and loop. 4. Anticodon arm and loop. 5. Rarely small 5th arm is present is called variable arm. • The 5’end has methylated guanosine. • The 3’ end has three free nitrogen bases CCA.
• Each arm has paired base pairs stem and unpaired base pairs loop. • Amino acid acceptor arm has 7 base pairs and 3 unpaired bases CCA at 3’end. Therefore amino acid always binds to adenine present in the 3’end. • T ѰC arm and loop contains unusual sequence of nucleotides as thymine (T), pseudo uridine ( Ѱ) and cytosine (C). It helps to bind ribosome at the time of protein synthesis.
• DHU arm and loop contains dihydrouridine. It helps to recognizing specific amino acid activating enzymes amino acyl synthetase. • The anti codon loop contains 7 unpaired nitrogen bases. Among them 3 nucleotides acts as anticodon which are complementary to codon of m- RNA. • Functions: It carries specific amino acid towards the site of protein synthesis.
Ribosomal RNA (r-RNA): • r- RNA is the structural and functional unit of ribosomes. • It represents nearly 80% of the total RNA in the cell.
• Translation: • decoding the coded information carried by m- RNA into protein is called translation. OR • Synthesis of poly peptide chain on m-RNA strand with the help of t-RNA and ribosomes is called translation. • Translation takes place in cytoplasm. • The required components for translation are, 1. m-RNA. 2. t-RNA. 3. Ribosomes. 4. Amino acids. 5. Amino acyl synthetase. 6. Peptidyle synthetase. 7. ATP. 8. GTP. 9. Mg +2
• The process of translation takes place by 5 steps. 1. Activation of amino acids. 2. Attachment of activated amino acids to the t- RNA. 3. Initiation of poly peptide chain. 4. Elongation of polypeptide chain. 5. Termination of polypeptide chain.
Activation of amino acids. • The specific amino acid present in cytoplasm gets activated by specific amino acyl synthetase enzyme and ATP.It forms amino acyl adenylate enzyme complex. • Amino acid + ATP + Amino acyl synthetase. Mg +2 Amino acyl adenylate enzyme complex + PPi
Attachment of activated amino acids to the t- RNA. • The DHU loop of specific t-RNA recognizes the activated amino acid according to its anticodon. • The activated amino acid binds to the 3ed end of t-RNA. It results in the formation of amino acyl t- RNA.
Initiation of poly peptide chain
Initiation of poly peptide chain • The ribosome binds to the m-RNA at 5’ end. • The ribosome recognizes the initiator codon AUG on m-RNA. • The t- RNA having anticodon UAC carries formyl methionine acid to the site of initiator codon. • It initiates the poly peptide chain.
Elongation of polypeptide chain. • It is the linear growth of poly peptide chain on m- RNA.
• The charged t-RNA that carries specific amino acid enters the ribosome. It attaches to m-RNA next to initiator codon with the help of anticodon. • The peptide bond forms between these two amino acids by peptidyle synthetase. • As the peptide bond forms the t-RNA becomes uncharged. It leaves the ribosome. • The ribosome moves codon by codon in the direction of 5’ to 3’ end. • As the ribosome moves over m-RNA, the coded information decodes into polypeptide chain.
Termination of polypeptide chain • The termination of poly peptide chain takes place due to the presence of terminator codon UAA, UGA or UAG. • when terminator codon comes, it does not codes for any amino acid. It leads to termination of polypeptide chain. • The poly peptide chain synthesized releases out from ribosome. It undergoes folding to form specific protein. • The ribosome leaves the m-RNA.
Lac operon concept. OR Gene expression in prokaryotes. OR Inducesable operon concept. Lac-operon concept was first proposed by French biologists Jacob and Monad. Experimentally they demonstrated the regulation of gene in E.coli. 17 June 1920 (age 92) 9 February 1910 - 31 May , 1976.
• An operon is a group of genes that are transcribed at the same time. • The sequential arrangement of regulatory gene, promoter gene, operator gene and structural genes in prokaryotes is called operon concept.
• The lac operon consists of three structural genes. Each involved in processing the sugar lactose • One of them is the gene for enzyme β- galactosidase. This enzyme hydrolyses lactose into glucose and galactose.
Cultural situation for E.coli 1. When glucose is present and lactose is absent the E. coli does not produce β- galactosidase. 2. When glucose is absent and lactose is present the E. coli produce β-galactosidase.
• E. coli can use either glucose, which is a monosaccharide, or lactose, which is a disaccharide • The lactose needs to be hydrolysed (digested) first into glucose and galactose. • Promoter gene: It is the site for attachment of RNA polymerase II. It promotes the structural genes to transcribe through operator gene. • Operator gene: it operates and controls the expression of structural genes.
• Regulator gene: It regulates the operator gene incorporation with repressor chemical. • Structural genes: Three structural genes are present next to operator gene. They are, – Lac Z : codes for enzyme β –galactosidase. – Lac Y: codes for lactose permease – Lac A: codes for enzyme thiogalactoside transacetylase.
In absence of lactose. ( switched off condition)
• The E.coli bacteria that cultured in absence of lactose media, it would not produces the enzyme β –galactosidase. That necessary for lactose metabolism.
• In this condition structural genes are in switched off. • In absence of lactose, the repressor protein synthesized by regulator gene binds to operator gene.
• This blocks the RNA polymerase II to transcribe structural gene. • Hence enzymes are not produced.
In presence of lactose. ( switched on condition
• The E.coli bacteria that are cultured in presence of lactose media, it produces the enzyme β –galactosidase. It is necessary for lactose metabolism.
• In this condition structural genes are in switched on. • In presence of lactose, the repressor protein synthesized by regulator gene binds to lactose molecule. It forms repressor inducer complex.
• The inactive repressor complex does not binds to operator gene. • The RNA polymerase II transcribes structural genes to produce enzymes.
• U.S. govt. started Human genome project in 1990 co-ordinated by the Department of Energy and the National Institutes of Health. • GENOME – The whole hereditary information of an organism that is encoded in the DNA is called genome. • . Human Genome Project (HGP) was called a mega project because, 1. Human genome have approximately 3 x 109 bp. The cost of sequencing required 3 US $ per bp. Then total estimated cost of the project is 9 billion US dollars. 2. The obtained sequences were to be stored in typed form in books. If each page of the book contained 1000 letters. each book contained 1000 pages. Then 3300 such books need to store information from a single human cell.
• Aims or goal of the project: 1. Toidentify the approximate 20,000-25,000 genes in the human DNA. 2. Todetermine the sequences of the 3 billion bases that make up human DNA. 3. Tostore this information in data bases. 4. ToImprove tools for data analysis. 5. Toaddress the ethical, legal, and social issues that arise from genome research
• Methodologies : • The methods involved two major approaches. 1. Identifying all the genes that expressed as RNA (Expressed Sequence Tags - ESTs). 2. Blind approach of simply sequencing the whole set of genome. That contained all the coding and non- coding sequence. later assigning different regions in the sequence with functions (Sequence Annotation).
• Salient Features of Human Genome • The human genome contains 3164.7 million nucleotide bases. • The average gene consists of 3000 bases, but sizes varies. • the largest known human gene being dystrophin has2.4 million bases. • The total number of genes is estimated at 30,000. it is lower than previous estimates of 80,000 to 1,40,000 genes. • Almost all (99.9 per cent) nucleotide bases are exactly the same in all people. • The functions are unknown for over 50 per cent of discovered genes. • Less than 2 per cent of the genome codes for proteins.
• Repeated sequences make up very large portion of the human genome. • Chromosome 1 has most genes (2968), and the Y has the fewest (231). • Scientists have identified about 1.4 million locations where singlebase DNA differences (SNPs – single nucleotide polymorphism -‘snips. • This information helps to finding chromosomal locations for disease-associated sequences and tracing human history.
DNA finger printing technology • It is the technology used for identification of individual at genetic level. • This technology was first developed by alec Jeffreys, in 1985. • DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA, Born: 9 January 1950 (age 62) Oxford, United Kingdom
• These repetitive DNA are separated from bulk genomic DNA at different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA. • These sequences show high degree of polymorphism and form basis of DNA fingerprinting. • The inheritable mutation is observed in a population at high frequency it is referred as DNA polymorphism. • The principle of DNA finger printing is based on matching of VNTRs of DNA collected at crime spot with suspect person DNA.
• VNTRs: Variable number of tandem repeats. It is also called as mini satellites that shows very high degree of polymorphism. • VNTRs are very specific to individual and differs from person to person. It shows some similarities between family members. • VNTRs of identical twins are same. Hence it is not possible to identify individuality in identical twins by DNA finger printing technology. • Southern blotting: It is the technique of transferring DNA from agar gel to nylon sheath. • Probe: Single stranded polynucleotide fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene
Steps involved in DNA finger printing technology.
• The DNA finger printing technique involved Southern blot and hybridisation using radiolabelled VNTR as a probe. It included I. isolation of DNA, II. digestion of DNA by restriction endonucleases, III. separation of DNA fragments by electrophoresis, IV. transferring (blotting) of separated DNA fragments to nylon sheath. V. hybridisation using labelled VNTR probe, VI. detection of hybridised DNA fragments by autoradiography.
Application of DNA finger printing technology. 1. It is used to identify criminals and rapist. 2. Tosolve parental dispute. 3. Tosolve immigrant problems. 4. Toidentify dead bodies of soldiers died in wars. 5. Toidentify dead bodies of person died at accidents and bomb blast. 6. Toidentify racial groups. 7. Todetect inheritable disorders. 8. Todetect donor cell in case of transplantation.
• The DNA is isolated from the sample of blood cells, hair root cells, semen or bone collected at crime spot. • The DNA of suspect also collected and isolated separately. • The isolated DNA is treated with REN to cut into number of fragments. • The DNA fragments are separated according to their length on gel slab using gel electrophoresis. • The DNA strand on gel slab is treated with alkaline solution to split double strand in to single strand.
• The single strand DNA is transferred to nylon sheath using southern blotting technology. • The single stranded DNA is hybridized with radioactive probes of VNTRs . The excess of probes are washed off. • Nylon sheath is X-ray photographed to get bands of VNTRs. • The bands of X-ray sheath is the DNA finger print. • Comparing the DNA finger print of sample collected at crime spot with suspect identifies the individuality.
• Southern blotting: The technique of transferring DNA from agar gel to nylon sheath is called southern blotting. • Probe: Single stranded polynucleotide fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene
Thanku visit again

