Pat Heslop-Harrison [email_address] www.molcyt.com  pw/user: ‘visitor’ Pathh1 on Twitter and AoBBlog.com
 
Genome evolution: generating biodiversity repetitive DNA  –  fast & slow evolution  engineering  –  chromosomes & genomes ...
Agronomy & Nitrogen Genetics Transgenic Bt insect-resistant maize (& herbicide tolerant)
 
<ul><li>Finding  genes, controlling expression: using biodiversity </li></ul><ul><li>Recombining genes </li></ul><ul><li>C...
Darwin 1859 The only figure in  “ The Origin of Species”
Common Ancestor 2n=2x=14 Aegilops ventricosa 2n=4x=28 DDNN Triticum tauschii 2n=2x=14 DD Triticum aestivum 2n=6x=42 AABBDD...
 
 
 
 
 
Wheat 150 Mbp  17000 Mbp (x113 Arab.) 3300 Mbp (x22  Arabidopsis ) 1 mid-sized  human chromosome  =  Arabidopsis  genome 4...
Wheat <ul><li>Repetitive DNA is a major part of the genome </li></ul><ul><li>Localised sites – often tandem repeats </li><...
<ul><li>Where each arrow  is a single repeat unit </li></ul><ul><li>- often a multiple of 180 bp but up to 10kb long </li>...
 
Triticum aestivum   2n=6x=42 DAPI  pSc119.2  dpTa1 High copy number – low diversity in each of 3 genomes
 
dpTa1 pSc119.2 Genomic  Ae.ventricosa Inheritance of Chromosome 5D Aegilops ventricosa DDNN ABDN AABBDDNN Marne AABBDD CWW...
Correlation between genetic relationships and similarity of dpTa1 hybridization 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 0....
<ul><li>Eyespot (fungus  Pseudocercosporella ) resistance from  Aegilops ventricosa  introduced to wheat by chromosome eng...
Crop standing Lodging in cereals Crop fallen
ancestral Low-copy number High-copy number Low-copy number High-copy number Low-copy number High-copy number High copy spp...
Arabidopsis  species – species specific 178bp tandem repeat motif HH et al.  Chromosome Research  2003
2n = 26 10 from  A. thaliana  2n=2x=10 16 from  A. arenosa  2n=2x=16 Kamm, HH et al .
S.vav42!248 Afacer1 T.mono106/42!133pt1 T.mono106/42!155pt1 Ae.umb106/208!1911 Ae.umb106/208!1810 Ae.umb106/208!2012 S.vav...
119 repeats: showing homogenization and amplification High copy species Low copy species Drosophila: Kuhn, HH et al. 2009/...
<ul><li>Mutation </li></ul><ul><li>Rearrangement </li></ul><ul><li>Duplication </li></ul><ul><li>Deletion </li></ul><ul><l...
<ul><li>Arachis hypogaea  – 2n=4x=40 </li></ul><ul><li>In situ  hybridization of two BACs including repeats </li></ul><ul>...
 
Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Davey et al 2011 Annals of Botany
 
Hybrids involving 2 genomes A and B, diploid and triploid but all sterile   Red  AAA  Palayam codan AAB (two bunch yellow,...
 
 
www.crocusbank.org Saffron Diversity and Origins
<ul><li>From  C. cartwrightianus  by autotriploidy </li></ul><ul><li>C. cartwrightianus  crossed with a related species in...
Crocus sativus  Pachytene DAPI
Late Pachytene Crocus sativus Anti-ASY-1 associates with the lateral element (antibody from Arabidopsis, Chris Franklin la...
<ul><li>Current  commercial varieties </li></ul><ul><li>Wild collections </li></ul><ul><ul><li>Landraces </li></ul></ul><u...
Wsm-1: only highly effective source of resistance to WSMV
Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
 
C Figure 5:  Root tip metaphase (A, B and D) and meiotic prophase (C) chromosomes after FISH and immunostaining with antib...
Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
<ul><li>… </li></ul><ul><li>Dotplot comparisons at scale of 10,000s bp </li></ul><ul><li>Two  Musa  chromosomes are >95% h...
Brassica rapa (AA) Brassica nigra  (BB) Brassica juncea (AABB) Brassica napus (AACC) Brassica carinata (BBCC) Brassica ole...
B. napus  (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18)  B. rapa (AA, 2n=2x=20)...
Alix, HH et al Plant J 2008
01/10/11 Dotter plot of  Brassica oleracea  var. alboglabra clone BoB028L01 x  Brassica rapa  subsp. pekinensis clone KBrB...
 
