This study has a novel approach to investigate the effects of oral supplementation of kefir grains on metabolic improvement and the expression of the antioxidant enzymes Glutathione Peroxidase (GPx) and Catalase (CAT) of the liver in malnourished mice.
Austin Journal of Veterinary Science & Animal Husbandry is an open access, peer reviewed, scholarly journal dedicated to publish articles in all areas of Veterinary Science.
The aim of the journal is to provide a forum for researchers, physicians, academicians and other Veterinary professionals to find most recent advances in the areas of diagnosis and treatments in Veterinary sciences.
Austin Journal of Veterinary Science & Animal Husbandry accepts original research articles, review articles, case reports, clinical images and rapid communication on all the aspects of Veterinary Science.
Austin Journal of Veterinary Science & Animal Husbandry is an open access, peer reviewed, scholarly journal dedicated to publish articles in all areas of Veterinary Science.
The aim of the journal is to provide a forum for researchers, physicians, academicians and other Veterinary professionals to find most recent advances in the areas of diagnosis and treatments in Veterinary sciences.
Austin Journal of Veterinary Science & Animal Husbandry accepts original research articles, review articles, case reports, clinical images and rapid communication on all the aspects of Veterinary Science.
Effects of Probiotics Feeding Technology on Weight Gain of Indigenous Chicken...iosrjce
IOSR Journal of Agriculture and Veterinary Science (IOSR-JAVS) is a double blind peer reviewed International Journal edited by the International Organization of Scientific Research (IOSR). The journal provides a common forum where all aspects of Agricultural and Veterinary Sciences are presented. The journal invites original papers, review articles, technical reports and short communications containing new insight into any aspect Agricultural and Veterinary Sciences that are not published or not being considered for publication elsewhere.
Dietary Intervention with Yoghurt, Synbiotic Yogurt or Traditional Fermented ...Mostafa Gouda
Dietary Intervention with Yoghurt, Synbiotic
Yogurt or Traditional Fermented Sobya:
Bio-Potency among Male Adolescents Using
Five Bio-Markers of Relevance to Colonic
Metabolic Activities
A description and the results of research carried out on broiler chickens in order to explore the efficacy of phytase products on ileal digestibility of phosphorus.
The reseach results found that phytase supplementation was effective in improving the growth performance, ileal phosphorus digestibility and the bone mineralization parameters when included in the low phosphorus diet.
Visit us at: http://www.dsm.com/markets/anh/en_US/home.html
Induced Lactation in Non pregnant Cows: Profitability and Response to Bovine ...Faisal A. Alshamiry
Significant culling of high-producing cows with low fertility reduces profitability of dairy farms as those cows are replaced with heifers.
Induced lactation of non pregnant cows may be a management alternative to increase profits.
Adding replacement heifers to the milking string is one of the largest costsof dairy farming.
There is potential to increase income by reducing the number of heifers raised or by selling excess heifers.
An improved method to induce non pregnant cows into lactation could return to production valuable healthy cows that would otherwise be culled and at the same time decrease the need for replacement heifers.
Low beneficial effects of short term antidiabetic diet treatment in streptozo...iosrphr_editor
Oxidative stress is currently suggested to play a role in the pathogenesis of Diabetes mellitus. The role of dietary management in diabetes mellitus is to provide a proper balance of total nutrients while meeting the special dietary needs of the patient. The present study was designated to evaluate the effect of special antidiabetic diet treatment upon oxidative stress parameters in the initial stages of the development of diabetes. Male Wistar strain rats were used as an experimental model, divided into five groups. A significant decrease in superoxide dismutase and total glutathione activities were observed in the liver of diabetic rats when compared with control animals. The plasma level of aminotransferases, creatine kinase, lactate dehydrogenase and urea were significantly increased after induction of diabetes, in all groups under treatment. In contrast, rats fed special diet food, have shown slight different, but not significant changes. The findings of the present study suggest that special diet formula useful for prevention of progressive hyperglycaemia in age induced diabetes in dogs, could not restore the imbalance of cellular defence mechanism provoked by streptozotocin.
Antihyperlipidemic Activity of Torbangun Extract (Coleus amboinicus Lour) on ...iosrphr_editor
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Effects of Probiotics Feeding Technology on Weight Gain of Indigenous Chicken...iosrjce
IOSR Journal of Agriculture and Veterinary Science (IOSR-JAVS) is a double blind peer reviewed International Journal edited by the International Organization of Scientific Research (IOSR). The journal provides a common forum where all aspects of Agricultural and Veterinary Sciences are presented. The journal invites original papers, review articles, technical reports and short communications containing new insight into any aspect Agricultural and Veterinary Sciences that are not published or not being considered for publication elsewhere.
Dietary Intervention with Yoghurt, Synbiotic Yogurt or Traditional Fermented ...Mostafa Gouda
Dietary Intervention with Yoghurt, Synbiotic
Yogurt or Traditional Fermented Sobya:
Bio-Potency among Male Adolescents Using
Five Bio-Markers of Relevance to Colonic
Metabolic Activities
A description and the results of research carried out on broiler chickens in order to explore the efficacy of phytase products on ileal digestibility of phosphorus.
The reseach results found that phytase supplementation was effective in improving the growth performance, ileal phosphorus digestibility and the bone mineralization parameters when included in the low phosphorus diet.
Visit us at: http://www.dsm.com/markets/anh/en_US/home.html
Induced Lactation in Non pregnant Cows: Profitability and Response to Bovine ...Faisal A. Alshamiry
Significant culling of high-producing cows with low fertility reduces profitability of dairy farms as those cows are replaced with heifers.
Induced lactation of non pregnant cows may be a management alternative to increase profits.
Adding replacement heifers to the milking string is one of the largest costsof dairy farming.
There is potential to increase income by reducing the number of heifers raised or by selling excess heifers.