More Related Content

PPTX
Chapter 6. Molecular basis of inheritance.
bymohan bio
 
PDF
Molecular basis of inheritance
byV.s. Malik
 
PPTX
Class xii chapter 6
byRashmiSinha61
 
PDF
Molecular basis of inheritance
byShashi Kumar Shekhar
 
PDF
Molecular basis of Inheritance
byDr Janaki Pandey
 
PPT
The molecular basis of inheritance
bytanzeem khan
 
PPTX
The molecular basis of inheritance class 12
byAnurag Verma
 
PPTX
Molecular basis of inheritance
byDrPritimaGupta
 
Chapter 6. Molecular basis of inheritance.
bymohan bio
 
Molecular basis of inheritance
byV.s. Malik
 
Class xii chapter 6
byRashmiSinha61
 
Molecular basis of inheritance
byShashi Kumar Shekhar
 
Molecular basis of Inheritance
byDr Janaki Pandey
 
The molecular basis of inheritance
bytanzeem khan
 
The molecular basis of inheritance class 12
byAnurag Verma
 
Molecular basis of inheritance
byDrPritimaGupta
 

What's hot

PPT
16 the molecular basis of inheritance
bykindarspirit
 
PPT
Replication Of DNA
byMSCW Mysore
 
PPT
The molecular basis of inheritance
byMarlette Delos Santos
 
PPTX
Dna replication
byVijay Kumar Rayi
 
PPT
Chapter 16: Molecular Basis of Inheritance
byAngel Vega
 
PPT
Genetics chapter 7 dna structure and replication
byvanessawhitehawk
 
PPTX
Unit 1 genetics nucleic acids dna
byjane namane
 
PPTX
Unit 1 genetics nucleic acids dna
byLondeka Mkhize
 
PPTX
MOLECULAR BASIS OF INHERITANCE -DNA AS GENETIC MATERIAL
byNilima Patil
 
PPTX
Bacterial genetics
byDr Aaron Sarwal
 
PPT
Molecular Genetics
byJolie Yu
 
PPTX
6 molecular basis of inheritance extra
byTeenTraining
 
PPTX
Dna
bySuganyaPaulraj
 
PPTX
Bacterial genetics. Basics
bySociety for Microbiology and Infection care
 
PPTX
Recombinant dna technology
byDr Lekshmi Priya
 
PPTX
Recombinant DNA Technology
bykhyatigangwar
 
PPT
Chapter 16 molecular inheritance
byHeather Fogell
 
PDF
Basics of DNA
byGauri Jindal
 
PPTX
Nucleic acid and its chemistry, dna as genetic material
bydeepa sundari
 
16 the molecular basis of inheritance
bykindarspirit
 
Replication Of DNA
byMSCW Mysore
 
The molecular basis of inheritance
byMarlette Delos Santos
 
Dna replication
byVijay Kumar Rayi
 
Chapter 16: Molecular Basis of Inheritance
byAngel Vega
 
Genetics chapter 7 dna structure and replication
byvanessawhitehawk
 
Unit 1 genetics nucleic acids dna
byjane namane
 
Unit 1 genetics nucleic acids dna
byLondeka Mkhize
 
MOLECULAR BASIS OF INHERITANCE -DNA AS GENETIC MATERIAL
byNilima Patil
 
Bacterial genetics
byDr Aaron Sarwal
 
Molecular Genetics
byJolie Yu
 
6 molecular basis of inheritance extra
byTeenTraining
 
Dna
bySuganyaPaulraj
 
Bacterial genetics. Basics
bySociety for Microbiology and Infection care
 
Recombinant dna technology
byDr Lekshmi Priya
 
Recombinant DNA Technology
bykhyatigangwar
 
Chapter 16 molecular inheritance
byHeather Fogell
 
Basics of DNA
byGauri Jindal
 
Nucleic acid and its chemistry, dna as genetic material
bydeepa sundari
 

Similar to Class 12th molecular basis new f

PPTX
Molecular basis of inheritance by mohanbio
bymohan bio
 
PPTX
molecularbasisofinheritane-ppt-.pptx
byAmeenaBegum32
 
PPTX
molecularbasisofinheritane-ppt- (1).pptx
bySmilyshine
 
PPTX
Class 12th Biology Chapter MOLECULAR BASIS OF INHERITANCE
byvsatyam5180
 
PPTX
Class 12 Molecular Basis of Inheritance.pptx
byvabhishek5180
 
PDF
PROJECT WORK.pdf
by756http98ANONYMOUS
 
PDF
Molecular Basis of Inheritance Class 12th Biology CBSE CHSE
byVivek Kola
 
PPT
DNA Structure and Replication From Principle Of Genetics
bysanjaynagaraj2020
 
PPTX
molecular basis of inheritance in files .pptx
bynexgenofficial0001
 
PDF
CH- 6 MOLECULAR BASIS OF INHERITANCE (1).pdf
bySunitaKumar24
 
PPTX
DNA
byNafeesa Naeem
 
PPSX
Molecular basis of inheritane ppt
byblessiemary
 
PDF
CBSE Class 12 Biology Chapter 6 revision notes of Molecular basis of inheritance
bySarvarHussain4
 
PPTX
2 (1).pptx
byatabdlih
 
PPTX
DNA Deoxyribo nucleic acid-The Genetic Material.pptx
bykaneezfatima991385
 
PPT
DNA-An-overview......................ppt
byMary Magdelena Bautista
 
PPTX
Std 12 chapter 6
bySANJAY SIDDHAPURA- MKS 334, UTRAN,SURAT
 
PPTX
Nature structure and replication of genetic material
byYashwanth Jv
 
PPTX
genetic material in organization, Central dogma,transcription in prokaryotes ...
byPatelrushi11
 
PPT
Genetics dentistry part 2 2017
byLama K Banna
 
Molecular basis of inheritance by mohanbio
bymohan bio
 
molecularbasisofinheritane-ppt-.pptx
byAmeenaBegum32
 
molecularbasisofinheritane-ppt- (1).pptx
bySmilyshine
 
Class 12th Biology Chapter MOLECULAR BASIS OF INHERITANCE
byvsatyam5180
 
Class 12 Molecular Basis of Inheritance.pptx
byvabhishek5180
 
PROJECT WORK.pdf
by756http98ANONYMOUS
 
Molecular Basis of Inheritance Class 12th Biology CBSE CHSE
byVivek Kola
 
DNA Structure and Replication From Principle Of Genetics
bysanjaynagaraj2020
 
molecular basis of inheritance in files .pptx
bynexgenofficial0001
 
CH- 6 MOLECULAR BASIS OF INHERITANCE (1).pdf
bySunitaKumar24
 
DNA
byNafeesa Naeem
 
Molecular basis of inheritane ppt
byblessiemary
 
CBSE Class 12 Biology Chapter 6 revision notes of Molecular basis of inheritance
bySarvarHussain4
 
2 (1).pptx
byatabdlih
 
DNA Deoxyribo nucleic acid-The Genetic Material.pptx
bykaneezfatima991385
 
DNA-An-overview......................ppt
byMary Magdelena Bautista
 
Std 12 chapter 6
bySANJAY SIDDHAPURA- MKS 334, UTRAN,SURAT
 
Nature structure and replication of genetic material
byYashwanth Jv
 
genetic material in organization, Central dogma,transcription in prokaryotes ...
byPatelrushi11
 
Genetics dentistry part 2 2017
byLama K Banna
 

More from Bhanu Kalra

PPTX
Class 9 cvics chap 1
byBhanu Kalra
 
PPTX
Chapter13 organism and population
byBhanu Kalra
 
PPT
Chapter 9 class 9
byBhanu Kalra
 
PPT
Class 9 tissue chapter 6
byBhanu Kalra
 
PPTX
Class 11 chapter 2
byBhanu Kalra
 
PPTX
Howdoorganismsreproduce 141026012923-conversion-gate02 (1)
byBhanu Kalra
 
PPTX
Class 12 biology human reproductive ...
byBhanu Kalra
 
PPTX
Sexualrepro flowering BY BHANU KALRA
byBhanu Kalra
 
PPTX
Class 9th matter in our surrounding
byBhanu Kalra
 
PPTX
1sound
byBhanu Kalra
 
Class 9 cvics chap 1
byBhanu Kalra
 
Chapter13 organism and population
byBhanu Kalra
 
Chapter 9 class 9
byBhanu Kalra
 
Class 9 tissue chapter 6
byBhanu Kalra
 
Class 11 chapter 2
byBhanu Kalra
 
Howdoorganismsreproduce 141026012923-conversion-gate02 (1)
byBhanu Kalra
 
Class 12 biology human reproductive ...
byBhanu Kalra
 
Sexualrepro flowering BY BHANU KALRA
byBhanu Kalra
 
Class 9th matter in our surrounding
byBhanu Kalra
 
1sound
byBhanu Kalra
 

Recently uploaded

PPTX
West Hatch High School - GCSE Spanish Presentation
byWestHatch
 
PDF
Fast Followers Project, Embedding Net Zero into Wakefield Metropolitan Distri...
byAssociation for Project Management
 
PPTX
TLE 8 W1 Q4 D2.pptx COMMON FLOOR PLAN SYMBOLS PLUMBING SYMBOLS
byraquelanaaltres1
 
PPTX
YSPH VMOC Special Report - Measles - The Americas 1-25-2026
byYale School of Public Health - The Virtual Medical Operations Center (VMOC)
 
PPTX
West Hatch High School - GCSE Art Presentation
byWestHatch
 
PPTX
Metabolism ( BIOCHEMISTRY & CLINICAL PATHOLOGY )
byBushraDeshpande
 
PDF
Information about the author Shashi Deshpande
bydarshanaparmar6522
 
PDF
Beak Modifications by Dr. Ramzan Virani pptx.pdf
byDr. Ramzan Virani
 
PPTX
Powerpoint for testing in embed test with Sway
byjeanpierrefort3
 
PPT
West Hatch High School - GCSE History Option
byWestHatch
 
PPTX
PREVENTIVE PEDIATRICS.pptx
byBANDITA PATRA
 
PPTX
Exploring Higher education and its pathways
byEVAMAEBONGHANOY5
 
PPTX
Reimagining Academic Library Services through Artificial Intelligence: A Case...
byDon Bosco College, Itanagar
 
