SlideShare a Scribd company logo
1 of 94
Chromosomes, Crops and 
Superdomestication in Katowice 
Pat Heslop-Harrison 
phh4@le.ac.uk 
www.molcyt.com 
UserID/PW ‘visitor’ 
Pathh1: 
Twitter #PMC . 
Slideshare pathh1
From Chromosome to Nucleus 
Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
How do genomes evolve? 
–Gene mutation Genome very rarely evolution 
(human: 
10−8/site/generation) 
–Chromosome evolution 
–Polyploidy and genome duplication (ancient & 
modern) 
–Repetitive sequences: mobility & copy number 
(10−4/generation in μsat) 
–Recombination 
–Epigenetic aspects: centromeres & expression
How do genomes evolve? 
– Gene mutation Genome very rarely 
evolution 
– Chromosome evolution 
– Polyploidy and genome duplication (ancient and modern) 
– Repetitive sequences: mobility & copy number 
– Recombination 
– Epigenetic aspects – centromeres & expression 
How can we exploit knowledge of genome evolution? 
– Biodiversity 
– Chromosome and genome engineering 
– Breeding 
– Markers
Musa biodiversity and genomes: x=11 
Red - AAA 2n=3x=33 – M. acuminata 
Palayam codan AAB (two bunch yellow, one green) Musa x 
Peyan ABB (green cooking banana) 
Njalipoovan AB (yellow) 2n=2x=22 M. acuminata x M. balbisiana 
Robusta AAA (green ripe) 
Nendran AAB 
Poovan AAB (one yellow bunch) 
Red AAA 
Varkala, Kerala, India Peyan ABB
Retrotransposons 
Class I transposable elements 
RNA intermediate 
DNA transposons 
Class II transposable elements 
Cut-and-paste
Retroelements 
Sequences which amplify through an RNA intermediate 
• 50% of all the DNA!
Retroelements 
BAC sequences from Musa Calcutta 4 
Homologous over the full length 
except for a 5kb insert 
• a Ty1-copia retroelement
Alignment of two homologous Musa BACs shows gaps in both 
B genome M. balbisiana and A genome M. acuminata 
MA4_82I11 
MBP_81C12 
MuhAT 
1 
XX TE MITE XX TE (SINGLE) 
MuhAT2 
a 
XX TE 
(AGNABI) 
MuhAT3 MuhAT4 MITE(MBIR 
) 
XX 
TE 
XX TE (MBT) 
272 
bp 
102,190 
bp 
26, 410 bp 128,068 bp 
DNA transposons hAT are particularly frequent 
8 bp TSD, and short TIRs of 5–27 bp 
transposase (sometimes degenerate) including a DDE site. 
Non-autonomous (MITE) derivatives of hAT with deletion coding sequence 
Menzel, Schmidt, Nouroz, HH Chr Res subject minor revision 2015
Musa balbisiana (MBP 81C12) 
Musa acuminata (MA4 82I11) 
hAT 1 
1676 TE 
384 bp TE + 781 MITE 
Transposed Element 
Sr. No. Primer Pairs Product Size 
(bp) 
Microsatellite (AT) 
621 bp MBT 
Sequence 
1. hAT18486 
hAT19037 
hAT 2 
hAT 3 
560 ACCCACCTGGCTCTTGTGTC 
AGCGAATGTGTTTTGACCAC 
4192 bp TE 
hAT 4 
Microsatellite (AT) 
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 
23/09/2014 12
Musa balbisiana (MBP 81C12) 
Musa acuminata (MA4 82I11) 
hAT 1 
1676 TE 
384 bp TE + 781 MITE 
Transposed Element 
Sr. No. Primer Pairs Product Size 
(bp) 
Microsatellite (AT) 
621 bp MBT 
Sequence 
1. hAT18486 
hAT19037 
hAT 2 
hAT 3 
560 ACCCACCTGGCTCTTGTGTC 
AGCGAATGTGTTTTGACCAC 
4192 bp TE 
hAT 4 
Microsatellite (AT) 
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 
23/09/2014 13
A-genome specific hAT in 
three Musa accessions 
(2n=3x=33) 
Musa ‘Williams 
Cavendish’ 
(AAA) 
Musa 
(ABB) 
Musa 
(ABB)
23/09/2014 15 Dot plot showing the complete Inverted repeat.
HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 
23/09/2014 16 
1KB 
800 
600 
400 
200 
hAT1 insertion sites in Musa diversity collection 
hAT486F and hAT037R 
Top bands (560-bp) amplified hAT element 
Lower bands amplifying the flanking sequences only 
Menzel, Nouroz, Heslop-Harrison, Schmidt 2014
Retroelement Markers 
LTR Retrotransposon LTR 
LTR Retrotransposon LTR 
LTR Retrotransposon LTR 
LTR Retrotransposon LTR 
Insertion 
IRAP – InterRetroelement PCR 
LTR Retrotransposon LTR 
LTR Retrotransposon LTR
IRAP diversity in Musa 
Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol 
Nair, Teo, Schwarzacher, HH 2006 Euphytica 
Teo, Schwarzacher et al. in prep.
Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al. 
23/09/2014 19
BSV Expression in Banana 
Double stranded DNA is infective: Insect vector 
Unexpected epidemiology: Appearance after cold or tissue culture
Nuclear Copies of Banana Streak Virus in Banana
Nuclear Copies 
of BSV in banana 
DNA Fibre in situ hybridization 
Harper, HH et al., Virology 1999 … cf D’Hont et al., Nature, 2012
Whole genome shotgun sequencing 
• Changing all cytogenomics (.org) work 
• Easily obtaining several-fold sequence 
coverage
D’Hont et al. 
Nature 2012 
doi:10.1038/nature 
11241
Musa 
Banana 
n=11 
Sequence: 
D’Hont, inc HH et al. 
Nature 2012 
Haploid: Nair, HH 2013
Whole genome duplications 
• The surprise to the sequencers: conserved 
synteny and relatively few breakpoints 
• The surprise to the cytogeneticists: 
sequencing shows whole genome duplications 
(=polyploidy) deep in the phylogenetic tree 
• The surprise to everyone: so few genes but 
multifunctional
A D’Hont et al. Nature 2012 
doi:10.1038/nature11241
Brachiaria 
LTR element families 
Fabíola Carvalho Santos 
André Luiz Laforga Vanzela 
See poster 
Forage/pasture 
Urban 
Savanna/cerrado 
Forest 
Sugar cane 
Soybean/corn 
Brazil land use
Some probes show less 
hybridization to some 
chromosomes, perhaps indicating 
genome specificity. 
Fabíola Carvalho Santos 
André Luiz Laforga Vanzela 
See poster
From Chromosome to Nucleus 
Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
Wheat evolution and hybrids 
Triticum uratu 
2n=2x=14 
AA 
Aegilops speltoides 
Triticum dicoccoides 
Einkorn 
2n=4x=28 
AABB 
Triticum monococcum 
2n=2x=14 
AA 
Bread wheat 
Triticum 
aestivum 
2n=6x=42 
AABBDD 
Durum/Spaghetti 
Triticum turgidum ssp durum 
2n=4x=28 
AABB 
relative 
2n=2x=14 
BB Triticum tauschii 
(Aegilops squarrosa) 
2n=2x=14 
DD 
Triticale 
xTriticosecale 
2n=6x=42 
AABBRR 
Rye 
Secale cereale 
2n=2x=14 
RR
Copyright restrictions may apply. 
Inter-retroelement (IRAP) 
analysis of Triticum tauschii ssp 
tauschii from Iran 
SSR/Microsats: all are different 
and no tree is supported 
Different sequence classes 
evolve at different rates 
Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
Crop standing 
Lodging in cereals 
Crop fallen
Use of repetitive DNA sequences as 
chromosome markers
Inheritance of Chromosome 5D 
Aegilops ventricosa 
DDNN 
dpTa1 
pSc119.2 
Genomic Ae.ventricosa 
ABDN 
Triticum persicum Ac.1510 
AABB 
AABBDDNN Marne 
AABBDD 
VPM1 Dwarf A 
CWW1176-4 
Rendezvous 
Piko 
Virtue 
96ST61 
× 
× 
× 
× 
Hobbit 
× {Kraka × (Huntsman × Fruhgold)}
Wheat Streak Mosaic Virus in North America 
Bob Graybosch, USDA
Wsm-1: only highly effective source of resistance to WSMV
Mace wheat 
Graybosch et al. 2009 
In situ: Niaz Ali & Schwarzacher
Chromosome evolution - Polyploidy 
• Selected natural 
– Wheat 
– Banana 
– Brachiaria 
– Proso millet 
• Synthetic 
– Triticale 
– Nicotiana
Proso millet (Panicum miliaceum): 
origins, genomic studies and 
prospects 
Pat Heslop-Harrison, Farah Badakshi 
and Harriet Hunt
Panicum sensu stricto c. 100 species; x=9 
Evolution of Panicum miliaceum Proso millet 
P. virgatum 
2n=4x=36 or 2x=18 
? ? ? ? ? ? 
P. miliaceum 
2n=4x=36 
P. capillare 
2n=2x=18 
P. repens 
2n=4x=36 
also 2n=18 to 54 
P. sumatrense 
2n=2x=18 or 4x=36 
Global North-temperate 
Low genetic diverstiy 
Weedy forms 
• Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the 
origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. 2014
• P. miliaceum: allotetraploid with maternal 
ancestor P. capillare and one genome shared 
with P. repens (also allotetraploid) 
 Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of 
tetraploid broomcorn millet, P. miliaceum. J Exp Bot. March 2014
Chromosome 
and genome 
engineering 
Cell fusion 
hybrid of two 
4x tetraploid 
tobacco 
species 
Patel, Badakshi, HH, 
Davey et al 2011 Annals 
of Botany
Nicotiana 
hybrid 
4x + 4x 
cell fusions 
Each of 4 
chromosome 
sets has 
distinctive 
repetitive 
DNA when 
probed with 
genomic DNA 
Patel et al 
Ann Bot 2011 
Cell fusion 
hybrid of two 
4x tetraploid 
tobacco 
species 
Four genomes 
differentially 
labelled 
Patel, Badakshi, 
HH, Davey et al 
2011 Annals 
Botany
Arachis hypogaea - Peanut 
Tetraploid of recent origin, 
ancestors separated only 3 My ago 
Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals Botany 2013
•Arachis hypogea 2n=4x=40 probed with 
•(green) A. duranensis; (red) A. ipaënsis 
 Bertioli et al. Annals of Botany 2013
BAC in situ hybridization
Primula BAC mapping 
Gilmartin, Lu, HH & Badakshi 2015?
Size and location of 
chromosome regions 
from radish (Raphanus 
sativus) carrying the 
fertility restorer Rfk1 
gene and transfer to 
spring turnip rape 
(Brassica rapa) 
DAPI metaphase blue 
Radish genomic red (2 
radish chromosomes) 
far-red 45S rDNA 
Rfk1 carrying BAC green 
labels sites on radish and 
homoeologous pair in 
Brassica 
Tarja Niemelä, 
Seppänen, Badakshi, 
Rokka HH 
Chromosome Research 
2012
BACs from different 
species have different 
repeat distributions – 
and hence different 
patterns of hybridization
Organelle sequences 
from chloroplasts or 
mitochondria 
Sequences from viruses, 
Agrobacteriumor other 
vectors 
Transgenes introduced 
with molecular biology 
methods 
Genes, regulatory and non-coding 
single copy sequences 
Dispersed repeats: 
Transposable Elements 
Repetitive DNA sequences 
Nuclear 
Genome 
Tandem repeats 
DNA transposons 
copied and 
moved via DNA 
Retrotransposons 
amplifying via an 
RNA intermediate 
Centromeric 
repeats 
Structural 
components of 
chromosomes 
Telomeric 
repeats 
Repeated genes 
Simple sequence 
repeats or 
microsatellites 
Subtelomeric 
repeats 
45S and 5S 
rRNA genes 
Blocks of tandem 
repeats at discrete 
chromosomal loci 
DNA sequence components of the nuclear genome 
Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences 
Other genes
MuTRR 
180 bp 
X MuTRR 
MuTRF 
MuTRF 
220 bp 
Monkey retroelement 
• The original 177bp repeat fits nicely around the 
nucleosome allowing a tight coiling 
• The repeat unit with the retroelement foot print, the 
63bp box, has a much more open configuration 
• It is maintained as it brings a CG and CNG site that allows 
control via methylation 
Insertion and 
subsequent loss 
C.H Teo and Schwarzacher
A 
B 
C 
DNA sequence 
Centromere 
TE 
Tandem repeat monomer 
TE Transposable element 
Single copy DNA 
Metaphase 
chromosome 
Spindle microtubules pulling apart 
chromatids 
147bp plus 5-70bp linker = 150-220bp 
100bp plus 55bp linker = 155bp 
D 
E 
F 
G 
H 
I 
Kinetochore 
Henikoff et al 2013 
C: antibody to CENH3 variant 
Heslop-Harrison & Schwarzacher 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci 
USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://wp.me/p2Ewqp-7h
Domestication 
• Most species domesticated 10,000 years ago: 
cereals, legumes/pulses, brassicas, fruits, 
cows/sheep/pigs, silkworm/bees) 
• Few species more recently (rabbits, fish; trees, 
biofuel crops) 
• A few dropped out of production 
• First steps: productive, reproduce easily, 
disease-free, edible/tasty, harvestable … 
Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and 
review of rabbits www.tinyurl.com/rabdom
Domestication 
• … 
• A few dropped out of production 
• Second steps: more productive, harvestable 
• Third step: fitting for sustainable intensification 
• Proso millet: the most water-efficient cereal 
• Superdomestication and design of crops 
Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and 
review of rabbits www.tinyurl.com/rabdom www.tinyurl.com/superdom
Outputs 
–CROPS 
– Fixed energy 
Inputs 
–Light 
–Heat 
–Water 
–Gasses 
–Nutrients 
–Light 
–Heat 
–Water 
–Gasses 
–Nutrients 
(Ecosystem services)
Conventional Breeding 
• Cross the best with the best and hope for something 
better 
Superdomestication 
• Decide what is wanted and then plan how to get it 
– Variety crosses 
– Mutations 
– Hybrids (sexual or cell-fusion) 
– Genepool 
– Transformation
Economic growth 
• Separate into increases in inputs 
(resources, labour and capital) and 
technical progress 
• 90% of the growth in US output per 