An improved method to induce non pregnant cows into lactation could return to production valuable healthy cows that would otherwise be culled and at the same time decrease the need for replacement heifers.
Induced Lactation in Non pregnant Cows: Profitability and Response to Bovine ...
Similar to Austin publishing group - Oral kefir grains supplementation improves metabolism and liver antioxidant enzymes expression in malnourished mice
Low beneficial effects of short term antidiabetic diet treatment in streptozo...iosrphr_editor
Oxidative stress is currently suggested to play a role in the pathogenesis of Diabetes mellitus. The role of dietary management in diabetes mellitus is to provide a proper balance of total nutrients while meeting the special dietary needs of the patient. The present study was designated to evaluate the effect of special antidiabetic diet treatment upon oxidative stress parameters in the initial stages of the development of diabetes. Male Wistar strain rats were used as an experimental model, divided into five groups. A significant decrease in superoxide dismutase and total glutathione activities were observed in the liver of diabetic rats when compared with control animals. The plasma level of aminotransferases, creatine kinase, lactate dehydrogenase and urea were significantly increased after induction of diabetes, in all groups under treatment. In contrast, rats fed special diet food, have shown slight different, but not significant changes. The findings of the present study suggest that special diet formula useful for prevention of progressive hyperglycaemia in age induced diabetes in dogs, could not restore the imbalance of cellular defence mechanism provoked by streptozotocin.
Antihyperlipidemic Activity of Torbangun Extract (Coleus amboinicus Lour) on ...iosrphr_editor
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Effect of Herbal Medicine Supplementations (Arsilvon Super, Bedgen40 and Hepa-cure Herbal Medicines) on Growth Performance, Immunity and Haematological Profile in Broilers
Lactobacillus acidophilus CRL 1014 improved "gut health" in the SHIME(R) reactorEnrique Moreno Gonzalez
How to maintain “gut health” is a goal for scientists throughout the world. Therefore, microbiota management models for testing probiotics, prebiotics, and synbiotics have been developed.
Edible Bird’s Nest Attenuates Procoagulation Effects of High-Fat Diet in RatsElabscience
Edible bird’s nest (EBN) is used traditionally in many parts of Asia to improve wellbeing, but there are limited studies on its
efficacy. We explored the potential use of EBN for prevention of high fat diet- (HFD-) induced insulin resistance in rats.
Effect of Piper crocatum Extract Against Weight Loss and Liver Enzyme Levels ...iosrphr_editor
Piper crocatum is one of Indonesian medicinal plant that contain flavonoids, tannins, alkaloids, and saponins. Aims of this study were to evaluate the effect of Piper crocatum aqueous extract against a decrease in body weight (BW) and the activity of enzymes involved in lipid metabolism (AMPK, ACC, FAS) in liver obese rats. This study used four groups of Sprague dawley rat (n = 6), including normal group (N), obese controls (OC), Piper crocatum extract dose 1260 mg/kgBW (PcA), and Piper crocatum extract dose of 1890 mg/kgBW (PcB). Measurement of metabolic liver enzyme levels (AMPK, ACC, FAS) are using ELISA kit (CusabioTM). Results of this study showed that the PcA group produce the highest reduction in body weight (4.52%), and the lowest levels of ACC (9.13 ng/g) and FAS (360.68 ng/g) which was significantly different from obese control group (95% CI). Piper crocatum extract can't activate AMPK. The highest levels in rat liver AMPK is in N group with 8.42 ng/g, but this value is not significantly different from other groups.
Comparative Study of The Antioxidant Activities of Monodora Myristica And A. ...iosrjce
IOSR Journal of Biotechnology and Biochemistry (IOSR-JBB) covers studies of the chemical processes in living organisms, structure and function of cellular components such as proteins, carbohydrates, lipids, nucleic acids and other biomolecules, chemical properties of important biological molecules, like proteins, in particular the chemistry of enzyme-catalyzed reactions, genetic code (DNA, RNA), protein synthesis, cell membrane transport, and signal transduction. IOSR-JBB is privileged to focus on a wide range of biotechnology as well as high quality articles on genetic engineering, cell and tissue culture technologies, genetics, microbiology, molecular biology, biochemistry, embryology, cell biology, chemical engineering, bioprocess engineering, information technology, biorobotics.
Dr Carlene Starck, Postdoctoral Research Fellow at Riddet Institute, New Zealand: http://www.kiwifruitsymposium.org/presentations/kiwifruit-and-digestive-comfort-in-vitro-and-in-vivo-supporting-evidence/
Presentation at the 1st International Symposium on Kiwifruit and Health.
Kiwifruit (Actinidia deliciosa) hosts a number of beneficial properties for gut health. In addition to its high fibre content, water holding capacity and levels of the vitamins C and E, its consumption has been reported to provide relief of symptoms of gastrointestinal discomfort.
Piper nigrum and Ferula foetida shows Significant Antisecretory and Anti Ulce...BRNSS Publication Hub
In the present study, the gastroprotective mechanism of aqueous extract of Piper nigrum and Ferula foetida (AEPF) was investigated. In the current study AEPF showed significant anti ulcer activity in rats. The antiulcerogenic impact of the AEPF is also associated with its antisecretory action since acid may be a major consideration of the event of ulceration. The current data also clearly demonstrated that 400 mg/kg is more effective than 200 mg/kg and 100 mg/kg dose of AEPF and has shown increased pH and decreased total acidity of gastric fluid. The ulcerogenic effect of cysteamine-induced duodenal ulcers was developed in rats that received cysteamine HCl 400 mg/kg. The exact mechanism of pathological process within the cysteamine-induced peptic ulcer model is not totally known, but hypersecretion of gastric acid, deterioration of mucosal resistance, and promotion of gastric emptying are among the possible mechanisms. In cold restraint stress-induced ulcer model, blood parameters such as glucose, cholesterol, and triglycerides were estimated. The significant increase in blood sugar level was discovered because, beneath nerve-racking conditions, ductless gland secretes corticosterone in man and glucocorticoid in rats. AEPF significantly reduced the elevated serum cholesterol and triglycerides levels, which may be due to inhibition of stimulation of the sympathetic nervous system. Therefore, it could act as a potent therapeutic agent against peptic ulcer disease.