PDF
Risks and opportunities of artificial intelligence in education: A critical view
byYannis
 
PPTX
Payment Follow-Up via WhatsApp in Odoo 18.1 Accounting
byCeline George
 
PPTX
Poster Based Ethical Reflection - Dharma and Values Poster.pptx
byRajshreeBeneymadoo
 
PPTX
Mohan - "A man of silence and authority"
bynidhibachauhan46
 
PPTX
That long silence - Novel by Shashi Deshapande
bysanjanavaghela65
 
PDF
West Hatch High School - GCSE French Specification
byWestHatch
 
PPTX
Definition of communication skills and it's process.
bypurvrajsinhsarvaiya0
 
West Hatch High School - GCSE Spanish Presentation
byWestHatch
 
Fast Followers Project, Embedding Net Zero into Wakefield Metropolitan Distri...
byAssociation for Project Management
 
TLE 8 W1 Q4 D2.pptx COMMON FLOOR PLAN SYMBOLS PLUMBING SYMBOLS
byraquelanaaltres1
 
YSPH VMOC Special Report - Measles - The Americas 1-25-2026
byYale School of Public Health - The Virtual Medical Operations Center (VMOC)
 
West Hatch High School - GCSE Art Presentation
byWestHatch
 
Metabolism ( BIOCHEMISTRY & CLINICAL PATHOLOGY )
byBushraDeshpande
 
Information about the author Shashi Deshpande
bydarshanaparmar6522
 
Beak Modifications by Dr. Ramzan Virani pptx.pdf
byDr. Ramzan Virani
 
Powerpoint for testing in embed test with Sway
byjeanpierrefort3
 
West Hatch High School - GCSE History Option
byWestHatch
 
PREVENTIVE PEDIATRICS.pptx
byBANDITA PATRA
 
Exploring Higher education and its pathways
byEVAMAEBONGHANOY5
 
Reimagining Academic Library Services through Artificial Intelligence: A Case...
byDon Bosco College, Itanagar
 
Risks and opportunities of artificial intelligence in education: A critical view
byYannis
 
Payment Follow-Up via WhatsApp in Odoo 18.1 Accounting
byCeline George
 
Poster Based Ethical Reflection - Dharma and Values Poster.pptx
byRajshreeBeneymadoo
 
