SlideShare a Scribd company logo
1 of 4
CRISPR
Requirements
1. Primer sets for gRNA amplicon, vector backbone
and colony PCR for recombinant vector with
gRNA
2. Hi-Fidelity long range polymerases like Q5/
Phusion
3. Gibson Assembler with master mix having, T5
exonuclease, taq ligase and Phusion polymerase
Primer sets
1)Primers for gRNA amplicon
dLarp7 gRNA8.0 FP
atatccgggtgaacttcgGTCAGGAGCCCGCGACATCAGgttttagagctagaaatag
dLarp7 gRNA6.4 RP
tctagctctaaaacCCATGGACTGAGTCACTTTCcgacgttaaattgaaaatagg
2)Primers for backbone amplicon
dLarp7 GA FP
cctattttcaatttaacgtcggggtcttcgagaagacctgttttagagctagaaatag
dLarp7 GA RP
ctatttctagctctaaaacaggtcttctcgaagaccccgaagttcacccggatat
3)Colony PCR for recombinant vector with gRNA
Test dLarp7 gRNA 8.0 FP
CAGGAGCCCGCGACATCAG
Test dLarp7 gRNA 6.4 RP
CCATGGACTGAGTCACTTTC
Method
• Generate recombinant pCDF4 with 2 tandem
gRNAs against dLarp7
• At the facility - Microinject it into BL 25709/25710
with attP docking site for phiC31 integrase-
mediated transformation on 2/3rd chromosome
• gRNA flies x Act5c Cas9 flies on X chromosome
(Need suggestion to which marker should be
present in the Cas9 stock) to obtain F1 progeny
with del
• F1 x double bal stock yield F2 which will be used for
screening the deletion through PCR

More Related Content

What's hot

Log Visualization - Bellua BCS 2006
Log Visualization - Bellua BCS 2006Log Visualization - Bellua BCS 2006
Log Visualization - Bellua BCS 2006Raffael Marty
 
Enzymes In Transcription, Translation and Replication
Enzymes In Transcription, Translation and ReplicationEnzymes In Transcription, Translation and Replication
Enzymes In Transcription, Translation and ReplicationAngsumanDas2
 
Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Integrated DNA Technologies
 
Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Integrated DNA Technologies
 
Lectut btn-202-ppt-l29. applications of pcr-i (1)
Lectut btn-202-ppt-l29. applications of pcr-i (1)Lectut btn-202-ppt-l29. applications of pcr-i (1)
Lectut btn-202-ppt-l29. applications of pcr-i (1)Rishabh Jain
 
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIncreasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIntegrated DNA Technologies
 
Real time pcr market & end user needs survey
Real time pcr   market & end user needs surveyReal time pcr   market & end user needs survey
Real time pcr market & end user needs surveyAmy Morgan
 
Knockdown of lncRNAs: exploring RNAi and antisense oligo methods
Knockdown of lncRNAs: exploring RNAi and antisense oligo methodsKnockdown of lncRNAs: exploring RNAi and antisense oligo methods
Knockdown of lncRNAs: exploring RNAi and antisense oligo methodsIntegrated DNA Technologies
 
Anne_Vaittinen_advanced_seminar_presentation
Anne_Vaittinen_advanced_seminar_presentationAnne_Vaittinen_advanced_seminar_presentation
Anne_Vaittinen_advanced_seminar_presentationAnne Vaittinen
 
Real time PCR
Real time PCRReal time PCR
Real time PCRnaren
 
Optimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingOptimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingIntegrated DNA Technologies
 
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Integrated DNA Technologies
 
RNA polymerase II depletion promotes transcription of alternative mRNA species
RNA polymerase II depletion promotestranscription of alternative mRNA species RNA polymerase II depletion promotestranscription of alternative mRNA species
RNA polymerase II depletion promotes transcription of alternative mRNA species Md. Shabab Mehebub
 
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Integrated DNA Technologies
 

What's hot (20)

Log Visualization - Bellua BCS 2006
Log Visualization - Bellua BCS 2006Log Visualization - Bellua BCS 2006
Log Visualization - Bellua BCS 2006
 
Enzymes In Transcription, Translation and Replication
Enzymes In Transcription, Translation and ReplicationEnzymes In Transcription, Translation and Replication
Enzymes In Transcription, Translation and Replication
 
Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...Target capture of DNA from FFPE samples— recommendations for generating robus...
Target capture of DNA from FFPE samples— recommendations for generating robus...
 
Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...Reducing off-target events in CRISPR genome editing applications with a novel...
Reducing off-target events in CRISPR genome editing applications with a novel...
 
Lectut btn-202-ppt-l29. applications of pcr-i (1)
Lectut btn-202-ppt-l29. applications of pcr-i (1)Lectut btn-202-ppt-l29. applications of pcr-i (1)
Lectut btn-202-ppt-l29. applications of pcr-i (1)
 
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymesIncreasing genome editing efficiency with optimized CRISPR-Cas enzymes
Increasing genome editing efficiency with optimized CRISPR-Cas enzymes
 
Real time pcr market & end user needs survey
Real time pcr   market & end user needs surveyReal time pcr   market & end user needs survey
Real time pcr market & end user needs survey
 
Knockdown of lncRNAs: exploring RNAi and antisense oligo methods
Knockdown of lncRNAs: exploring RNAi and antisense oligo methodsKnockdown of lncRNAs: exploring RNAi and antisense oligo methods
Knockdown of lncRNAs: exploring RNAi and antisense oligo methods
 
Anne_Vaittinen_advanced_seminar_presentation
Anne_Vaittinen_advanced_seminar_presentationAnne_Vaittinen_advanced_seminar_presentation
Anne_Vaittinen_advanced_seminar_presentation
 
Real time PCR
Real time PCRReal time PCR
Real time PCR
 
20140711 3 t_clark_ercc2.0_workshop
20140711 3 t_clark_ercc2.0_workshop20140711 3 t_clark_ercc2.0_workshop
20140711 3 t_clark_ercc2.0_workshop
 
Bioproject2
Bioproject2Bioproject2
Bioproject2
 
Optimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editingOptimized methods to use Cas9 nickases in genome editing
Optimized methods to use Cas9 nickases in genome editing
 
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
Increase efficiency of genome editing with the Alt-R™ CRISPR-Cas9 System: Des...
 
20140711 4 e_tseng_ercc2.0_workshop
20140711 4 e_tseng_ercc2.0_workshop20140711 4 e_tseng_ercc2.0_workshop
20140711 4 e_tseng_ercc2.0_workshop
 
Genome Assembly
Genome AssemblyGenome Assembly
Genome Assembly
 
Chigot poster2007
Chigot poster2007Chigot poster2007
Chigot poster2007
 
RNA polymerase II depletion promotes transcription of alternative mRNA species
RNA polymerase II depletion promotestranscription of alternative mRNA species RNA polymerase II depletion promotestranscription of alternative mRNA species
RNA polymerase II depletion promotes transcription of alternative mRNA species
 
Nested pcr
Nested pcrNested pcr
Nested pcr
 
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing...
 

Similar to CRISPR.pptx

19_21Translation
19_21Translation19_21Translation
19_21TranslationKaren Lewis
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryPeyman Ghoraishizadeh
 
New RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingNew RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingIntegrated DNA Technologies
 
PCR based Detection of Carbapenamases: Different primers and their utility
PCR based Detection of Carbapenamases: Different primers and their utilityPCR based Detection of Carbapenamases: Different primers and their utility
PCR based Detection of Carbapenamases: Different primers and their utilityBhoj Raj Singh
 
Crop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymesCrop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymesOECD Environment
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishingNikolay Vyahhi
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technologyDr. Armaan Singh
 
Transcription and translation
Transcription and translationTranscription and translation
Transcription and translationpunxsyscience
 
Polymerase chain reaction principles and practice
Polymerase chain reaction   principles and practice Polymerase chain reaction   principles and practice
Polymerase chain reaction principles and practice subramaniam sethupathy
 
Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Robert Bruce
 
2011-Molecularmarker (1).ppt
2011-Molecularmarker (1).ppt2011-Molecularmarker (1).ppt
2011-Molecularmarker (1).pptsumitraDas14
 