Similar to Austin publishing group - Oral kefir grains supplementation improves metabolism and liver antioxidant enzymes expression in malnourished mice (20)
Nanoparticles are small molecules with size ranging between 1-100nm. Basis of their classification is their properties shapes and size. These find usage in wide range of industries from agricultural, biomedical, environmental and food. There are numerous ways of producing these nanoparticles using chemicals and biological means. Use of various micro-organisms (biological process) is highly effective in producing high quality, toxin free and cost effective nanoparticles.
Nutrition, Sports, and Covid-19 Lockdown Impact on Young Competitive Artistic...Austin Publishing Group
COVID-19 lockdown has highlighted a worrying discrepancy among macronutrients intake during the training period and the suggested ratio of macronutrients for healthy nutrition, with an inverted ratio fat/protein, and lower energy intake in respect to the consumed.
Austin Publishing Group- Case report of external compression in stevens johns...Austin Publishing Group
Stevens-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) form a spectrum of severe mucocutaneous reactions, characterized by epidermal detachment and necrosis. Though disease mortality and morbidity are high, treatment remains mostly of supportive measures with varying efficacy.
Primary hypotensive reaction is a rare type of transfusion reaction caused by excess bradykinin in the blood product, which is typically not screened for during packed red blood cell preparation. Here, we describe a patient who experienced hypotension during blood transfusion that could not be attributed to other life-threatening reactions such as acute hemolytic reaction, anaphylaxis, transfusion-related acute lung injury, or sepsis.
Nalbuphine hydrochloride (5a,6a)-17-(Cyclobutylmethyl)-4,5- epoxymorphinan-3,6,14-triol hydrochloride, is narcotic analgesic drug which is a morphine- like drug with agonist activity at the k- opioid receptor and antagonist activity at the μ-opioid receptor. Nalbuphine is recommended for use in moderate to serve pain and its indications include pain after myocardial infraction.
As an uncommon malignant tumor, hypopharyngeal cancer accounts for 3–5% of head and neck tumors [1]. Most pathological types of hypopharyngeal cancer are squamous cell carcinoma. Due to the occult anatomical location of hypopharyngeal cancer and poor surgical effect, local recurrence or distant metastasis often occurs in patients with hypopharyngeal cancer following surgery.
Level of knowledge of the human papilloma virus in women of a primary care un...Austin Publishing Group
The HPV is a virus that belongs to the papolomaviridae family [1]. It infects and replicates in the nucleus of epithelial cells, its main site of involvement is the transitional epithelium of the cervix, affecting basal cells of the squamous epithelium. It has the ability to infect on contact with the skin, by sexual and vertical transmission at the time of delivery.
Perspectives on Transitional Care for Vulnerable Older Patients A Qualitative...Austin Publishing Group
Transitional care for vulnerable older patients is optimal if, on top of the organization of transitional care, these patients and their informal caregivers have trust in the professionals involved. Regarding the challenge of organizing increasingly complex transitional care for vulnerable older patients, the focus should shift towards optimizing trust.
Austin Virology and Retrovirology is an international scholarly peer reviewed Open Access journal, aims to promote the research in the field of Virology.
Austin Virology and Retrovirology is a comprehensive Open Access peer reviewed scientific Journal that covers multidisciplinary fields. We provide limitless access towards accessing our literature hub with colossal range of articles. The journal aims to publish high quality varied article types such as Research, Review, Case Reports, Short Communications, Perspectives (Editorials), Clinical Images
Austin Virology and Retrovirology supports the scientific modernization and enrichment in virology research community by magnifying access to peer reviewed scientific literary works. Austin also brings universally peer reviewed member journals under one roof thereby promoting knowledge sharing, collaborative and promotion of multidisciplinary science.
Austin Transplantation Sciences is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Transplantation Sciences.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all areas of Transplantation Sciences. Austin Transplantation Sciences accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of Transplantation Sciences.
Austin Transplantation Sciences strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
Austin Hematology is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Hematology.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all areas of Hematology. Austin Hematology accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of hematology.
Austin Hematology strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
Gastrointestinal Cancer: Research & Therapy is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Gastrointestinal Cancer.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all areas of Gastrointestinal Cancer. Gastrointestinal Cancer: Research & Therapy accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of Gastrointestinal Cancer.
Gastrointestinal Cancer: Research & Therapy strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
Journal of Endocrine Disorders is a peer-reviewed, open access journal published by Austin Publishers. It provides easy access to high quality Manuscripts in all related aspects of several problems associated with in the endocrine system that can result in numerous disorders, including diabetes, obesity, thyroid disorders, osteoporosis and hormone malfunction. The Journal focuses upon all the endocrine disorders and the new advancements in the related treatments.
Austin Publishing Group is a successful host of more than hundred peer reviewed, open access journals in various fields of science and technology with intent to bridge the gap between academia and research access.
Journal of Endocrine Disorders accepts original research articles, review articles, case reports, mini reviews, rapid communication, opinions and editorials on all related aspects of diseases associated with endocrine system.
Austin Journal of Drug Abuse and Addiction is an open access, peer reviewed, scholarly journal dedicated to publish articles in all areas of drug abuse and addiction treatment.
The renowned team of guest editors ensures a balanced, expert assessment of the articles published, with an aim to provide a forum for physicians, researchers and other healthcare professionals to find most recent advances in the areas of addiction treatment.
Austin Journal of Drug Abuse and Addiction accepts original research articles, review articles and short communication on all the aspects of drug abuse and addiction treatment for review and possible publication.
Austin Digestive System is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Digestive System.