Mohan - "A man of silence and authority"
bynidhibachauhan46
 
That long silence - Novel by Shashi Deshapande
bysanjanavaghela65
 
West Hatch High School - GCSE French Specification
byWestHatch
 
Definition of communication skills and it's process.
bypurvrajsinhsarvaiya0
 

Class 12th molecular basis new f

  • 1.
  • 2.
    • Nucleic acids. •Nucleic acids are the macromolecules present in all living cell. • Freidrich Miescher was the first person isolated the nucleic acids from the pus cells. He called it as nuclein. • As it has an acidic nature, hence Altmann called it as nucleic acids. • The two types of nucleic acids found in living organisms are, 1. Deoxyribonucleic acid [DNA] 2. Ribonucleic acid [RNA].
  • 3.
    • Deoxyribonucleic acid[DNA] • DNA is the genetic material of all living organisms. This carries the coded information from one generation to another generation. • It is a long polymer of deoxyribonucleotides. • The length of the DNA depends on, number of nucleotide pair present in it. • In eukaryotic cell DNA is found nucleus. It is the chief component of chromosomes. DNA also found in the mitochondria and chloroplasts
  • 4.
    • Chemically DNAis composed of Deoxyribose sugar, Phosphate group and nitrogenous base . • Deoxyribose sugar: It is a pentose sugar heaving the molecular formula C5H10O4. • Phosphate group: The phosphoric acid forms the phosphate group. • its molecular formula is H3PO4. It is responsible for acidic nature of DNA.
  • 5.
    • Nitrogenous base:Nitrogenous base are the nitrogen containing compounds. These are mainly divided in to two types as 1. Purines . 2. Pyrimidines. • Purines: Purines are the double ring heterocyclic structural compounds. The two types of purines present in the DNA are Adenine (A) and Guanine (G).
  • 6.
    • Pyrimidine: Pyrimidinesare the single ring structured compounds. The two types of pyrimidines present in the DNA are Cytosine (C) and Thymine (T). • Nucleosides: compounds formed by the combination of pentose sugar and Nitrogenous base is called nucleosides. • A nitrogen base attached to the C1 of pentose sugar by N-glycosidic linkage. • In DNA Nucleosides are formed by the combination of deoxyribose sugar and nitrogenous base .
  • 7.
    • Adenine +deoxyribose sugar = Deoxyadenosine • Guanine + deoxyribose sugar = Deoxygaunosine. • Cytosine + deoxyribose sugar = Deoxycytidine. • Thymine + deoxyribose sugar =Deoxythymidine
  • 8.
    • Nucleotides: Thecompound formed by the combination of phosphate groups with nucleosides is called nucleotides. • The four types of nucleotides present in the DNA are, 1. Deoxyadenosine monophosphate. 2. Deoxygaunosine monophosphate. 3. Deoxycytidine monophosphate. 4. Deoxythymidine monophosphate.
  • 9.
    • Polynucleotide strand: Numberof nucleotides linked each other by phospho-di-ester bond and forms a long chain of molecule called polynucleotide strand. • The phospho-di-ester bond forms between 5th and 3ed carbon atom position of pentose sugar. Therefore polynucleotide strand contains 5th and 3ed end.
  • 10.
    Structure of DNAor Double helix structure of DNA • J.D.Watson and F.H.C.Crick first proposed the structural model of DNA in 1953. • They got the Nobel Prize for their work in 1962. • According to Watson and Crick model of DNA, ‘The DNA contains two polynucleotide strands coiled together in helical manner’. Hence the name Watson and Crick double helix structure of DNA is given.
  • 11.
    James Dewey Watson:April 6th, 1928 Nobel prize winner at the age of 34 (1962)
  • 12.
    Francis Harry ComptonCrick: (8 June 1916 – 28 July 2004)
  • 13.
    • The structureof DNA is as fallows, • The DNA is a double stranded polynucleotide molecule. • Sugar and phosphate forms the backbone . The bases projected to inside. • The two strands are coiled each other and arranged antiparallely. I.e. if one strand has 5th to 3ed and other has 3ed to 5th in direction. • The two strands of DNA have the common diameter of 20 0A. • Adenine of one strand pairs with Thymine of another strand by two hydrogen bonds and vice versa. • Guanine of one strand pairs with Cytosine of another strand by three hydrogen bonds and vice versa..
  • 14.
    • Because ofcomplementary base pairing arrangement, if one strand of polynucleotide sequence is known, another can be deduced. • Ex: 5th AGCTTTACATACCGGAAAATTACAGT 3ed first strand. • 3ed TCGAAATGTATGGCCTTTTAATGTCA 5TH second strand. • The complementary strand twisted each other at the distance of 34 0A. • Each twist of DNA contains 10 base pair. • The distance between these two base pairs are 3.4 0A.
  • 17.
    • Central dogma •One way flow of genetic information from DNA to protein is called central dogma. • DNA→ RNA→ Protein. • Packaging of DNA in prokaryotes: • Prokaryotes do not have definite nucleus. • The DNA is not scattered throughout the cell. • It is held together with some proteins in a region is called ‘nucleoid’. • The DNA in nucleoid is organized in large loops held be proteins.
  • 18.
    • Packaging ofDNA in Eukaryotes: • In eukaryotes DNA is stabilized with positively charged, basic protein called Histones. • Histones are positively charged due to rich in basic amino acids like Lysines and arginines. • Histones are organized to form a unit of eight molecules called histone octamere.
  • 19.
    • Negatively chargedDNA wrapped around positively charged histone octamere to form a structure called nucleosome. • The nucleosomes are seen as ‘beads-on-string’ structure under electron microscope. • Nucleosome forms the repeating unit of a structure in nucleus called chromatin,
  • 20.
    • The chromatinis packaged to form chromatin fibers. These are further coiled and condensed at metaphase stage to form chromosome. • euchromatin: In the nucleus some loosely coiled regions of chromatin (light stained) is called euchromatin. • Heterochromatin: In the nucleus more densely packed regions of chromatin (stains dark) are called Heterochromatin. • Euchromatin is transcriptionally active than heterochromatin.
  • 21.
    • Transforming principle: •Frederich Griffith conducted experiments to show Transforming principle in bacteria • He conducted an experiment on mice and pneumonia bacteria streptococcus pneumoniae. These bacteria are found in two strains, as • 1 virulent (smooth strain) • 2 non-virulent (rough strain). • The S-strain bacteria produce capsule and is pathogenic. • The R-strain lacks capsule and is non pathogenic.
  • 23.