worker is attributable to technical 
progress 
Robert Solow – Economist
1.2E+09 
1E+09 
800000000 
600000000 
Agronomy 
400000000 
200000000 
0 
52 years of plant breeding progress 
GM maize 
Maize 
Rice, paddy 
Wheat 
Population /10 
Genetics 
1961 1970 1980 1990 2000 2010 2013
United Nations Millennium Development Goals-MDGs 
1990 to 2015 
• Goal 1 – Eradicate extreme poverty and 
hunger 
• 
Goal 2 – Achieve universal primary education 
• Goal 3 – Promote gender equity and 
empower women 
• Goal 4 – Reduce child mortality 
• 
Goal 5 – Improve maternal health 
• 
Goal 6- Combat HIV/AIDS, malaria and 
other diseases 
• Goal 7 - Ensure environmental 
sustainability 
• Goal 8 - Develop a global partnership 
for development
From Chromosome to Nucleus 
Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
How do genomes evolve? 
– Gene mutation Genome very rarely 
evolution 
– Chromosome evolution 
– Polyploidy and genome duplication (ancient and modern) 
– Repetitive sequences: mobility & copy number 
– Recombination 
– Epigenetic aspects – centromeres & expression 
How can we exploit knowledge of genome evolution? 
– Biodiversity 
– Chromosome and genome engineering 
– Breeding 
– Markers Pat Heslop-Harrison & Trude Schwarzacher 
www.molcyt.com 
Pathh1 on slideshare
Chromosomes, Crops and 
Superdomestication in Katowice 
Pat Heslop-Harrison 
phh4@le.ac.uk 
www.molcyt.com 
UserID/PW ‘visitor’ 
Pathh1: 
Twitter #PMC . 
Slideshare pathh1
Major Genomic Components 
• Tandem Repeats 
• Simple Sequence Repeats 
• Dispersed Repeats 
• Functional Repeats 
• Retroelements 
• Genes 
Typical Fraction 
10% 
5% 
10% 
15% 
50% 
10%
A D’Hont et al. 
Nature 2012 
doi:10.1038/na 
ture11241 
Whole-genome duplication events.
Satellite DNA probe green
Differences between genomes 
Major differences in the nature and amount of 
repetitive DNA 
• 45S rDNA 
• dpTa1 tandem repeat
146 bp around 
histones
From Chromosome to Nucleus 
Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
• Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC 
content of the sequence and (red, smooth line) sequence curvature. While GC and AT 
rich regions of a sequence generally correlate with curvature, the kinked region shows 
curvature with low GC content.
• How do genomes evolve? 
• How can we exploit knowledge of genome 
evolution? 
– Biodiversity 
– Chromosome engineering 
– Markers
Genome engineering 
• Introgression of chromosomes 
– Brassica – Raphanus 
– Wheat – Thinopyrum
Chromatin 
• Packaging
UK Wheat 1948-2007 
52,909 data points, 308 varieties 
From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from 
the past and opportunities for the future. SCRI website.
Rules for successful domestication 
• There aren’t any! 
• Crops come from anywhere (new/old world; 
temperate/tropical; dry/humid) 
• They might be grown worldwide 
• Polyploids and diploids (big genomes-small 
genomes, many chromosomes-few 
chromosomes) 
• Seeds, stems, tubers, fruits, leaves
DNA methylation is unevenly distributed on 
10 m 
Musa chromosomes 
copia 
elements 
in methylated 
regions, but also 
in some low 
methylated 
regions (arrows) 
5MeC
DNA methylation is unevenly distributed on 
10 m 
C.H Teo and Schwarzacher 
Musa chromosomes 
5MeC 
gypsy 
elements 
in methylated 
regions, but also 
in some low 
methylated 
regions (arrows) 
Teo & 
Schwarzacher in 
prep 2013
Genome evolution 
• How do genomes evolve? 
– Mutation very rarely (human: 10−8/site/generation) 
– Chromosome evolution 
– Polyploidy and genome duplication (ancient and modern) 
– Repetitive sequences – mobility & copy number (10−4 μsat) 
– Recombination 
– Epigenetic aspects – centromeres & expression 
• How can we exploit knowledge of genome evolution? 
– Biodiversity 
– Chromosome engineering 
– Breeding 
– Markers
Outputs 
–Crops 
(Chemical energy) 
– Food 
– Feed 
– Fuel 
– Fibre 
– Flowers 
– Pharmaceuticals 
– Fun 85
The genepool has the diversity to 
address these challenges … 
New methods to exploit and 
characterize germplasm let use make 
better and sustainable use of the 
genepool 
Molecular cytogenetics …
How to use diversity 
• Cross two varieties 
• Genome manipulations 
• Cross two species and make a new one 
• Cell fusion hybrids 
• Chromosome manipulation 
• Backcross a new species 
• Generate recombinants 
• Chromosome recombinations 
• Transgenic approaches 
• Use a new species
Nothing special about crop genomes? 
Crop Genome size 2n Ploidy Food 
Rice 400 Mb 24 2 3x endosperm 
Wheat 17,000 Mbp 42 6 3x endosperm 
Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm 
Rapeseed B. 
napus 
1125 Mbp 38 4 Cotyledon oil/protein 
Sugar beet 758 Mbp 18 2 Modified root 
Cassava 770 Mbp 36 2 Tuber 
Soybean 1,100 Mbp 40 4 Seed cotyledon 
Oil palm 3,400 Mbp 32 2 Fruit mesocarp 
Banana 500 Mbp 33 3 Fruit mesocarp 
Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop 
domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B978- 
0-12-381466-1.00001-8 
Tinyurl.com/domest
DNA sequence 
Centromere 
TE 
Tandem repeat monomer 
TE Transposable element 
Single copy DNA 
Metaphase 
chromosome 
Spindle microtubules pulling apart 
chromatids 
147bp plus 5-70bp linker = 150-220bp 
Kinetochore 
Heslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci 
USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013)
Genes!
EvolutionEpigeneticsDevelopment 
Phenotype 
Multiple abnormalities 
Genetic changes 
non-reverting 
Changes seen, some reverting 
(Male/Female) 
Normal Differentiation 
Cause 
Chromosomal loss, deletion or 
translocation 
Gene mutation / base pair 
changes 
Telomere shortening 
(Retro)transposon insertion 
Retrotransposon activation 
SSR expansion 
Methylation 
Heterochromatinization 
Chromatin remodelling 
Histone modification
Outputs 
–CROPS 
– Fixed energy 
Inputs 
–Light 
–Heat 
–Water 
–Gasses 
–Nutrients
Outputs 
–CROPS 
– Fixed energy 
93 
Inputs 
–Light 
–Heat 
–Water 
–Gasses 
–Nutrients 
– Light 
– Heat 
– Water 
– Gasses 
– Nutrients
Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication

More Related Content

What's hot

Cytoplasmic male sterility
Cytoplasmic male sterilityCytoplasmic male sterility
Cytoplasmic male sterilityvibhakhanna1
 
Mapping the bacteriophage genome
Mapping the bacteriophage genomeMapping the bacteriophage genome
Mapping the bacteriophage genomevibhakhanna1
 
Deveopment of embryo in monocot and dicot
Deveopment of embryo in monocot and dicotDeveopment of embryo in monocot and dicot
Deveopment of embryo in monocot and dicotAmohamedmansuraliMan
 
Transition o of flowering plants
Transition o of flowering plants Transition o of flowering plants
Transition o of flowering plants SnehaSahu20
 
RNA Interference (RNAi)
RNA Interference (RNAi)RNA Interference (RNAi)
RNA Interference (RNAi)Suresh Antre
 
Mitochondrial genome
Mitochondrial genomeMitochondrial genome
Mitochondrial genomenaren
 
in vitrogermplasm conservation
 in vitrogermplasm conservation in vitrogermplasm conservation
in vitrogermplasm conservationKalpataru Nanda
 
Distant hybridization
Distant hybridizationDistant hybridization
Distant hybridizationPawan Nagar
 
Genome editing tools in plants
Genome editing tools in plantsGenome editing tools in plants
Genome editing tools in plantsSAIMA BARKI
 
Plant nuclear genome organization
Plant  nuclear genome organizationPlant  nuclear genome organization
Plant nuclear genome organizationvijayakumars66
 
Plant Epigenetics in crop Improvement
Plant Epigenetics in crop Improvement Plant Epigenetics in crop Improvement
Plant Epigenetics in crop Improvement sukruthaa
 
Apomixis and its application for crop improvement.
Apomixis and its application for crop improvement.Apomixis and its application for crop improvement.
Apomixis and its application for crop improvement.Pawan Nagar
 

What's hot (20)

Cytoplasmic male sterility
Cytoplasmic male sterilityCytoplasmic male sterility
Cytoplasmic male sterility
 
Mapping the bacteriophage genome
Mapping the bacteriophage genomeMapping the bacteriophage genome
Mapping the bacteriophage genome
 
Deveopment of embryo in monocot and dicot
Deveopment of embryo in monocot and dicotDeveopment of embryo in monocot and dicot
Deveopment of embryo in monocot and dicot
 
Techniques of Germplasm Conservation
Techniques of Germplasm ConservationTechniques of Germplasm Conservation
Techniques of Germplasm Conservation
 
Embryogenesis
EmbryogenesisEmbryogenesis
Embryogenesis
 
Transition o of flowering plants
Transition o of flowering plants Transition o of flowering plants
Transition o of flowering plants
 
Extra chromosomal inheritance
Extra chromosomal inheritanceExtra chromosomal inheritance
Extra chromosomal inheritance
 