The journal aims to promote latest information and provide a forum for doctors, researchers, physicians, and healthcare professionals to find most recent advances in the areas of Digestive System. Austin Digestive System accepts research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of Digestive System.
Austin Digestive System strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing.
Austin Diabetes Research is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Diabetes.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all areas of Diabetes. Austin Diabetes Research accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of Diabetes.
Austin Diabetes Research strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
Austin Journal of Dermatology is an open access, peer reviewed, scholarly Journal committed to publish articles in all areas of Dermatology. The Journal aims to establish a discussion for the exchange of information about new and major research carried out in the field of dermatology and to encourage this discipline throughout the world.
Austin Journal of Dermatology is peer-reviewed journal publishing information covering all aspects of the management of dermatological environment, predominantly the place in therapy of newer and established agents and procedures.
Austin Journal of Dermatology accepts original research articles, review articles, case reports and rapid communication on all the aspects of study and treatment of Dermatology.
Austin Journal of Dermatology is an open access, peer reviewed, scholarly journal committed to publish articles in all areas of Dermatology. The Journal aims to establish a discussion for the exchange of information about new and major research carried out in the field of dermatology and to encourage this discipline throughout the world.
Austin Journal of Dentistry is an open access, peer review journal publishing original research & review articles in all the fields of Dentistry.
The Journal aims to provide a forum for all researchers, scientists, scholars, students to publish their research work & also find recent advances in the area of Dentistry. We provide limitless access towards accessing our literature hub with colossal range of articles. Austin Journal of Dentistry accepts high quality articles of various types such as Research, Review, Short Communications, Case Reports, Perspectives (Editorials), Clinical Images.
Austin Journal of Dentistry supports the scientific modernization and enrichment in Dentistry research community by magnifying access to peer reviewed scientific literary works. Austin also brings universally peer reviewed member journals under one roof thereby promoting knowledge sharing, collaborative and promotion of multidisciplinary science.
Austin Cardiology is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Cardiology.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all areas of Cardiology. Austin Cardiology accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of cardiology.
Austin Cardiology strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
Journal of Bacteriology and Mycology is a peer-reviewed, open access journal published by Austin Publishers. It provides easy access to high quality manuscripts in all related aspects of two major sub branches of Microbiology namely Bacteriology: the study of Bacterial Mycology& the study of fungus. The Journal focuses upon the identification, classification, characterization of bacterial/fungal species and the infections and health issues caused by these dreadful bacteria and fungus.
Austin Publishing Group is a successful host of more than hundred peer reviewed journals, open access journals in various fields of science and technology with intent to bridge the gap between academic and research access.
Journal of Bacteriology and Mycology journal accepts original research articles, review articles, case reports, mini reviews, rapid communication, opinions and editorials in all related aspects of Bacterial Mycology & Fungal Species.
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Anti ulcer drugs and their Advance pharmacology ||
Anti-ulcer drugs are medications used to prevent and treat ulcers in the stomach and upper part of the small intestine (duodenal ulcers). These ulcers are often caused by an imbalance between stomach acid and the mucosal lining, which protects the stomach lining.
||Scope: Overview of various classes of anti-ulcer drugs, their mechanisms of action, indications, side effects, and clinical considerations.
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
These lecture slides, by Dr Sidra Arshad, offer a quick overview of physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar leads (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
MANAGEMENT OF ATRIOVENTRICULAR CONDUCTION BLOCK.pdfJim Jacob Roy
Cardiac conduction defects can occur due to various causes.
Atrioventricular conduction blocks ( AV blocks ) are classified into 3 types.
This document describes the acute management of AV block.
2. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 02
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
and gluconic acid, ethyl alcohol, carbon dioxide, vitamin B12 and
polysaccharides that give the product unique sensory characteristics.
The lactic acid formed from lactose fermentation acts as a natural
preservative, making kefir a biologically safe product, combining it
with nutrients, calcium and iron, facilitating their absorption. The
product also has high digestibility, which is attributed to the nature of
the curd, whose proteins undergo, during fermentation, denaturation
in various degrees, thus obtaining a curd of finely divided particles,
easily penetrated by gastric juice [9,10]. Hence, this work aimed to
evaluate the effect of kefir grains supplementation on the metabolism
and liver inflammatory and antioxidant markers in malnourished
mice.
Materials and Methods
Animals and Diet
The experiment was carried out with 32 male Swiss mice, aged
6 weeks, divided into 4 groups (n = 8 each). The animals were kept
in an initial adaptation phase (10 days), with free access to water
and the standard chow diet (Presence) for rats and mice containing
67.5% carbohydrates, 22.5% proteins, and 10% lipids. All procedures
performed involving animals were in accordance with the institution’s
ethical standards (CEEBEA - State University of Montes Claros -
Annex 1). The animals were kept under controlled conditions of light
and temperature. (Protocol number 189/2019).
Kefir Preparation
Kefir grains were donated from the biotechnology laboratory
of the Institute of Agricultural Sciences of UFMG, at the Montes
Claros Campus, and rehydrated three weeks before the experiments.
The grains were inoculated (5%, weight/volume) and propagated in
sterilized milk at 20 °
C for 20 h for activation. After the filtration of the
grains,thefermentedmilkwasdiscardedandthegrainswereseparated
and refrigerated at 20 °
C [11]. Regarding the nutritional composition,
kefir can vary widely and is influenced by the composition of milk, the
origin and composition of grains, time, temperature of fermentation,
and storage conditions. However, the nutritional composition of
kefir is still not well described in the literature. Thus, the nutritional
composition of kefir is described in Table 1 [12].
Malnutrition Protocols and Renutrition Diets
Immediately after the adaptation period, the animals were
submitted to two treatment phases: the caloric restriction phase to
lead to malnutrition [13] and the renutrition phase.