    • When theR-strains are injected into the mouse, it is a non pathogenic and does not causes pneumonia. The mouse continued to live. • When the S-strains are injected into the mouse, that causes pneumonia and mouse dies. • When heat killed S-strains are injected into the mouse that does not causes pneumonia. The mouse continued to live. • When the heat killed S-strains and R-strain are mixed and injected into the mouse, that causes pneumonia and mouse dies.
  • 24.
    • Conclusion ofexperiment: • R – Strain bacteria had been transformed by the heat killed S-Strain bacteria. • The transformation of R-Strain to S-Strain is due to transfer of Genetic material. • The biochemical nature of genetic material was not defined from his experiment.
  • 25.
    • Biochemical characterizationof transforming principle: • Oswald Avery, Colin Macleod and Maclyn McCarty. (1933-44) worked to determine the biochemical nature of the ‘transforming principle’ of Griffith’s experiment. • They purified biomolecules (proteins, DNA and RNA) from the heat killed S strain. They added digestive enzyme of each, to see which one could transform live R cells to S cells.
  • 26.
    • Heat killedS-Strain + protease + Live R-Strain → transforms R strain to S strain. • Heat killed S-Strain + RNase + Live R-Strain → transforms R strain to S strain. • Heat killed S-Strain + DNase + Live R-Strain → unable to transforms R strain to S strain.
  • 27.
    • Conclusion ofthe experiments: • Protein of heat killed S-Strain is not the genetic material • RNA of heat killed S-Strain is not the genetic material. • DNA of heat killed S-Strain is the genetic material. – Because DNA digested with DNase mixed with R-strain unable to transform R-Strain to S-Strain. • But all biologist are not convienced.
  • 28.
    • The GeneticMaterial is DNA: • ‘DNA is the genetic material’ is proved by Alfred Hershey and Martha Chase (1952). • They worked on the virus that infects bacteria called bacteriophage. • During infection the bacteriophage first attaches the bacteria cell wall. It inserts its genetic material into the bacterial cell.
  • 29.
    • The viralgenetic material became part of the bacterial genome. It manufactures more virus particle using host content. • Hershey and Chase worked to discover whether it was protein or DNA from the viruses that entered the bacteria. • Experiment :( blenders experiment) • They grew some viruses on a medium having radioactive phosphorus . Some others on medium having radioactive sulfur. • Viruses grown in radioactive Phosphorus have radioactive DNA but not radioactive protein. Because Phosphorus present in DNA not in protein. • Viruses grown in radioactive sulfur have radioactive protein not radioactive DNA. Because sulfur present in protein but not in DNA.
  • 31.
    • radioactive phageswere allowed to infect E.coli bacteria. The phages transfer the genetic material to the bacteria. • The viral coats were separated from the bacteria surface by blender. • The virus particles were separated from the bacteria by centrifuge machine. • Observation: • Bacteria infected with viruses that had radioactive DNA were radioactive. No radioactivity in the supernatant. • Bacteria infected with viruses that had radioactive protein were not radioactive. But radioactivity found in the supernatant. • Conclusion of Experiment: • DNA is the infecting agent that made the bacteria radioactive hence DNA is the genetic material not the protein.
  • 32.
    • Criteria forgenetic material: • It should be able to generate its replica (replication) • It should be chemically and structurally stable. • It should provide slow changes (mutation) that required for evolution. • It should be able to express itself in the form of ‘Mendelian Character’. • Protein dose not fulfill the criteria hence it is not the genetic material. • RNA and DNA fulfill the criteria.
  • 33.
    • Replication ofDNA: • “It is the process by which DNA produces the exact copies of the original DNA." • In eukaryotes, DNA is double stranded. The two strands are complementary to each other because of their base sequences. • Semi-conservative method of DNA replication • It is the most common method of DNA replication. • It takes place in the nucleus where the DNA is present. • Replication takes place in the S-phase of cell cycle. • Deoxyribose nucleotides needed for formation of new DNA strands are present in nucleoplasm.
  • 34.
    • At thetime of replication two strands of DNA separates. • Each strand acts as a template for the formation of a new strand. • A new strand is constructed on each old strand by complementary base pairing. • Hence two exactly identical double stranded DNA molecules are formed. • In each new DNA molecule, one strand is old while the other is newly formed. Hence, Watson and Crick described this method as semi-conservative replication. .
  • 35.
    Semi conservative natureof DNA Mathew Messelson and Franklin start.
  • 39.
    Semi conservative natureof DNA Mathew Messelson and Franklin stahl. • They grew E. coli on 15 NH4Cl culture medium. 15N is the heavy isotope of nitrogen • Both strands of DNA have 15N (15N 15N). • These bacteria are Shifted to 14NH4Cl culture medium • DNA extracted subjected to [Cesium Chloride (CsCl)] CsCl density gradient centrifugations. • Hybrid/ Intermediate type of DNA (15N 14N) • After next generation equal amount of light DNA (14N 14N) and hybrid DNA (15N 14N) are formed.
  • 40.
    • Mechanism ofDNA replication: • The process of DNA replication takes place by number of substance, enzymes and proteins. They are, • Substance: Deoxyribonucleotides. • Enzymes: DNA Helicase. DNA Polymarase III, II, I. RNA Primase. DNA ligase. • Protein: SSB [ single strand binding protein]
  • 43.
    • Mechanism ofreplication starts at a specific point of DNA molecule called point of ori. • At origin, DNA strand unwinds by breaking hydrogen bonds. This takes place with the help of an enzyme DNA Helicases. • At the point separation it appears like a fork or a Y- shape. It is called replication fork. • Each old DNA strand acts as a template for the synthesis of new strand. • SSB protein attaches to un-winded strand and prevents rejoining. • the synthesis of new DNA strand on old strand takes place by an enzymes DNA polymerase III. It adds new nucleotides through complementary base pairing.
  • 44.
    • DNA polymeraseIII always synthesis new strand in 5 to 3 direction. • The synthesis of new strand for the parent templet strand heaving 3 to 5 end is continuous. This strand is called leading strand. • The synthesis of new strand for the parent templet strand heaving 5 to 3 end is discontinuous. It forms by small segments of DNA called Okazoki fragments. This strand is called lagging strand . • During the formation of okazoki fragment RNA primase first synthesis RNA primer