Male sterility
Male sterilityMale sterility
Male sterility
 
RNA Interference (RNAi)
RNA Interference (RNAi)RNA Interference (RNAi)
RNA Interference (RNAi)
 
Mitochondrial genome
Mitochondrial genomeMitochondrial genome
Mitochondrial genome
 
in vitrogermplasm conservation
 in vitrogermplasm conservation in vitrogermplasm conservation
in vitrogermplasm conservation
 
Distant hybridization
Distant hybridizationDistant hybridization
Distant hybridization
 
Genome editing tools in plants
Genome editing tools in plantsGenome editing tools in plants
Genome editing tools in plants
 
Plant nuclear genome organization
Plant  nuclear genome organizationPlant  nuclear genome organization
Plant nuclear genome organization
 
Chloroplast genome organisation
Chloroplast genome organisationChloroplast genome organisation
Chloroplast genome organisation
 
Taxonomy a synthetic science
Taxonomy a synthetic scienceTaxonomy a synthetic science
Taxonomy a synthetic science
 
Qtl mapping
 Qtl mapping  Qtl mapping
Qtl mapping
 
Plant Epigenetics in crop Improvement
Plant Epigenetics in crop Improvement Plant Epigenetics in crop Improvement
Plant Epigenetics in crop Improvement
 
Apomixis and its application for crop improvement.
Apomixis and its application for crop improvement.Apomixis and its application for crop improvement.
Apomixis and its application for crop improvement.
 
Collection, evaluation and documentation of germplasm
Collection, evaluation and documentation of germplasmCollection, evaluation and documentation of germplasm
Collection, evaluation and documentation of germplasm
 

Viewers also liked

Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Pat (JS) Heslop-Harrison
 
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013Pat (JS) Heslop-Harrison
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Pat (JS) Heslop-Harrison
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Fruit And Veg Assembly
Fruit And Veg AssemblyFruit And Veg Assembly
Fruit And Veg AssemblyNitin Kumar
 
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...CIMMYT
 
Introduction to In situ pcr
Introduction to In situ pcrIntroduction to In situ pcr
Introduction to In situ pcrBioGenex
 
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaChromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaPat (JS) Heslop-Harrison
 
Exploiting Wheat’s Distant Relatives
Exploiting Wheat’s Distant RelativesExploiting Wheat’s Distant Relatives
Exploiting Wheat’s Distant RelativesCIMMYT
 
TRANSPOSABLE ELEMENTS
TRANSPOSABLE   ELEMENTSTRANSPOSABLE   ELEMENTS
TRANSPOSABLE ELEMENTSseetugulia
 
Banana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIBanana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIPat (JS) Heslop-Harrison
 
All about wheat
All about wheat All about wheat
All about wheat sonam786
 
Chromosomes and meiosis
Chromosomes and meiosisChromosomes and meiosis
Chromosomes and meiosisSian Ferguson
 
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-Harrison
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-HarrisonDomestication, polyploidy and genomics of crops #PAGXXV Heslop-Harrison
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-HarrisonPat (JS) Heslop-Harrison
 
Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)BioGenex
 

Viewers also liked (20)

Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
 
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
 
Fruit And Veg Assembly
Fruit And Veg AssemblyFruit And Veg Assembly
Fruit And Veg Assembly
 
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...
Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene...
 
Zhang Zhengbin — Wheat evolution under climate chang warming
Zhang Zhengbin — Wheat evolution under climate chang warmingZhang Zhengbin — Wheat evolution under climate chang warming
Zhang Zhengbin — Wheat evolution under climate chang warming
 
Introduction to In situ pcr
Introduction to In situ pcrIntroduction to In situ pcr
Introduction to In situ pcr
 
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison MalaysiaChromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
 
Monosomics
MonosomicsMonosomics
Monosomics
 
Exploiting Wheat’s Distant Relatives
Exploiting Wheat’s Distant RelativesExploiting Wheat’s Distant Relatives
Exploiting Wheat’s Distant Relatives
 
TRANSPOSABLE ELEMENTS
TRANSPOSABLE   ELEMENTSTRANSPOSABLE   ELEMENTS
TRANSPOSABLE ELEMENTS
 
Banana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIIIBanana Transposable Elements: The hAT DNA element story PAGXXIII
Banana Transposable Elements: The hAT DNA element story PAGXXIII
 
All about wheat
All about wheat All about wheat
All about wheat
 
Chromosomes and meiosis
Chromosomes and meiosisChromosomes and meiosis
Chromosomes and meiosis
 
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-Harrison
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-HarrisonDomestication, polyploidy and genomics of crops #PAGXXV Heslop-Harrison
Domestication, polyploidy and genomics of crops #PAGXXV Heslop-Harrison
 
Wheat
WheatWheat
Wheat
 
Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)
 

Similar to Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication

In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherPat (JS) Heslop-Harrison
 
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PragueGenome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PraguePat (JS) Heslop-Harrison
 
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...Pat (JS) Heslop-Harrison
 
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Pat (JS) Heslop-Harrison
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiPat (JS) Heslop-Harrison
 
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Trinidad Mendez
 
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Pat (JS) Heslop-Harrison
 
Long-term balancing selection in a white-rot fungi
Long-term balancing selection in a white-rotfungiLong-term balancing selection in a white-rotfungi
Long-term balancing selection in a white-rot fungiDavid Peris Navarro
 
Haploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome eliminationHaploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome eliminationIARI, New Delhi
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarPat (JS) Heslop-Harrison
 
Dissecting quantitative variation introgressed into bermudagrass and Upland c...
Dissecting quantitative variation introgressed into bermudagrass and Upland c...Dissecting quantitative variation introgressed into bermudagrass and Upland c...
Dissecting quantitative variation introgressed into bermudagrass and Upland c...Sameer Khanal
 
Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...CIAT
 
plastome engineering
plastome engineeringplastome engineering
plastome engineeringKanchan Rawat
 
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...Arvinder Singh
 
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...ExternalEvents
 
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...CGIAR Generation Challenge Programme
 

Similar to Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication (20)

In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude Schwarzacher
 
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC PragueGenome Evolution Chromosomes Heslop-Harrison ICC Prague
Genome Evolution Chromosomes Heslop-Harrison ICC Prague
 
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...
 