The caloric restriction of 20% in relation to the control group was
maintained until animals reached a weight deficit of about 20% in
relation to their original weight. Subsequently, during the renutrition
phase, the animals received diets every day for 30 days. Diets (chow
powder plus kefir grains) were administered orally. Groups with their
respective renutrition diets are shown in Table 2.
Glucose tolerance and insulin sensitivity tests (GTT and
IST)
For the glucose tolerance test, 2 mg glucose/g of body weight
was injected intraperitoneally into mice after an overnight fast.
Glucose levels were monitored at 0, 15, 30, 60, and 120 min after
injection, using blood samples taken from the animal’s tail. Insulin
sensitivity tests were performed with the animals in the fed state, after
intraperitoneal injection of insulin (0.75 U/kg of body weight), where
tail blood samples were collected at times 0, 15, 30, and 60 min after
injection for measuring blood glucose levels.
Biochemical Analyses
At the end of the treatment period, the mice were euthanized
and blood, and tissue samples were collected. The serum was
obtained after centrifugation (3200 rpm for 10 minutes at 4 °C). Total
cholesterol, triglycerides, high-density lipoprotein (HDL), Alanine
Aminotransferase (ALT), Aspartate Aminotransferase (AST) and
alkaline phosphatase were evaluated using enzymatic kits (Wiener®
,
Argentina). Measurements were performed on a Wiener BT-3000
plus Chemistry Analyzer (Wiener®
, Argentina).
Histopathological Assessments
For microscopic evaluation, the liver samples were fixed in 10%
buffered formalin at 40 °
C overnight, dehydrated by increasing degrees
of alcohol, xylene and paraffin, and then embedded in paraffin,
sectioned at 5 μm and subsequently stained with hematoxylin and
eosin to assess the liver tissue architecture and the infiltration of
inflammatory cells [14]. Slides were analyzed using an inverted
microscope FSX100 (Sao Paulo, Brazil). Inflammatory cell counts
were obtained using Image J software (Wayne Rasband, National
Institutes of Health, Bethesda, MD) [15,16].
Reverse Transcriptase (RT-PCR)
The total RNA extracted from the liver was prepared using the
TRIzol reagent (Invitrogen Corp.®
, San Diego, California, USA),
treated with DNAse and reverse transcribed with M-MLV (Invitrogen
Corp.®
). Endogenous glyceraldehyde 3-phosphate dehydrogenase
Nutritional attributes
Nutritional
components
Concentration
100g
Vitamins (mg)
Vitamin B1 <1
Vitamin B2 <0.5
Vitamin B3 0.3
Amino acids (g)
Threonine 0.18
Lysine 0.38
Valine 0.22
Isoleucine 0.26
Methionine 0.14
Phenylalanine 0.23
Tryptophan 0.07
Minerals (g)
Potassium 1.65
Calcium 0.86
Magnesium 1.45
Phosphor 0.3
Microelements (mg)
Copper 0.73
Zinc 9.27
Iron 2.03
Manganese 1.3
Cobalt 0.02
Molybdenum 0.03
Table 1: Nutritional composition of kefir.
3. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 03
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
(GAPDH), free radical deactivating enzymes such as glutathione
peroxidase (GPx) and Catalase (CAT) were evaluated using specific
primers and SYBR green reagent (Applied Biosystems®
, USA) on a
plus-one platform (Applied Biosystems®
). The relative comparative
CT method was applied to compare the levels of gene expression
between the groups, using the equation 2-ΔΔCT [17]. Primer
sequences are described in Table 3 [18].
Table 3 - RT-PCR primers used in this study.
Statistical Analysis
All data were analyzed using the GraphPad Prism software
(Version 5.0®
, San Diego, California, USA), with target confidence
level of 95% (p <0.05). Data are expressed as the mean ± SEM.
Statistical significance between groups of mice was assessed by one-
way ANOVA, followed by Tukey’s post-test and Student’s t-test.
Statistical significance was established at p <0.05.
Results
Food and Energy Consumption, Body Weight, and
Adiposity
Food (ST, 0.0750 ± 0.015; ST + GK, 0.0750 ± 0.015; FR, 0.0660
± 0.015; FR + GK, 0.0660 ± 0.015) and energy (ST, 0.2420 ± 0.050;
ST + GK, 0.2420 ± 0.050; FR, 0. 2530 ± 0.051; FR + GK, 0.2530 ±
0.051) consumption did not differ significantly between the groups
that received kerfir and the control group (Figures 1a and 1b). In the
analysis of body weight, we observed an expected reduction in body
weight in the group of malnourished mice when compared to the
control, not malnourished, group (ST, 58.63 ± 3,154 vs. FR, 45.15 ±
0.328) (Figure 1c).
In the analysis of the area on the body weight curve, no significant
difference was observed between the malnourished group and the
one treated with kefir grains (FR, 381.1 ± 9.429 vs. FR + GK, 378.7
± 4.060) (Figure 1c). Regarding adiposity, a significant increase was
observed in malnourished mice that received kefir in relation to the
malnourished control group (FR, 0.014 ± 0.003 vs. FR+GK, 0.040 ±
0.0) (Figure 1d).
Tolerance tests, Insulin Sensitivity, and Biochemical
Analyses
The analysis of the area under the glucose tolerance test curve did
notshowstatisticallysignificantdifferencesbetweenthemalnourished
and the malnourished group that received kefir (FR, 22433 ± 1506 vs.
FR + GK, 21255 ± 1054) (Figure 2a). Similar results were found in the
analysis of the area under the curve of the insulin sensitivity test (FR,
6465 ± 926.9 vs. FR + GK 6063 ± 1164) (Figure 2b). No statistically
significant differences were found in serum glucose levels while
fasting (RF, 156.3 mg / dL ± 10.31 vs. FR + GK, 150.7 mg / dL ± 3.528)
and triglycerides (RF, 294.4 mg / dL ± 19.36 vs. FR + GK 348.0 mg /
dL ± 24.68) among the mice in the treated malnourished group and
their respective malnourished control (Figure 2c).