  • 45.
    • DNA polymaraseIII continuous the synthesis of okazoki fragment in 5 to3 direction. • At the end RAN primer are replaced by deoxyribonucleotides with the help of enzyme DNA polymarase I. • The okazoki fragments joins together with the help of an enzyme DNA ligase. • DNA polymarase II once again checks and repairs the errors occurred in new strand.
  • 46.
    Central dogma. • Oneway flow of information from DNA to m- RNA and from m-RNA to protein is called central dogma.
  • 47.
    Mechanism of Transcription. •The processes of transcription takes place by 1. DNA helicase. 2. RNA polymerase II. 3. Ribonucleotides. • Ribonucleoside monophosphate activates into ribonucleoside tri phosphate by phosphorylase enzyme and phosphoric acid. Hence ATP,GTP,UTP, CTP forms.
  • 48.
    • Transcription beginsby uncoiling of DNA at specific site called promoter region of cistron. It takes place by DNA helicase. • RNA polymerase II recognizes and binds to the promoter sequence. • RNA polymerase II synthesis RNA, always from 5’ to 3’ direction. • Hence among two strands of DNA one strand 3’ to 5’ end act as a templet.
  • 49.
    5' 3' G C AG T A C A T G T C C G T C A T G T A C A G 3' 5' coding strand template strand transcription RNAG C A G U A C A U G U C5' 3'
  • 51.
    • The complementarybase for templet strand pairs to transcribe m- RNA. • When the RNA polymerase reaches the terminator point, synthesis of RNA stops up. • Newly synthesized m-RNA in eukaryotic is called hnRNA (heterogeneous RNA). It undergoes post transcriptional process by splicing. • The eukaryotic m-RNA contains exons and introns. In splicing introns are removed and exons are joined in a defined order.
  • 52.
    • hnRNA undergoesadditional processing called as capping and tailing. • In capping an unusual nucleotide methyl guanosine triphosphate is added to the 5′-end of hnRNA. • In tailing, adenylate residues are added at 3′- end as a template independent manner. • Fully processed hnRNA, now called mRNA. It transported out of the nucleus for translation
  • 53.
    Messenger RNA (m-RNA) •It is the RNA that carries message from DNA to the site of protein synthesis. It represents about 5 to 10% of the total RNA of cell. • It carries the genetic information in the form of triplet codons,
  • 54.
    • m-RNA isa single stranded poly nucleotide chain. • The eukaryotic m-RNA contains a cap at 5th end composed of 7 methyl gonosine. It is absent in prokaryotic m-RNA. • Next to the cap it has non coding region called leader sequence. • Next to it has an initiator codon. AUG. It initiate the protein synthesis.
  • 55.
    • Next toinitiator codon, the coding sequence is present. It codes for specific protein. It is called exon. • Next to this terminator codon, UAA, UGA or UAG is present. It terminates the protein synthesis. • Next to this again non coding region is present. • In eukaryotic m-RNA poly A tail is present at 3’ end.
  • 56.
    Functions of r-RNA: 1. It helps in binding of ribosomes to m-RNA. 2. It acts as an enzyme(ribozymes), helps in formation of peptide bond during protein synthesis.
  • 57.
    Difference between DNAand RNA DNA • Has high molecular weight. • Double stranded poly nucleotide chain. • Deoxy ribose sugar is the pentose sugar. • Thymine is present. • Unusual nitrogen bases are absent • Genetic material of living organism. RNA • Has very low molecular weight. • single stranded poly nucleotide chain. • ribose sugar is the pentose sugar. • Uracil is present. • Unusual nitrogen bases are present. • Genetic material of some virus.
  • 58.
    Note: • RNA polymeraseis also called DNA dependent RNA polymerase. • RNA polymerase I is found in nucleolus and helps in synthesis of r- RNA. Hence nucleolus is called ribosome factories of cell. • RNA polymerase II helps in synthesis of m-RNA. • RNA polymerase III helps in synthesis of t-RNA. • Ribosomal RNA is the insoluble RNA. • Pribnow box: It is a DNA sequence found in the promoter region of genes in prokaryotes. It has the sequence of TATAATG. • TATAbox: The TATAbox (Goldberg-Hogness box) is a DNA sequence found in the promoter region of genes in eukaryotes. It has the sequence of TATAAAT.
  • 59.
    Concept of gene. •Gene is the basic unit of inheritance that express specific character. • 1857 - Gregor Johann Mendel conducted hybridization experiments with pea plants. He called them as factors. • 1909 - Danish botanist Johannsen proposed that each portion of a chromosome that controls a phenotype is called a “gene” (Greek: “to give birth to”). • 1941 - George W.Beadle and Edward L. Tatum discovered that genes control the production of enzymes. They proposed One gene one enzyme hypothesis.
  • 60.
    • 1944 -Oswald T. Avery announced that DNA is the substance responsible for heredity. • 1950’s – Watson and Crick discover chemical structure of DNA, • The gene is made up of a specific sequence of DNA nucleotides. • Symer Benzer proposed modern concept of gene, while working on Ecoli and T4 bacteriophage. • According to him gene is , 1. Cistron. 2. Recon. 3. Muton. 4. Replicon
  • 61.
    • Cistron: Itis the structural gene. It is functional unit of DNA molecule that codes for specific protein. • Recon: It is the unit of DNA that undergoes recombination. • Muton: It is the unit of DNA that capable to undergo mutation. • Replicon: It is the unit of DNA that undergoes preplication.
  • 62.
    • Genetic code:The three specific nucleotide sequence that codes for specific amino acid present in DNA is called genetic code. • Codon: The three specific nucleotide sequence that codes for specific amino acid present in m-RNA is called codon. • Anti codon: The three specific nucleotide sequence that codes for specific amino acid present in anticodon arm of t-RNA is called anticodon. • Anticodons are complementary to codons.
  • 63.
    General features ofgenetic code. • The genetic code is triplet: Each codon is made up of three specific nucleotides. • Genetic code is universal: each codon codes for specific amino acid in all living organism. • Genetic codons are no over lapping: Adjacent codon never shares there nucleotides. • Genetic code is comma less: There is no gap between neighboring codon. • Genetic codon is degenerative in nature: more than one codon codes for single amino acid. • Ex GUA, GUG, GUC,GUU codes for valine.
  • 65.