2011-Molecularmarkerpppppppppppppppppt.ppt
2011-Molecularmarkerpppppppppppppppppt.ppt2011-Molecularmarkerpppppppppppppppppt.ppt
2011-Molecularmarkerpppppppppppppppppt.pptBioinformaticsCentre
 
rnaseq_from_babelomics
rnaseq_from_babelomicsrnaseq_from_babelomics
rnaseq_from_babelomicsFrancisco Garc
 

Similar to CRISPR.pptx (20)

Molecular markers
Molecular markersMolecular markers
Molecular markers
 
19_21Translation
19_21Translation19_21Translation
19_21Translation
 
Flipbook
FlipbookFlipbook
Flipbook
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratory
 
Types of PCR
Types of PCR Types of PCR
Types of PCR
 
Types of PCR
Types of PCRTypes of PCR
Types of PCR
 
New RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editingNew RNA tools for optimized CRISPR/Cas9 genome editing
New RNA tools for optimized CRISPR/Cas9 genome editing
 
PCR based Detection of Carbapenamases: Different primers and their utility
PCR based Detection of Carbapenamases: Different primers and their utilityPCR based Detection of Carbapenamases: Different primers and their utility
PCR based Detection of Carbapenamases: Different primers and their utility
 
Hoofdstuk 20 2008 deel 1
Hoofdstuk 20 2008 deel 1Hoofdstuk 20 2008 deel 1
Hoofdstuk 20 2008 deel 1
 
Crop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymesCrop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymes
 
Assembly and finishing
Assembly and finishingAssembly and finishing
Assembly and finishing
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technology
 
Transcription and translation
Transcription and translationTranscription and translation
Transcription and translation
 
RNA Folding
RNA FoldingRNA Folding
RNA Folding
 
Rna Folding
Rna FoldingRna Folding
Rna Folding
 
Polymerase chain reaction principles and practice
Polymerase chain reaction   principles and practice Polymerase chain reaction   principles and practice
Polymerase chain reaction principles and practice
 
Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.
 
2011-Molecularmarker (1).ppt
2011-Molecularmarker (1).ppt2011-Molecularmarker (1).ppt
2011-Molecularmarker (1).ppt
 
2011-Molecularmarkerpppppppppppppppppt.ppt
2011-Molecularmarkerpppppppppppppppppt.ppt2011-Molecularmarkerpppppppppppppppppt.ppt
2011-Molecularmarkerpppppppppppppppppt.ppt
 
rnaseq_from_babelomics
rnaseq_from_babelomicsrnaseq_from_babelomics
rnaseq_from_babelomics
 

Recently uploaded

OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...
OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...
OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...OECD Environment
 
Finland's mental health policy and its implementation: a CSO perspective
Finland's mental health policy and its implementation: a CSO perspectiveFinland's mental health policy and its implementation: a CSO perspective
Finland's mental health policy and its implementation: a CSO perspectiveKristian Wahlbeck
 
Electric vehicle infrastructure in rural areas
Electric vehicle infrastructure in rural areasElectric vehicle infrastructure in rural areas
Electric vehicle infrastructure in rural areasRPO America
 
16 may, International Day of Living together in peace 2024
16 may, International Day of Living together in peace 202416 may, International Day of Living together in peace 2024
16 may, International Day of Living together in peace 2024Christina Parmionova
 
Harbin-Gross-Spring2022.pdf Yale Historical Review
Harbin-Gross-Spring2022.pdf Yale Historical ReviewHarbin-Gross-Spring2022.pdf Yale Historical Review
Harbin-Gross-Spring2022.pdf Yale Historical Reviewyalehistoricalreview
 
International Day of Families - 15 May 2024 - UNDESA.
International Day of Families - 15 May 2024 - UNDESA.International Day of Families - 15 May 2024 - UNDESA.
International Day of Families - 15 May 2024 - UNDESA.Christina Parmionova
 
Everything you need to know about your Parish or Town council website & .gov....
Everything you need to know about your Parish or Town council website & .gov....Everything you need to know about your Parish or Town council website & .gov....
Everything you need to know about your Parish or Town council website & .gov....Scribe
 
2024: The FAR - Federal Acquisition Regulations, Part 33
2024: The FAR - Federal Acquisition Regulations, Part 332024: The FAR - Federal Acquisition Regulations, Part 33
2024: The FAR - Federal Acquisition Regulations, Part 33JSchaus & Associates
 