Regarding the lipid profile of the animals, an increase in HDL
levels was observed in the malnourished group treated with kefir
compared to the control (FR, 54.57 mg/dL ± 2.88 vs. FR + GK, 84.20
mg/dL ± 9,035) (Figure 2d). Total cholesterol levels were statistically
lower in malnourished animals when compared to the non-
malnourished control (ST, 145.8 mg/dL ± 7.351 vs. FR, 135.3 mg/
dL ± 7.860) (Figure 2e). Interestingly, increased levels of TGO were
observed in mice subjected to caloric restriction and treated with kefir
(FR, 215.3 mg/dL ± 51.97 vs. FR + GK, 556.0 mg/dL ± 20.00) (Figure
2f). An improvement in the profile of liver enzymes was also observed
in the group of treated malnourished mice when compared to the
malnourished control, with reduced levels of TGP (FR, 406.7 mg/dL
± 33.19 vs. FR + GK, 198.5 mg/dL ± 21.95) and alkaline phosphatase
(FR, 327.3 mg/dL ± 20.54 vs. FR + GK, 181.3 mg/dL ± 34.26) (Figure
2g-h).
Liver Weight, Histological Analysis, and Real-Time PCR
Malnourished mice that received kefir showed increased liver
weight when compared to the malnourished control group (FR,
215.3 g/BW ± 0.004 vs. FR + GK, 0.050 g/BW vs. 0.0) (Figure 3a). A
statistically significant reduction in the inflammatory infiltrate was
observed in the group of animals treated with kefir when compared to
their respective control (ST, 53.63 ± 4.136; ST + GK, 41.13 ± 1.469; FR,
45.38 ± 2.611; FR + GK, 33.00 ± 3.343) (Figure 3b). RT-PCR analyses
showed a significant increase in the expression of the antioxidant
enzymes GPx (ST, 1.70 ± 0.858; ST + GK, 77.97 ± 19.50; FR, 2.475 ±
0.9; FR + GK, 173.7 ± 38.66) (Figure 3c) and CAT (ST, 1.146 ± 0.407;
ST + GK, 21.35 ± 2.823; FR, 1.408 ± 0.674; FR + GK, 25.38 ± 5.165)
(Figure 3d) in groups of animals fed a diet supplemented with kefir
grains.
Discussion
Liver damage caused by malnutrition due to food restriction
has already been described by other studies [19], mainly because the
liver is a central organ in metabolism [20]. In the present study, we
demonstrated that malnutrition generates liver damage. An increase
in the serum levels of the enzymes TGP and alkaline phosphatase
was observed, as well as a reduction in liver weight, inflammation
Group identification Renutrition diet Estimated caloric consumption per animal/day (kcal)
Control – Nourished Standard chow* (7.5g) 25.67
Control + kefirgrains** Standard chow (7.30g) + kefirgrains (0.20g/mL) 25.67
Malnourished Standard chow (6g) 19.75
Malnourished + kefirgrains ** Standard chow (5.80g) + kefirgrains (0.20g/mL) 19.75
Table 2: Groups of animals according to the type of diet.
*
Presence Chow: 3.95 kcal/1g; **
kefir grains: 4.272 kcal/g.
Gene Forward Reverse
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA
CAT GGAGGCGGGAACCCAATAG GTGTGCCATCTCGTCAGTGAA
GPx CCACCGTGTATGCCTTCTCC AGAGAGACGCGACATTCTCAAT
Table 3: RT-PCR primers used in this study.
*
GAPDH: Endogenous glyceraldehyde 3-phosphate dehydrogenase, CAT:
Catalase and GPx: Glutathione peroxidase.
4. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 04
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
Figure 1: Food and energy consumption, body weight, and adiposity.
Body weight, food and energy consumption of mice fed a standard diet and renourished. Food consumption (A), energy consumption (B), daily body weight and
area on the curve (C), and adiposity (D). Data are presented as mean ± SEM. Statistically significant differences between groups are indicated as *
p <0.05, **
p
<0.01, ***
p <0.001 compared to the Standard Diet (ST) and renutrition groups (ST, ST + GK, FR and FR + GK).
Figure 2: Tolerance tests, insulin sensitivity, and biochemical analyses.
The glycemic and biochemical profile of mice fed a standard diet and renourished. Glucose tolerance test and area on the curve (a), insulin sensitivity test and
area on the curve (b), triglycerides (c), HDL (d), total cholesterol (e), AST (f), ALT (g), alkaline phosphatase (h). Data are presented as mean ± SEM. Statistically
significant differences between groups are indicated as *
p <0.05, **
p <0.01, ***
p <0.001 in comparison with the standard diet groups (ST) and renutrition groups (ST,
ST + GK, FR, and FR + GK).
5. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 05
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
and in the expression of the antioxidant enzymes GPx and CAT.
These results validate the findings of other authors who also showed
a decrease in body and liver weight [18,19] in animals submitted to
food restriction.
The arguments to confirm some of these changes related to
malnutrition are well described in the literature. According to
Guzman-Silva et al. (2004) [21], malnutrition is related to the loss
of liver mass in order to provide energy to important organs, such as
brain and heart [21,22], which justifies the analyzed difference.
The damages caused by oxidative stress have been related
to malnutrition, which could alter the antioxidant protection
mechanisms [23]. Normally, organisms are equipped with
mechanisms to eliminate these reactive species, involving both non-
enzymatic and enzymatic pathways. Enzymatic pathways include
some free-radical-deactivating enzymes such as catalase, Glutathione
Peroxidase (GPx), and Superoxide Dismutase (SOD) [24,25].
In this context, we analyzed the effect of malnutrition on
enzymes related to oxidative stress. We observed a decrease in mRNA
expression of the catalase and glutathione peroxidase genes in the
malnourished group (FR). This suggests that the modulation of the
gene expression of these enzymes can be affected by malnutrition.