    • Initiator codon:AUG is the initiator codon that initiates the protein synthesis. It codes for amino acid methionine. • Terminator codon: Among 64 codon, three codon UAG, UGA, UAA does not codes for any amino acids. These are called terminator codon or non-sense codon. • Genetic code is unambiguous: Each codon codes for specific amino acid, and only one amino acid. • Ex: The codon UUU codes for the amino acid phenyl alanine only. • Genetic code is unidirectional: codon reads only in 5’ to 3’ direction. • Wobble base: In each codon third nitrogenous base is less specific. • Ex: GUA, GUC, GUG, GUU codes for valine.
  • 66.
    Transfer RNA (t-RNA) •The RNA that carries and transports activated amino acid to the site of protein synthesis is called t-RNA. • It represents about 10 to 15% of the total RNA in the cell. • The polynucleotide chain is folded on itself to have the shape of a cloverleaf. • Cloverleaf model of t-RNA was proposed by American biochemist Robert Holley in 1965. He shared the Nobel Prize in Physiology in 1968 1922 - 1993
  • 67.
    Structure of t-RNA. • t- RNA is a single stranded polynucleotide chain. It folds in some region and resembles as trifoliate leaf of clover plant. • It contains 4 arms as, 1. Amino acid binding site or acceptor arm. 2. T ѰC arm and loop. 3. DHU arm and loop. 4. Anticodon arm and loop. 5. Rarely small 5th arm is present is called variable arm. • The 5’end has methylated guanosine. • The 3’ end has three free nitrogen bases CCA.
  • 68.
    • Each armhas paired base pairs stem and unpaired base pairs loop. • Amino acid acceptor arm has 7 base pairs and 3 unpaired bases CCA at 3’end. Therefore amino acid always binds to adenine present in the 3’end. • T ѰC arm and loop contains unusual sequence of nucleotides as thymine (T), pseudo uridine ( Ѱ) and cytosine (C). It helps to bind ribosome at the time of protein synthesis.
  • 69.
    • DHU armand loop contains dihydrouridine. It helps to recognizing specific amino acid activating enzymes amino acyl synthetase. • The anti codon loop contains 7 unpaired nitrogen bases. Among them 3 nucleotides acts as anticodon which are complementary to codon of m- RNA. • Functions: It carries specific amino acid towards the site of protein synthesis.
  • 72.
    Ribosomal RNA (r-RNA): •r- RNA is the structural and functional unit of ribosomes. • It represents nearly 80% of the total RNA in the cell.
  • 73.
    • Translation: • decodingthe coded information carried by m- RNA into protein is called translation. OR • Synthesis of poly peptide chain on m-RNA strand with the help of t-RNA and ribosomes is called translation. • Translation takes place in cytoplasm. • The required components for translation are, 1. m-RNA. 2. t-RNA. 3. Ribosomes. 4. Amino acids. 5. Amino acyl synthetase. 6. Peptidyle synthetase. 7. ATP. 8. GTP. 9. Mg +2
  • 74.
    • The processof translation takes place by 5 steps. 1. Activation of amino acids. 2. Attachment of activated amino acids to the t- RNA. 3. Initiation of poly peptide chain. 4. Elongation of polypeptide chain. 5. Termination of polypeptide chain.
  • 75.
    Activation of aminoacids. • The specific amino acid present in cytoplasm gets activated by specific amino acyl synthetase enzyme and ATP.It forms amino acyl adenylate enzyme complex. • Amino acid + ATP + Amino acyl synthetase. Mg +2 Amino acyl adenylate enzyme complex + PPi
  • 76.
    Attachment of activatedamino acids to the t- RNA. • The DHU loop of specific t-RNA recognizes the activated amino acid according to its anticodon. • The activated amino acid binds to the 3ed end of t-RNA. It results in the formation of amino acyl t- RNA.
  • 78.
    Initiation of polypeptide chain
  • 79.
    Initiation of polypeptide chain • The ribosome binds to the m-RNA at 5’ end. • The ribosome recognizes the initiator codon AUG on m-RNA. • The t- RNA having anticodon UAC carries formyl methionine acid to the site of initiator codon. • It initiates the poly peptide chain.
  • 80.
    Elongation of polypeptidechain. • It is the linear growth of poly peptide chain on m- RNA.
  • 81.
    • The chargedt-RNA that carries specific amino acid enters the ribosome. It attaches to m-RNA next to initiator codon with the help of anticodon. • The peptide bond forms between these two amino acids by peptidyle synthetase. • As the peptide bond forms the t-RNA becomes uncharged. It leaves the ribosome. • The ribosome moves codon by codon in the direction of 5’ to 3’ end. • As the ribosome moves over m-RNA, the coded information decodes into polypeptide chain.
  • 86.
    Termination of polypeptidechain • The termination of poly peptide chain takes place due to the presence of terminator codon UAA, UGA or UAG. • when terminator codon comes, it does not codes for any amino acid. It leads to termination of polypeptide chain. • The poly peptide chain synthesized releases out from ribosome. It undergoes folding to form specific protein. • The ribosome leaves the m-RNA.
  • 90.
    Lac operon concept. OR Geneexpression in prokaryotes. OR Inducesable operon concept. Lac-operon concept was first proposed by French biologists Jacob and Monad. Experimentally they demonstrated the regulation of gene in E.coli. 17 June 1920 (age 92) 9 February 1910 - 31 May , 1976.
  • 91.
    • An operonis a group of genes that are transcribed at the same time. • The sequential arrangement of regulatory gene, promoter gene, operator gene and structural genes in prokaryotes is called operon concept.
  • 92.
    • The lacoperon consists of three structural genes. Each involved in processing the sugar lactose • One of them is the gene for enzyme β- galactosidase. This enzyme hydrolyses lactose into glucose and galactose.
  • 93.
    Cultural situation forE.coli 1. When glucose is present and lactose is absent the E. coli does not produce β- galactosidase. 2. When glucose is absent and lactose is present the E. coli produce β-galactosidase.
  • 94.
    • E. colican use either glucose, which is a monosaccharide, or lactose, which is a disaccharide • The lactose needs to be hydrolysed (digested) first into glucose and galactose. • Promoter gene: It is the site for attachment of RNA polymerase II. It promotes the structural genes to transcribe through operator gene. • Operator gene: it operates and controls the expression of structural genes.
  • 95.
    • Regulator gene:It regulates the operator gene incorporation with repressor chemical. • Structural genes: Three structural genes are present next to operator gene. They are, – Lac Z : codes for enzyme β –galactosidase. – Lac Y: codes for lactose permease – Lac A: codes for enzyme thiogalactoside transacetylase.
  • 96.
    In absence oflactose. ( switched off condition)
  • 97.
    • The E.colibacteria that cultured in absence of lactose media, it would not produces the enzyme β –galactosidase. That necessary for lactose metabolism.
