The document discusses the major characteristics used in taxonomy to identify microorganisms. It describes morphological characteristics like cell shape, size, staining reactions, and microscopic examination. It also discusses cultural characteristics like colony morphology, physiological characteristics like temperature and pH ranges, and immunological characteristics involving antigen-antibody reactions. Identification is also based on metabolic characteristics, composition of proteins and nucleic acids, DNA-DNA hybridization, and 16S rRNA gene sequencing which can determine evolutionary relationships.

1. Major characteristics used in taxonomy

2. The identification of an organism is the process of determining its species. Various
characteristics of the organism are determined by appropriate observations & tests, &
these are then compared with published descriptions of the various species.
Identification of microorganisms is done on the basis of:
Morphological characteristics:
Physiological characteristics:
Immunological characteristics:
Metabolic characteristics:
Etiological characteristics:
Composition of Proteins:
Composition of Nucleic acid:
Hybridization :
Nucleic acid sequencing:
16S rRNA sequencing:
16S rDNA sequencing:

3. Morphological Characteristics:
 Unlike other kinds of microbial characteristics, determination of morphological
features usually requires studying individual cells of pure culture.
Microorganisms are very small in size usually expressed in micrometer (µm).
 The size, shape & arrangement of cells are determined by microscopic
examination of stained smears. Examination of living organisms in a hanging
drop preparation shows motility.
 Organisms are differentiated on the basis of various staining reactions.
frequently used staining methods are Gram stain, Acid fast stain, Flagella stain,
Capsule stain, Spore stain, Negative stain etc.
 The Gram stain is of great value, because organisms are classified as Gram
positive or Gram negative. The staining reactions, however, vary with the
composition of medium, conditions of growth & the age of the culture.

4. Cultural Characteristics:
 Pure cultures of organisms can be studied by growing them on a wide variety of
culture media. Under appropriate cultural conditions, organisms show
characteristic types of growth, & such observations are useful in the
identification of the organism. Growth characteristics are commonly observed
on the following types of culture:
Colonies on solid media (plate cultures).
Growth in liquid media.
Growth on agar slants.
Growth in agar stabs.
Growth in gelatin stabs.
Description of colonies on solid media should include size, shape, elevation,
surface, color, & appearance by reflected & transmitted light. Similar
information can also be secured from agar slants & agar stab cultures.

5. Colony characteristics on solid media:

6. Bacterial growth pattern on slant & liquid media:

7. Physiological characteristics:
Physiological tests which are commonly used in the identification of an organism are
as follows -
Temperature range of growth:
psychrophilic (0-200C),
mesophilic (20-450C),
thermophilic (45-650C)
thermoduric 65-1000C).
Oxygen tolerance:
strict aerobe (requires O2),
strict anaerobe (doesn’t require O2),
facultative anaerobe (doesn’t require O2 but can grow in presence of
O2 ),
microaerophilic (range of 2 to 10% for growth).

8. pH range of growth:
acidophilic (0-5.5),
neutrophilic (5.5-8),
alkaliphilic (8-14).
Pigment production (water soluble or insoluble).
Tolerance & requirement of salt.
Source of illumination (photosynthetic organisms).
Physiological characteristics:

9. Immunological Characteristics:
 Certain chemical compounds of microbial cells are called antigens.
Antigenic characterization of microorganisms has great practical
importance.
 If microbial cells enter the animal body, the animal responds to their
antigens by forming specific blood serum protein called antibodies,
which bind to the antigens.
 Antibodies are highly specific for the antigens that induce their
formation, because different kinds of microorganisms have different
types of antigens. Antibodies are widely used as tools for the rapid
identification of particular kind of microorganism.
 Example: if we take typhoid bacterium antibody & mixed with
suspension of unknown bacterial cells. If precipitation occurs (+Ve
test) considered as unknown sample is of typhoid bacteria. (Widal
test ).

10. Metabolic characteristics:
 All living organisms require water, a source of energy, carbon, nitrogen,
sulphur & phosphorus in either inorganic or organic form. Depending upon
the utilization of source of energy microorganisms are differentiated.
 Autotrophs are capable of synthesizing their entire cellular constituents from
simple inorganic compounds in the medium, but heterotrophs fail to grow
unless one or more essential metabolites, growth factors, or vitamins are
provided in the medium.
 Phototrophs obtain energy from the sun, where the growth is dependent upon
exogenous inorganic hydrogen donors (photolithotrophs) or organic hydrogen
donors (photoorgonotrophs}. Microorganisms can be divided into many nutri-
tional groups on the basis of their nutritional requirements.

11. Etiological characteristics:
 The ability to cause a disease of some microorganisms is certainly a
dramatic characteristic & is stimulated much of the early work with
microorganisms.
 As we know that some microorganisms are pathogenic & cause a disease
to plant, some cause disease to animals.
 Whiles some cause a diseases to other microorganisms. These
characteristics to cause a disease to different things useful for the
identification of microorganisms.