Similar results were found in another study conducted on the
thymus of malnourished lactating rats [23], in which decreased
expression of the catalase and GPx genes in malnourished animals
Figure 3: Liver weight, histological analysis, and Real-time PCR.
Kefir grains reduced inflammatory infiltrates and modulated mRNA expression of free radical deactivating enzymes, such as Glutathione Peroxidase (GPx) and
Catalase (CAT) in malnourished mice. Liver (a), number of inflammatory cells (b), mRNA expression of GPx (c) and mRNA expression of CAT (d). Data are
presented as mean ± SEM. Statistically significant differences between groups are indicated as *p <0.05, **p <0.01, ***p <0.001 compared to the standard diet (ST)
and renutrition groups (ST, ST + GK, FR and FR + Gk).
was observed [23]. In addition, it has been shown that protein-energy
malnutrition results in a reduction in the expression of the antioxidant
enzyme glutathione S-transferase in the rat liver, which can increase
radicals and oxidative stress in the organ [26]. Experimental studies
have suggested that protein malnutrition causes inflammatory
changes in the liver, including an increase in interleukin-6 production
[27].
Supplementation with low cost and convenient antioxidants such
as vitamin E may be useful in preventing the progression of liver
damage [24,28,29]. In this study, we describe for the first time that
supplementation of malnourished animals with kefir grains was able
to reverse liver damage as well as increase adiposity and expression
of GPx and CAT.
Kefiran, an important component of kefir, inhibited pulmonary
inflammation induced by ovalbumin in a murine model of asthma,
suppressing the release of eosinophils and other inflammatory cells in
Bronchoalveolar Lavage Fluid (BAL) and lung tissue, as well as levels
of proinflammatory cytokines interleukin-4 (IL-4) and interleukin-5
(IL-5) [30]. Another study described the antioxidant effect of kefir in
rats with kidney damage [31]. Similar results were found in a study
with rats exposed to lead, in which case kefir also induced antioxidant
activity [32].
Conclusion
In summary, we show that oral supplementation with kefir grains
6. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 06
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
improved the metabolic profile of malnourished animals, increasing
adiposity, HDL, decreasing serum levels of TGP and alkaline
phosphatase, liver inflammation and increasing the expression of
antioxidant enzymes GPx and catalase. The results of the present
study suggest, for the first time, the modulation of inflammation and
hepatic oxidative stress by kefir grains in malnourished animals. These
findings may contribute to better understand the metabolic effects
mediated by kefir grains in the context of malnutrition. However, the
mechanisms by which kefir grains activate the enzymes GPx and CAT
in the liver need to be further investigated.
Acknowledgment
This work was partially supported by the Coordenadoria de
Aperfeicoamento do Pessoal de Nivel Superior (CAPES), Conselho
Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq),
and Fundacao de Amparo a Pesquisa do Estado de Minas Gerais
(FAPEMIG).
Author Contributions
FRS and ASM: study design, data analysis and drafting of the
article; DFL and ASM: drafting of the article; DFL and FRS: data
acquisition; AMBP, IVB and JCS: interpretation of data, SHSS and
ALSG: critically revising the manuscript for important intellectual
content. All authors have approved the final version of the manuscript
for submission.
Availability of Data and Materials
The data that support the findings of this study are available from
the corresponding author, [SHSS], upon reasonable request.
Ethics Approval and Consent to Participate
The Montes Claros State University (Unimontes), Brazil, Ethics
Committee approved the study #189/2019.
Human and Animal Rights
No humans were used in the study. All reported experiments
on animals were performed in accordance to the protocol approved
by the Animal care and use of Committee for Ethics in Animal
Experimentation and Welfare (CEBEA).
References
1. Meier R, Stratton R. Basic concepts in nutrition: epidemiology of malnutrition.
e-SPEN, the European e-Journal of Clinical Nutrition and Metabolism. 2008;
3: e167-e70.
2. Verbrugghe M, Beeckman D, Van Hecke A, Vanderwee K, Van Herck K,
Clays E, et al. Malnutrition and associated factors in nursing home residents:
A cross-sectional, multi-centre study. Clinical nutrition. 2013; 32: 438-443.
3. Institute IFPR. Global Food Policy Report: International Food Policy Research
Institute. 2016.
4. Soeters P, Bozzetti F, Cynober L, Forbes A, Shenkin A, Sobotka L. Defining
malnutrition: a plea to rethink. Clinical nutrition. 2017; 36: 896-901.
5. Ghone RA, Suryakar AN, Kulhalli P, Bhagat SS, Padalkar RK, Karnik AC,
et al. A study of oxidative stress biomarkers and effect of oral antioxidant
supplementation in severe acute malnutrition. Journal of clinical and
diagnostic research: JCDR. 2013; 7: 2146.
6. Partadiredja G, Worrall S, Simpson R, Bedi K. Pre-weaning under nutrition
alters the expression levels of reactive oxygen species enzymes but not their
activity levels or lipid peroxidation in the rat brain. Brain research. 2008; 1222:
69-78.
7. Nompleggi DJ, Bonkovsky HL. Nutritional supplementation in chronic liver
disease: an analytical review. Hepatology. 1994; 19: 518-533.
8. Rui L. Energy metabolism in the liver. Compr Physio. 2014; l 4: 177-197.
9. Hertzler SR, Clancy SM. Kefir improves lactose digestion and tolerance in
adults with lactose maldigestion. Journal of the American Dietetic Association.
2003; 103: 582-587.
10. SOUZA G, GARCIA S, VALLE J. Kefir e suatecnologia-aspectosgerais.
Boletim Ital. 1984; 21.
11. Chen H, Tung Y, Tsai C, Lai C, Lai Z, Tsai H, et al. Kefir improves fatty
liver syndrome by inhibiting the lipogenesis pathway in leptin-deficient ob/ob
knockout mice. International journal of obesity. 2014; 38: 1172.