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
 
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
 
Heslopharrisonassisiweb
HeslopharrisonassisiwebHeslopharrisonassisiweb
Heslopharrisonassisiweb
 
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
 
Long-term balancing selection in a white-rot fungi
Long-term balancing selection in a white-rotfungiLong-term balancing selection in a white-rotfungi
Long-term balancing selection in a white-rot fungi
 
Haploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome eliminationHaploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome elimination
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
 
Dissecting quantitative variation introgressed into bermudagrass and Upland c...
Dissecting quantitative variation introgressed into bermudagrass and Upland c...Dissecting quantitative variation introgressed into bermudagrass and Upland c...
Dissecting quantitative variation introgressed into bermudagrass and Upland c...
 
Chromosomes cymbidoidae
Chromosomes cymbidoidaeChromosomes cymbidoidae
Chromosomes cymbidoidae
 
HeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptxHeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptx
 
Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...Learning from the pathogen towards tailored-sustainable resistance : the case...
Learning from the pathogen towards tailored-sustainable resistance : the case...
 
plastome engineering
plastome engineeringplastome engineering
plastome engineering
 
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...
 
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
 
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
 
Haploid
HaploidHaploid
Haploid
 

More from Pat (JS) Heslop-Harrison

Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomePat (JS) Heslop-Harrison
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitlePat (JS) Heslop-Harrison
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Pat (JS) Heslop-Harrison
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Pat (JS) Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsPat (JS) Heslop-Harrison
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecturePat (JS) Heslop-Harrison
 
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Pat (JS) Heslop-Harrison
 
Superdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsSuperdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsPat (JS) Heslop-Harrison
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkPat (JS) Heslop-Harrison
 
Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Pat (JS) Heslop-Harrison
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Pat (JS) Heslop-Harrison
 

More from Pat (JS) Heslop-Harrison (13)

Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenome
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecture
 
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
 
Superdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing cropsSuperdomestication, feed-forward breeding and climate proofing crops
Superdomestication, feed-forward breeding and climate proofing crops
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
 
Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
 

Recently uploaded

Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdfQucHHunhnh
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introductionMaksud Ahmed
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfciinovamais
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAssociation for Project Management
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphThiyagu K
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin ClassesCeline George
 

Recently uploaded (20)

INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across Sectors
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
 

Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication

  • 1. Chromosomes, Crops and Superdomestication in Katowice Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com UserID/PW ‘visitor’ Pathh1: Twitter #PMC . Slideshare pathh1
  • 2. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 3. How do genomes evolve? –Gene mutation Genome very rarely evolution (human: 10−8/site/generation) –Chromosome evolution –Polyploidy and genome duplication (ancient & modern) –Repetitive sequences: mobility & copy number (10−4/generation in μsat) –Recombination –Epigenetic aspects: centromeres & expression
  • 4. How do genomes evolve? – Gene mutation Genome very rarely evolution – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences: mobility & copy number – Recombination – Epigenetic aspects – centromeres & expression How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome and genome engineering – Breeding – Markers
  • 5.
  • 6. Musa biodiversity and genomes: x=11 Red - AAA 2n=3x=33 – M. acuminata Palayam codan AAB (two bunch yellow, one green) Musa x Peyan ABB (green cooking banana) Njalipoovan AB (yellow) 2n=2x=22 M. acuminata x M. balbisiana Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Varkala, Kerala, India Peyan ABB
  • 7.
  • 8. Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
  • 9. Retroelements Sequences which amplify through an RNA intermediate • 50% of all the DNA!
  • 10. Retroelements BAC sequences from Musa Calcutta 4 Homologous over the full length except for a 5kb insert • a Ty1-copia retroelement
  • 11. Alignment of two homologous Musa BACs shows gaps in both B genome M. balbisiana and A genome M. acuminata MA4_82I11 MBP_81C12 MuhAT 1 XX TE MITE XX TE (SINGLE) MuhAT2 a XX TE (AGNABI) MuhAT3 MuhAT4 MITE(MBIR ) XX TE XX TE (MBT) 272 bp 102,190 bp 26, 410 bp 128,068 bp DNA transposons hAT are particularly frequent 8 bp TSD, and short TIRs of 5–27 bp transposase (sometimes degenerate) including a DDE site. Non-autonomous (MITE) derivatives of hAT with deletion coding sequence Menzel, Schmidt, Nouroz, HH Chr Res subject minor revision 2015
  • 12. Musa balbisiana (MBP 81C12) Musa acuminata (MA4 82I11) hAT 1 1676 TE 384 bp TE + 781 MITE Transposed Element Sr. No. Primer Pairs Product Size (bp) Microsatellite (AT) 621 bp MBT Sequence 1. hAT18486 hAT19037 hAT 2 hAT 3 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC 4192 bp TE hAT 4 Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 23/09/2014 12
  • 13. Musa balbisiana (MBP 81C12) Musa acuminata (MA4 82I11) hAT 1 1676 TE 384 bp TE + 781 MITE Transposed Element Sr. No. Primer Pairs Product Size (bp) Microsatellite (AT) 621 bp MBT Sequence 1. hAT18486 hAT19037 hAT 2 hAT 3 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC 4192 bp TE hAT 4 Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 23/09/2014 13
  • 14. A-genome specific hAT in three Musa accessions (2n=3x=33) Musa ‘Williams Cavendish’ (AAA) Musa (ABB) Musa (ABB)
  • 15. 23/09/2014 15 Dot plot showing the complete Inverted repeat.
  • 16. HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 23/09/2014 16 1KB 800 600 400 200 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element Lower bands amplifying the flanking sequences only Menzel, Nouroz, Heslop-Harrison, Schmidt 2014
  • 17. Retroelement Markers LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR Insertion IRAP – InterRetroelement PCR LTR Retrotransposon LTR LTR Retrotransposon LTR
  • 18. IRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
  • 19. Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al. 23/09/2014 19
  • 20. BSV Expression in Banana Double stranded DNA is infective: Insect vector Unexpected epidemiology: Appearance after cold or tissue culture
  • 21. Nuclear Copies of Banana Streak Virus in Banana
  • 22. Nuclear Copies of BSV in banana DNA Fibre in situ hybridization Harper, HH et al., Virology 1999 … cf D’Hont et al., Nature, 2012
  • 23. Whole genome shotgun sequencing • Changing all cytogenomics (.org) work • Easily obtaining several-fold sequence coverage
  • 24. D’Hont et al. Nature 2012 doi:10.1038/nature 11241
  • 25. Musa Banana n=11 Sequence: D’Hont, inc HH et al. Nature 2012 Haploid: Nair, HH 2013
  • 26.
  • 27. Whole genome duplications • The surprise to the sequencers: conserved synteny and relatively few breakpoints • The surprise to the cytogeneticists: sequencing shows whole genome duplications (=polyploidy) deep in the phylogenetic tree • The surprise to everyone: so few genes but multifunctional
  • 28. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 29.
  • 30. Brachiaria LTR element families Fabíola Carvalho Santos André Luiz Laforga Vanzela See poster Forage/pasture Urban Savanna/cerrado Forest Sugar cane Soybean/corn Brazil land use
  • 31. Some probes show less hybridization to some chromosomes, perhaps indicating genome specificity. Fabíola Carvalho Santos André Luiz Laforga Vanzela See poster
  • 32. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 33. Wheat evolution and hybrids Triticum uratu 2n=2x=14 AA Aegilops speltoides Triticum dicoccoides Einkorn 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Bread wheat Triticum aestivum 2n=6x=42 AABBDD Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB relative 2n=2x=14 BB Triticum tauschii (Aegilops squarrosa) 2n=2x=14 DD Triticale xTriticosecale 2n=6x=42 AABBRR Rye Secale cereale 2n=2x=14 RR
  • 34. Copyright restrictions may apply. Inter-retroelement (IRAP) analysis of Triticum tauschii ssp tauschii from Iran SSR/Microsats: all are different and no tree is supported Different sequence classes evolve at different rates Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
  • 35. Crop standing Lodging in cereals Crop fallen
  • 36. Use of repetitive DNA sequences as chromosome markers
  • 37. Inheritance of Chromosome 5D Aegilops ventricosa DDNN dpTa1 pSc119.2 Genomic Ae.ventricosa ABDN Triticum persicum Ac.1510 AABB AABBDDNN Marne AABBDD VPM1 Dwarf A CWW1176-4 Rendezvous Piko Virtue 96ST61 × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)}
  • 38. Wheat Streak Mosaic Virus in North America Bob Graybosch, USDA
  • 39. Wsm-1: only highly effective source of resistance to WSMV
  • 40. Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
  • 41. Chromosome evolution - Polyploidy • Selected natural – Wheat – Banana – Brachiaria – Proso millet • Synthetic – Triticale – Nicotiana
  • 42. Proso millet (Panicum miliaceum): origins, genomic studies and prospects Pat Heslop-Harrison, Farah Badakshi and Harriet Hunt
  • 43. Panicum sensu stricto c. 100 species; x=9 Evolution of Panicum miliaceum Proso millet P. virgatum 2n=4x=36 or 2x=18 ? ? ? ? ? ? P. miliaceum 2n=4x=36 P. capillare 2n=2x=18 P. repens 2n=4x=36 also 2n=18 to 54 P. sumatrense 2n=2x=18 or 4x=36 Global North-temperate Low genetic diverstiy Weedy forms • Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. 2014
  • 44.
  • 45. • P. miliaceum: allotetraploid with maternal ancestor P. capillare and one genome shared with P. repens (also allotetraploid)  Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. March 2014
  • 46. Chromosome and genome engineering Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Davey et al 2011 Annals of Botany
  • 47. Nicotiana hybrid 4x + 4x cell fusions Each of 4 chromosome sets has distinctive repetitive DNA when probed with genomic DNA Patel et al Ann Bot 2011 Cell fusion hybrid of two 4x tetraploid tobacco species Four genomes differentially labelled Patel, Badakshi, HH, Davey et al 2011 Annals Botany
  • 48. Arachis hypogaea - Peanut Tetraploid of recent origin, ancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals Botany 2013
  • 49. •Arachis hypogea 2n=4x=40 probed with •(green) A. duranensis; (red) A. ipaënsis  Bertioli et al. Annals of Botany 2013
  • 50. BAC in situ hybridization
  • 51.
  • 52. Primula BAC mapping Gilmartin, Lu, HH & Badakshi 2015?
  • 53. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa) DAPI metaphase blue Radish genomic red (2 radish chromosomes) far-red 45S rDNA Rfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica Tarja Niemelä, Seppänen, Badakshi, Rokka HH Chromosome Research 2012