  • 98.
    • In thiscondition structural genes are in switched off. • In absence of lactose, the repressor protein synthesized by regulator gene binds to operator gene.
  • 99.
    • This blocksthe RNA polymerase II to transcribe structural gene. • Hence enzymes are not produced.
  • 100.
    In presence oflactose. ( switched on condition
  • 101.
    • The E.colibacteria that are cultured in presence of lactose media, it produces the enzyme β –galactosidase. It is necessary for lactose metabolism.
  • 102.
    • In thiscondition structural genes are in switched on. • In presence of lactose, the repressor protein synthesized by regulator gene binds to lactose molecule. It forms repressor inducer complex.
  • 103.
    • The inactiverepressor complex does not binds to operator gene. • The RNA polymerase II transcribes structural genes to produce enzymes.
  • 105.
    • U.S. govt.started Human genome project in 1990 co-ordinated by the Department of Energy and the National Institutes of Health. • GENOME – The whole hereditary information of an organism that is encoded in the DNA is called genome. • . Human Genome Project (HGP) was called a mega project because, 1. Human genome have approximately 3 x 109 bp. The cost of sequencing required 3 US $ per bp. Then total estimated cost of the project is 9 billion US dollars. 2. The obtained sequences were to be stored in typed form in books. If each page of the book contained 1000 letters. each book contained 1000 pages. Then 3300 such books need to store information from a single human cell.
  • 106.
    • Aims orgoal of the project: 1. Toidentify the approximate 20,000-25,000 genes in the human DNA. 2. Todetermine the sequences of the 3 billion bases that make up human DNA. 3. Tostore this information in data bases. 4. ToImprove tools for data analysis. 5. Toaddress the ethical, legal, and social issues that arise from genome research
  • 107.
    • Methodologies : •The methods involved two major approaches. 1. Identifying all the genes that expressed as RNA (Expressed Sequence Tags - ESTs). 2. Blind approach of simply sequencing the whole set of genome. That contained all the coding and non- coding sequence. later assigning different regions in the sequence with functions (Sequence Annotation).
  • 108.
    • Salient Featuresof Human Genome • The human genome contains 3164.7 million nucleotide bases. • The average gene consists of 3000 bases, but sizes varies. • the largest known human gene being dystrophin has2.4 million bases. • The total number of genes is estimated at 30,000. it is lower than previous estimates of 80,000 to 1,40,000 genes. • Almost all (99.9 per cent) nucleotide bases are exactly the same in all people. • The functions are unknown for over 50 per cent of discovered genes. • Less than 2 per cent of the genome codes for proteins.
  • 111.
    • Repeated sequencesmake up very large portion of the human genome. • Chromosome 1 has most genes (2968), and the Y has the fewest (231). • Scientists have identified about 1.4 million locations where singlebase DNA differences (SNPs – single nucleotide polymorphism -‘snips. • This information helps to finding chromosomal locations for disease-associated sequences and tracing human history.
  • 113.
    DNA finger printingtechnology • It is the technology used for identification of individual at genetic level. • This technology was first developed by alec Jeffreys, in 1985. • DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA, Born: 9 January 1950 (age 62) Oxford, United Kingdom
  • 114.
    • These repetitiveDNA are separated from bulk genomic DNA at different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA. • These sequences show high degree of polymorphism and form basis of DNA fingerprinting. • The inheritable mutation is observed in a population at high frequency it is referred as DNA polymorphism. • The principle of DNA finger printing is based on matching of VNTRs of DNA collected at crime spot with suspect person DNA.
  • 115.
    • VNTRs: Variablenumber of tandem repeats. It is also called as mini satellites that shows very high degree of polymorphism. • VNTRs are very specific to individual and differs from person to person. It shows some similarities between family members. • VNTRs of identical twins are same. Hence it is not possible to identify individuality in identical twins by DNA finger printing technology. • Southern blotting: It is the technique of transferring DNA from agar gel to nylon sheath. • Probe: Single stranded polynucleotide fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene
  • 116.
    Steps involved inDNA finger printing technology.
  • 118.
    • The DNAfinger printing technique involved Southern blot and hybridisation using radiolabelled VNTR as a probe. It included I. isolation of DNA, II. digestion of DNA by restriction endonucleases, III. separation of DNA fragments by electrophoresis, IV. transferring (blotting) of separated DNA fragments to nylon sheath. V. hybridisation using labelled VNTR probe, VI. detection of hybridised DNA fragments by autoradiography.
  • 119.
    Application of DNAfinger printing technology. 1. It is used to identify criminals and rapist. 2. Tosolve parental dispute. 3. Tosolve immigrant problems. 4. Toidentify dead bodies of soldiers died in wars. 5. Toidentify dead bodies of person died at accidents and bomb blast. 6. Toidentify racial groups. 7. Todetect inheritable disorders. 8. Todetect donor cell in case of transplantation.
  • 120.
    • The DNAis isolated from the sample of blood cells, hair root cells, semen or bone collected at crime spot. • The DNA of suspect also collected and isolated separately. • The isolated DNA is treated with REN to cut into number of fragments. • The DNA fragments are separated according to their length on gel slab using gel electrophoresis. • The DNA strand on gel slab is treated with alkaline solution to split double strand in to single strand.
  • 121.
    • The singlestrand DNA is transferred to nylon sheath using southern blotting technology. • The single stranded DNA is hybridized with radioactive probes of VNTRs . The excess of probes are washed off. • Nylon sheath is X-ray photographed to get bands of VNTRs. • The bands of X-ray sheath is the DNA finger print. • Comparing the DNA finger print of sample collected at crime spot with suspect identifies the individuality.
  • 122.
    • Southern blotting:The technique of transferring DNA from agar gel to nylon sheath is called southern blotting. • Probe: Single stranded polynucleotide fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene
  • 123.