12.  Cell Wall Composition: In 1956, Cummins & Harris suggested that amino acid
composition of cell wall would prove to be important criteria of classification of
bacteria.
 The glycoprotein & heteropolysaccharides also help in classifying. some
organisms lack cell wall, but contain glycoprotein in the cell membrane.
Example: Thermoplasma
 Amino acid sequence in various proteins:
 the amino acid sequence decides the characteristics features of proteins like the
antigenicity.
 2D electrophoresis & protein finger printing separates proteins.
 Very closely related organisms should have similar or identical kinds of cellular
proteins.
 Apart from this lipid & fatty acid composition & cytochrome composition also
helpful for the identification of microorganisms.
Composition of protein:

13. Composition of Nucleic acid:
 We know that the DNA molecule is made up of nucleotide base Adenine-thymine
& guanine-cytosine. The total no of nucleotide bases present in the DNA, that
percentage represented by guanine + cytosine is termed as moles% G+C value.
 Value of G+C varies from 20%-80% & estimated by calculating G+C ratio by
determining melting temperature of DNA.
G +C ratio = G + C X 100
A + T+ G + C
 As A=T has 2 H bonds while G=C has 3 H bonds, greater the GC content higher will
be the melting point. G+C content in plants & animals is about 40%
 It reflects on genetic differences between microorganisms & constant for strains
within the same species.
G+C (moles %) Organisms
28-30 Spirillum linum.
30-32 Clostridium perfringens. C. tetani

14. Hybridization: Homology
 Similarity of base composition represents only a limited basis for close genetic
relatedness because even distant organisms can by chance have a similar
composition.
 Moreover as groups diverge in evolution the DNA sequence changes long before
the base composition. Homology of sequence (DNA - DNA homology) can be
measured quantitatively in terms of the ability of DNA strands from two different
sources to form molecular hybrids in vitro.
 Organism are grown in the medium with heavy isotope of thymidine i.e.
radiolabeled (3H) while, Second organism is grown in the normal medium with
normal element non radiolabeled.
 The DNA to be compared are heated, sheared & transferred to nitrocellulose
paper.
 The ssDNA from different microorganisms is mixed & allowed to reassociate.
 homologous regions will reanneals & this will reveals the degree of relatedness of
the two microorganisms.

15. Identification of organisms based on 16SrRNA
sequencing
 The rDNA is the most conserved (least variable) gene in all cells which encode
rRNA.
 Portions of the rDNA sequence from distantly-related organisms are remarkably
similar. This means that sequences from distantly related organisms can be
precisely aligned, making the true differences easy to measure.
 For this reason, rDNA genes that encode the rRNA have been used extensively to
determine taxonomy, phylogeny (evolutionary relationships), & to estimate
rates of species divergence among bacteria.
 Thus the comparison of 16s rDNA sequence can show evolutionary relatedness
among microorganisms.
 This work was pioneered by Carl Woese, who proposed the three Domain
system of classification - Archaea, Bacteria, & Eucarya - based on such sequence
information.

16. The Ribosomal RNAs:
 In Bacteria, Archaea, Mitochondria, and Chloroplasts the small ribosomal
subunit contains the 16S rRNA (where the S in 16S represents Svedberg units).
 The large ribosomal subunit contains two rRNA species (the 5S and 23S rRNAs).
Bacterial 16S, 23S, and 5S rRNA genes are typically organized as a co-
transcribed operon.
 There may be one or more copies of the operon dispersed in the genome (for
example, E coli has seven). The Archaea contains either a single rDNA operon or
multiple copies of the operon.
Ribosomal RNAs in Prokaryotes
Name Size (nucleotides) Location
5S 120 Large subunit of ribosome
16S 1500 Small subunit of ribosome
23S 2900 Large subunit of ribosome

17.  The 5S has been extensively studied, but it is usually too small for reliable
phylogenetic inference. The 16S and 23S rRNAs are sufficiently large to be useful.
The 16s rDNA sequence has hypervariable regions, where sequences have
diverged over evolutionary time.
 Sequences from tens of thousands of clinical and environmental isolates are
available over the internet through the National Center for Biotechnology
Information (www.ncbi.nlm.nih.gov ) and the Ribosomal Database Project
(www.cme.msu.edu/RDP/html/index.html ). These sites also provide search
algorithms to compare new sequences to their database.
 Human
GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAA
AG
 Escherichia coli
GTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAA
GCG
The Ribosomal RNAs:

18.  Carl Woese recognized the full potential of rRNA sequences as a measure of
phylogenetic relatedness. He used RNA sequencing method that determined
about 1/4 of the nucleotides in the 16S rRNA.
 Today, the accumulated 16S rRNA sequences (about 10,000) constitute the
largest body of data available for inferring relationships among organisms.
 PROCEDURE:
 In this laboratory, amplify a region of the 16s rDNA gene (based on the E. coli 16s
rDNA sequence) using Polymerase Chain Reaction (PCR). The DNA will be
sequenced using the capillary DNA sequencer at the Grice Marine Lab. We will
then compare the results obtained with the public databases (NCBI and RDP) and
determine the identity of the unknown bacteria.
The Ribosomal RNAs:

20.  References:
www.google.com
Notes by puri sir
Microbiology by Pelczar,Chan and Krieg