12. Rosa DD, Dias MM, Grzeskowiak LM, Reis SA, Conceicao LL, Maria do
Carmo GP. Milk kefir: nutritional, microbiological and health benefits. Nutrition
research reviews. 2017; 30: 82-96.
13. Fock RA, Vinolo MAR, Rocha VdMS, de Sa Rocha LC, Borelli P. Protein-
energy malnutrition decreases the expression of TLR-4/MD-2 and CD14
receptors in peritoneal macrophages and reduces the synthesis of TNF-α in
response to Lipopolysaccharide (LPS) in mice. Cytokine. 2007; 40: 105-114.
14. Schneider DI. An introduction to programming using visual basic 2012:
Prentice Hall Press. 2013.
15. Aguiar J, Gomes E, Fonseca-Silva T, Velloso N, Vieira L, Fernandes M, et
al. Fluoxetine reduces periodontal disease progression in a conditioned fear
stress model in rats. Journal of periodontal research. 2013; 48: 632-637.
16. Gomes E, Aguiar J, Fonseca-Silva T, Dias L, Moura-Boas K, Roy A, et al.
Diazepam reverses the alveolar bone loss and hippocampal interleukin-1beta
and interleukin-6 enhanced by conditioned fear stress in ligature-induced
periodontal disease in rats. Journal of periodontal research. 2013; 48: 151-
158.
17. Livak K, Schmittgen T. Analysis of relative gene expression data using
real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods
[Internet]. 2001; 25: 402-408.
18. Pan Y, Long X, Yi R, Zhao X. Polyphenols in Liubao tea can prevent CCl4-
induced hepatic damage in mice through its antioxidant capacities. Nutrients.
2018; 10: 1280.
19. Morris HJ, Carrillo OV, Llaurado G, Alonso ME, Bermudez RC, Lebeque Y, et
al. Effect of starvation and refeeding on biochemical and immunological status
of Balb/c mice: an experimental model of malnutrition. Immunopharmacology
and immunotoxicology. 2011; 33: 438-446.
20. Couto JLA, Vieira RCdS, Barbosa JM, Machado SS, Ferreira HdS.
Alteracoes da funcaohepatica de camundongosdes nutridos e infectadospelo
Schistosomamansoni. Rev Soc Bras Med Trop. 2008; 41: 390-393.
21. Guzman-Silva MA, Wanderley AR, Macedo VM, Boaventura GT.
Recuperacao da desnutricaoemratos median teraco esadicionadasounao
de suplementoalimentar e de vitaminas e mineraisdurante o periodo de
crescimento. Revista de Nutricao. 2004.
22. de Almeida Pinheiro T, Barcala-Jorge AS, Andrade JMO, de Almeida Pinheiro
T, Ferreira ECN, Crespo TS, et al. Obesity and malnutrition similarly alter the
renin-angiotensin system and inflammation in mice and human adipose. The
Journal of nutritional biochemistry. 2017; 48: 74-82.
23. Gavia-García G, González-Martínez H, Miliar-García Á, Bonilla-González E,
de los Ángeles Rosas-Trejo M, Königsberg M, et al. Oxidative damage and
antioxidant defense in thymus of malnourished lactating rats. Nutrition. 2015;
31: 1408-1415.
24. Fardet A, Chardigny J-M. Plant-based foods as a source of lipotropes for
human nutrition: a survey of in vivo studies. Critical reviews in food science
and nutrition. 2013; 53: 535-590.
25. Lykke M, Hother A-L, Hansen CF, Friis H, Mølgaard C, Michaelsen KF, et al.
Malnutrition induces gut atrophy and increases hepatic fat infiltration: studies
in a pig model of childhood malnutrition. American journal of translational
research. 2013; 5: 543.
26. Cho MK, Kim YG, Lee MG, Kim SG. The effect of cysteine on the altered
7. Austin J Nutri Food Sci 8(3): id1148 (2020) - Page - 07
Santos SHS Austin Publishing Group
Submit your Manuscript | www.austinpublishinggroup.com
expression of class α and μ glutathione S-transferase genes in the rat liver
during protein-calorie malnutrition. Biochimicaet Biophysica Acta (BBA)-
Molecular Basis of Disease. 2000; 1502: 235-246.
27. Ling P-R, Smith RJ, Kie S, Boyce P, Bistrian BR. Effects of protein malnutrition
on IL-6-mediated signaling in the liver and the systemic acute-phase
response in rats. American Journal of Physiology-Regulatory, Integrative and
Comparative Physiology. 2004; 287: R801-R808.
28. Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, et al. The
diagnosis and management of non-alcoholic fatty liver disease: practice
Guideline by the American Association for the Study of Liver Diseases,
American College of Gastroenterology, and the American Gastroenterological
Association. Hepatology. 2012: 2005-2023.
29. Hernández-Aquino E, Muriel P. Beneficial effects of naringenin in liver
diseases: Molecular mechanisms. World journal of gastroenterology. 2018;
24: 1679.
30. Kwon OK, Ahn KS, Lee MY, Kim SY, Park BY, Kim MK, et al. Inhibitory effect
of kefiran on ovalbumin-induced lung inflammation in a murine model of
asthma. Archives of pharmacal research. 2008; 31: 1590-1596.
31. Punaro GR, Maciel FR, Rodrigues AM, Rogero MM, Bogsan CS, Oliveira MN,
et al. Kefir administration reduced progression of renal injury in STZ-diabetic
rats by lowering oxidative stress. Nitric Oxide. 2014; 37: 53-60.
32. Ozcan A, Kaya N, Atakisi O, Karapehlivan M, Atakisi E, Cenesiz S. Effect
of kefir on the oxidative stress due to lead in rats. Journal of Applied Animal
Research. 2009; 35: 91-93.