Nitrogen filled high expansion foam in open Containers
Nitrogen filled high expansion foam in open ContainersNitrogen filled high expansion foam in open Containers
Nitrogen filled high expansion foam in open ContainersHarm Kiezebrink
 
RPO America Peer Exchange: Rural Transportation Planning Programs
RPO America Peer Exchange: Rural Transportation Planning ProgramsRPO America Peer Exchange: Rural Transportation Planning Programs
RPO America Peer Exchange: Rural Transportation Planning ProgramsRPO America
 
Electric Vehicle infrastructure planning in Rural Planning Organizations
Electric Vehicle infrastructure planning in Rural Planning OrganizationsElectric Vehicle infrastructure planning in Rural Planning Organizations
Electric Vehicle infrastructure planning in Rural Planning OrganizationsRPO America
 
Item # 7-8 - 6900 Broadway P&Z Case # 438
Item # 7-8 - 6900 Broadway P&Z Case # 438Item # 7-8 - 6900 Broadway P&Z Case # 438
Item # 7-8 - 6900 Broadway P&Z Case # 438ahcitycouncil
 
Ian Bremmer's message for those graduating in toxic times.pdf
Ian Bremmer's message for those graduating in toxic times.pdfIan Bremmer's message for those graduating in toxic times.pdf
Ian Bremmer's message for those graduating in toxic times.pdfEnergy for One World
 
PPT Item # 9 2ndQTR Financial & Inv. Report
PPT Item # 9 2ndQTR Financial & Inv. ReportPPT Item # 9 2ndQTR Financial & Inv. Report
PPT Item # 9 2ndQTR Financial & Inv. Reportahcitycouncil
 
Tennessee DOT- TEVI Plan coordination & EV
Tennessee DOT- TEVI Plan coordination & EVTennessee DOT- TEVI Plan coordination & EV
Tennessee DOT- TEVI Plan coordination & EVRPO America
 
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...Harm Kiezebrink
 
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdf
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdfEDI Executive Education MasterClass- 15thMay 2024 (updated).pdf
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdfEnergy for One World
 
World Wildlife Crime Report 2024 - Introduction
World Wildlife Crime Report 2024 - IntroductionWorld Wildlife Crime Report 2024 - Introduction
World Wildlife Crime Report 2024 - IntroductionChristina Parmionova
 
Plant health, safe trade and digital technology.
Plant health, safe trade and digital technology.Plant health, safe trade and digital technology.
Plant health, safe trade and digital technology.Christina Parmionova
 

Recently uploaded (20)

OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...
OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...
OECD Green Talks LIVE | Diving deeper: the evolving landscape for assessing w...
 
Finland's mental health policy and its implementation: a CSO perspective
Finland's mental health policy and its implementation: a CSO perspectiveFinland's mental health policy and its implementation: a CSO perspective
Finland's mental health policy and its implementation: a CSO perspective
 
Electric vehicle infrastructure in rural areas
Electric vehicle infrastructure in rural areasElectric vehicle infrastructure in rural areas
Electric vehicle infrastructure in rural areas
 
16 may, International Day of Living together in peace 2024
16 may, International Day of Living together in peace 202416 may, International Day of Living together in peace 2024
16 may, International Day of Living together in peace 2024
 
Harbin-Gross-Spring2022.pdf Yale Historical Review
Harbin-Gross-Spring2022.pdf Yale Historical ReviewHarbin-Gross-Spring2022.pdf Yale Historical Review
Harbin-Gross-Spring2022.pdf Yale Historical Review
 
International Day of Families - 15 May 2024 - UNDESA.
International Day of Families - 15 May 2024 - UNDESA.International Day of Families - 15 May 2024 - UNDESA.
International Day of Families - 15 May 2024 - UNDESA.
 
Everything you need to know about your Parish or Town council website & .gov....
Everything you need to know about your Parish or Town council website & .gov....Everything you need to know about your Parish or Town council website & .gov....
Everything you need to know about your Parish or Town council website & .gov....
 
