2. Requirements
1. Primer sets for gRNA amplicon, vector backbone
and colony PCR for recombinant vector with
gRNA
2. Hi-Fidelity long range polymerases like Q5/
Phusion
3. Gibson Assembler with master mix having, T5
exonuclease, taq ligase and Phusion polymerase
3. Primer sets
1)Primers for gRNA amplicon
dLarp7 gRNA8.0 FP
atatccgggtgaacttcgGTCAGGAGCCCGCGACATCAGgttttagagctagaaatag
dLarp7 gRNA6.4 RP
tctagctctaaaacCCATGGACTGAGTCACTTTCcgacgttaaattgaaaatagg
2)Primers for backbone amplicon
dLarp7 GA FP
cctattttcaatttaacgtcggggtcttcgagaagacctgttttagagctagaaatag
dLarp7 GA RP
ctatttctagctctaaaacaggtcttctcgaagaccccgaagttcacccggatat
3)Colony PCR for recombinant vector with gRNA
Test dLarp7 gRNA 8.0 FP
CAGGAGCCCGCGACATCAG
Test dLarp7 gRNA 6.4 RP
CCATGGACTGAGTCACTTTC
4. Method
• Generate recombinant pCDF4 with 2 tandem
gRNAs against dLarp7
• At the facility - Microinject it into BL 25709/25710
with attP docking site for phiC31 integrase-
mediated transformation on 2/3rd chromosome
• gRNA flies x Act5c Cas9 flies on X chromosome
(Need suggestion to which marker should be
present in the Cas9 stock) to obtain F1 progeny
with del
• F1 x double bal stock yield F2 which will be used for
screening the deletion through PCR