  • 54. BACs from different species have different repeat distributions – and hence different patterns of hybridization
  • 55. Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacteriumor other vectors Transgenes introduced with molecular biology methods Genes, regulatory and non-coding single copy sequences Dispersed repeats: Transposable Elements Repetitive DNA sequences Nuclear Genome Tandem repeats DNA transposons copied and moved via DNA Retrotransposons amplifying via an RNA intermediate Centromeric repeats Structural components of chromosomes Telomeric repeats Repeated genes Simple sequence repeats or microsatellites Subtelomeric repeats 45S and 5S rRNA genes Blocks of tandem repeats at discrete chromosomal loci DNA sequence components of the nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences Other genes
  • 56. MuTRR 180 bp X MuTRR MuTRF MuTRF 220 bp Monkey retroelement • The original 177bp repeat fits nicely around the nucleosome allowing a tight coiling • The repeat unit with the retroelement foot print, the 63bp box, has a much more open configuration • It is maintained as it brings a CG and CNG site that allows control via methylation Insertion and subsequent loss C.H Teo and Schwarzacher
  • 57. A B C DNA sequence Centromere TE Tandem repeat monomer TE Transposable element Single copy DNA Metaphase chromosome Spindle microtubules pulling apart chromatids 147bp plus 5-70bp linker = 150-220bp 100bp plus 55bp linker = 155bp D E F G H I Kinetochore Henikoff et al 2013 C: antibody to CENH3 variant Heslop-Harrison & Schwarzacher 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://wp.me/p2Ewqp-7h
  • 58. Domestication • Most species domesticated 10,000 years ago: cereals, legumes/pulses, brassicas, fruits, cows/sheep/pigs, silkworm/bees) • Few species more recently (rabbits, fish; trees, biofuel crops) • A few dropped out of production • First steps: productive, reproduce easily, disease-free, edible/tasty, harvestable … Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom
  • 59. Domestication • … • A few dropped out of production • Second steps: more productive, harvestable • Third step: fitting for sustainable intensification • Proso millet: the most water-efficient cereal • Superdomestication and design of crops Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom www.tinyurl.com/superdom
  • 60. Outputs –CROPS – Fixed energy Inputs –Light –Heat –Water –Gasses –Nutrients –Light –Heat –Water –Gasses –Nutrients (Ecosystem services)
  • 61. Conventional Breeding • Cross the best with the best and hope for something better Superdomestication • Decide what is wanted and then plan how to get it – Variety crosses – Mutations – Hybrids (sexual or cell-fusion) – Genepool – Transformation
  • 62. Economic growth • Separate into increases in inputs (resources, labour and capital) and technical progress • 90% of the growth in US output per worker is attributable to technical progress Robert Solow – Economist
  • 63. 1.2E+09 1E+09 800000000 600000000 Agronomy 400000000 200000000 0 52 years of plant breeding progress GM maize Maize Rice, paddy Wheat Population /10 Genetics 1961 1970 1980 1990 2000 2010 2013
  • 64. United Nations Millennium Development Goals-MDGs 1990 to 2015 • Goal 1 – Eradicate extreme poverty and hunger • Goal 2 – Achieve universal primary education • Goal 3 – Promote gender equity and empower women • Goal 4 – Reduce child mortality • Goal 5 – Improve maternal health • Goal 6- Combat HIV/AIDS, malaria and other diseases • Goal 7 - Ensure environmental sustainability • Goal 8 - Develop a global partnership for development
  • 65. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 66. How do genomes evolve? – Gene mutation Genome very rarely evolution – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences: mobility & copy number – Recombination – Epigenetic aspects – centromeres & expression How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome and genome engineering – Breeding – Markers Pat Heslop-Harrison & Trude Schwarzacher www.molcyt.com Pathh1 on slideshare
  • 67. Chromosomes, Crops and Superdomestication in Katowice Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com UserID/PW ‘visitor’ Pathh1: Twitter #PMC . Slideshare pathh1
  • 68. Major Genomic Components • Tandem Repeats • Simple Sequence Repeats • Dispersed Repeats • Functional Repeats • Retroelements • Genes Typical Fraction 10% 5% 10% 15% 50% 10%
  • 69.
  • 70. A D’Hont et al. Nature 2012 doi:10.1038/na ture11241 Whole-genome duplication events.
  • 72.
  • 73. Differences between genomes Major differences in the nature and amount of repetitive DNA • 45S rDNA • dpTa1 tandem repeat
  • 74. 146 bp around histones
  • 75. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 76. • Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC content of the sequence and (red, smooth line) sequence curvature. While GC and AT rich regions of a sequence generally correlate with curvature, the kinked region shows curvature with low GC content.
  • 77. • How do genomes evolve? • How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome engineering – Markers
  • 78. Genome engineering • Introgression of chromosomes – Brassica – Raphanus – Wheat – Thinopyrum
  • 80. UK Wheat 1948-2007 52,909 data points, 308 varieties From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from the past and opportunities for the future. SCRI website.
  • 81. Rules for successful domestication • There aren’t any! • Crops come from anywhere (new/old world; temperate/tropical; dry/humid) • They might be grown worldwide • Polyploids and diploids (big genomes-small genomes, many chromosomes-few chromosomes) • Seeds, stems, tubers, fruits, leaves
  • 82. DNA methylation is unevenly distributed on 10 m Musa chromosomes copia elements in methylated regions, but also in some low methylated regions (arrows) 5MeC
  • 83. DNA methylation is unevenly distributed on 10 m C.H Teo and Schwarzacher Musa chromosomes 5MeC gypsy elements in methylated regions, but also in some low methylated regions (arrows) Teo & Schwarzacher in prep 2013
  • 84. Genome evolution • How do genomes evolve? – Mutation very rarely (human: 10−8/site/generation) – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences – mobility & copy number (10−4 μsat) – Recombination – Epigenetic aspects – centromeres & expression • How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome engineering – Breeding – Markers
  • 85. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 85
  • 86. The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool Molecular cytogenetics …
  • 87. How to use diversity • Cross two varieties • Genome manipulations • Cross two species and make a new one • Cell fusion hybrids • Chromosome manipulation • Backcross a new species • Generate recombinants • Chromosome recombinations • Transgenic approaches • Use a new species
  • 88. Nothing special about crop genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Rapeseed B. napus 1125 Mbp 38 4 Cotyledon oil/protein Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Soybean 1,100 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 2 Fruit mesocarp Banana 500 Mbp 33 3 Fruit mesocarp Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B978- 0-12-381466-1.00001-8 Tinyurl.com/domest
  • 89. DNA sequence Centromere TE Tandem repeat monomer TE Transposable element Single copy DNA Metaphase chromosome Spindle microtubules pulling apart chromatids 147bp plus 5-70bp linker = 150-220bp Kinetochore Heslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013)
  • 91. EvolutionEpigeneticsDevelopment Phenotype Multiple abnormalities Genetic changes non-reverting Changes seen, some reverting (Male/Female) Normal Differentiation Cause Chromosomal loss, deletion or translocation Gene mutation / base pair changes Telomere shortening (Retro)transposon insertion Retrotransposon activation SSR expansion Methylation Heterochromatinization Chromatin remodelling Histone modification
  • 92. Outputs –CROPS – Fixed energy Inputs –Light –Heat –Water –Gasses –Nutrients
  • 93. Outputs –CROPS – Fixed energy 93 Inputs –Light –Heat –Water –Gasses –Nutrients – Light – Heat – Water – Gasses – Nutrients