2024: The FAR - Federal Acquisition Regulations, Part 33
2024: The FAR - Federal Acquisition Regulations, Part 332024: The FAR - Federal Acquisition Regulations, Part 33
2024: The FAR - Federal Acquisition Regulations, Part 33
 
Nitrogen filled high expansion foam in open Containers
Nitrogen filled high expansion foam in open ContainersNitrogen filled high expansion foam in open Containers
Nitrogen filled high expansion foam in open Containers
 
RPO America Peer Exchange: Rural Transportation Planning Programs
RPO America Peer Exchange: Rural Transportation Planning ProgramsRPO America Peer Exchange: Rural Transportation Planning Programs
RPO America Peer Exchange: Rural Transportation Planning Programs
 
How to Save a Place: Get the Word Out Far And Wide
How to Save a Place: Get the Word Out Far And WideHow to Save a Place: Get the Word Out Far And Wide
How to Save a Place: Get the Word Out Far And Wide
 
Electric Vehicle infrastructure planning in Rural Planning Organizations
Electric Vehicle infrastructure planning in Rural Planning OrganizationsElectric Vehicle infrastructure planning in Rural Planning Organizations
Electric Vehicle infrastructure planning in Rural Planning Organizations
 
Item # 7-8 - 6900 Broadway P&Z Case # 438
Item # 7-8 - 6900 Broadway P&Z Case # 438Item # 7-8 - 6900 Broadway P&Z Case # 438
Item # 7-8 - 6900 Broadway P&Z Case # 438
 
Ian Bremmer's message for those graduating in toxic times.pdf
Ian Bremmer's message for those graduating in toxic times.pdfIan Bremmer's message for those graduating in toxic times.pdf
Ian Bremmer's message for those graduating in toxic times.pdf
 
PPT Item # 9 2ndQTR Financial & Inv. Report
PPT Item # 9 2ndQTR Financial & Inv. ReportPPT Item # 9 2ndQTR Financial & Inv. Report
PPT Item # 9 2ndQTR Financial & Inv. Report
 
Tennessee DOT- TEVI Plan coordination & EV
Tennessee DOT- TEVI Plan coordination & EVTennessee DOT- TEVI Plan coordination & EV
Tennessee DOT- TEVI Plan coordination & EV
 
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...
Low Atmospheric Pressure Stunning is not a humane alternative to Carbon Dioxi...
 
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdf
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdfEDI Executive Education MasterClass- 15thMay 2024 (updated).pdf
EDI Executive Education MasterClass- 15thMay 2024 (updated).pdf
 
World Wildlife Crime Report 2024 - Introduction
World Wildlife Crime Report 2024 - IntroductionWorld Wildlife Crime Report 2024 - Introduction
World Wildlife Crime Report 2024 - Introduction
 
Plant health, safe trade and digital technology.
Plant health, safe trade and digital technology.Plant health, safe trade and digital technology.
Plant health, safe trade and digital technology.
 

CRISPR.pptx

  • 2. Requirements 1. Primer sets for gRNA amplicon, vector backbone and colony PCR for recombinant vector with gRNA 2. Hi-Fidelity long range polymerases like Q5/ Phusion 3. Gibson Assembler with master mix having, T5 exonuclease, taq ligase and Phusion polymerase
  • 3. Primer sets 1)Primers for gRNA amplicon dLarp7 gRNA8.0 FP atatccgggtgaacttcgGTCAGGAGCCCGCGACATCAGgttttagagctagaaatag dLarp7 gRNA6.4 RP tctagctctaaaacCCATGGACTGAGTCACTTTCcgacgttaaattgaaaatagg 2)Primers for backbone amplicon dLarp7 GA FP cctattttcaatttaacgtcggggtcttcgagaagacctgttttagagctagaaatag dLarp7 GA RP ctatttctagctctaaaacaggtcttctcgaagaccccgaagttcacccggatat 3)Colony PCR for recombinant vector with gRNA Test dLarp7 gRNA 8.0 FP CAGGAGCCCGCGACATCAG Test dLarp7 gRNA 6.4 RP CCATGGACTGAGTCACTTTC
  • 4. Method • Generate recombinant pCDF4 with 2 tandem gRNAs against dLarp7 • At the facility - Microinject it into BL 25709/25710 with attP docking site for phiC31 integrase- mediated transformation on 2/3rd chromosome • gRNA flies x Act5c Cas9 flies on X chromosome (Need suggestion to which marker should be present in the Cas9 stock) to obtain F1 progeny with del • F1 x double bal stock yield F2 which will be used for screening the deletion through PCR