9-bp TSD (TATCCTATT) 6-bp TIR and 66-bp imperfect sub-TIR  551-bp BART1 TE TSD   TIR TIR   TSD 01/10/11 TATCCTATT G C G C ...
Brassica rapa (AA) Brassica nigra  (BB) Brassica juncea (AABB) Brassica napus (AACC) Brassica carinata (BBCC) Brassica ole...
700 bp hAT Microsatellite 715 bp hAT 1016 bp in LINE 258 MITE 402 bp hAT 237 bp Mariner Like Inversion 914 bp LINE 2781 bp...
DAPI   O. violaceus  genomic DNA DAPI Xianhong Ge, Farah  Badakshi, Heslop-Harrison and Schwarzacher 2012
Zyp1   Asy-1   O.violaceus Run 16 slide 5/7 Alien chromosome  is partly unpaired  and   partly paired with  Brassica  chro...
<ul><li>Finding  genes, controlling expression: using biodiversity </li></ul><ul><li>Recombining genes </li></ul><ul><li>C...
<ul><li>How many genes are there? </li></ul><ul><li>1990s: perhaps 100,000 in human </li></ul><ul><li>2000: 25,000 </li></...
Susanne Barth, Ulrike Anhalt, Celine Tomaszewski
<ul><li>Anhalt, Barth, HH  </li></ul><ul><li>2009 </li></ul><ul><li>Formidable genetic and environmental interactions </li...
Anhalt UCM, Heslop-Harrison JS, Piepho HP, Byrne S, Barth S. 2009.  Quantitative trait loci mapping for biomass yield trai...
Kim, HH, Cho et al. 2011 Science Signaling Circadian Clock regulation after Leloup & Goldbeter  cf Andrew Millar in Arabid...
<ul><li>Synchronization without external regulators </li></ul>
Live version: YouTube – pathh1 channel phaseportrait.avi
 
Heslop-Harrison 2012. www.tinyurl.com/domest Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mb...
United Nations  Millennium Development Goals  -  MDGs   <ul><li>Goal 1 – Eradicate extreme poverty and hunger  </li></ul><...
 
Pat Heslop-Harrison [email_address] www.molcyt.com  pw/user: ‘visitor’ and  AoBBlog.com
<ul><li>Mutation </li></ul><ul><li>Rearrangement </li></ul><ul><li>Duplication </li></ul><ul><li>Deletion </li></ul><ul><l...
Many of the repetitive sequences are retrotransposons and DNA transposons Some are microsatellite motifs Some are satellit...
Pat Heslop-Harrison phh4@le.ac.uk  Twitter: pathh1 www.molcyt.com  pw/user: ‘visitor’
<ul><li>Gypsy  elements are present in 25% of all BAC clones  </li></ul>Barley gypsy: Vershinin, Druka, Kleinhofs, HH: Pla...
Schematic representation of insertion   in Brassica rapa and other Brassica genomes. Green, red, blue and black boxes show...
<ul><li>Stochastic fluctuations </li></ul><ul><ul><li>preserve stable oscillations </li></ul></ul><ul><ul><li>ensure robus...
Jeong-Rae Kim, HH & Kwang-Hyun Cho. J Cell Sci 2010
 
<ul><li>Higher yielding </li></ul><ul><li>Disease-resistance </li></ul><ul><li>Well-adapted </li></ul><ul><li>Better nutri...
 
<ul><li>Tandem Repeats </li></ul><ul><li>Simple Sequence Repeats </li></ul><ul><li>Dispersed Repeats </li></ul><ul><li>Fun...
 
Upcoming SlideShare
Loading in …5
×

Heslopharrisonassisiweb

949 views

Published on

Molecular cytogenetics and plant breeding
(c) all rights reserved

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
949
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
183
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com 18
  • Trude Schwarzacher schwarzacher.com 20
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Do not forget variation in breeding programmes, wheat, also the trees in the backgound In the modules we are not interested in the morphology that describes species, but the genome, so the question is
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Trude Schwarzacher schwarzacher.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Heslopharrisonassisiweb

    1. 1. Pat Heslop-Harrison [email_address] www.molcyt.com pw/user: ‘visitor’ Pathh1 on Twitter and AoBBlog.com
    2. 3. Genome evolution: generating biodiversity repetitive DNA – fast & slow evolution engineering – chromosomes & genomes systems understanding new crops
    3. 4. Agronomy & Nitrogen Genetics Transgenic Bt insect-resistant maize (& herbicide tolerant)
    4. 6. <ul><li>Finding genes, controlling expression: using biodiversity </li></ul><ul><li>Recombining genes </li></ul><ul><li>Combining genomes </li></ul><ul><li>Chromosome engineering </li></ul><ul><li>Understanding </li></ul>
    5. 7. Darwin 1859 The only figure in “ The Origin of Species”
    6. 8. Common Ancestor 2n=2x=14 Aegilops ventricosa 2n=4x=28 DDNN Triticum tauschii 2n=2x=14 DD Triticum aestivum 2n=6x=42 AABBDD Triticum durum 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Aegilops sp. 2n=2x=14 BB Aegilops uniaristata 2n=2x=14 NN Aegilops 2n=2x=14 Triticum 2n=2x=14
    7. 14. Wheat 150 Mbp 17000 Mbp (x113 Arab.) 3300 Mbp (x22 Arabidopsis ) 1 mid-sized human chromosome = Arabidopsis genome 4 average wheat chromosomes = Human genome
    8. 15. Wheat <ul><li>Repetitive DNA is a major part of the genome </li></ul><ul><li>Localised sites – often tandem repeats </li></ul><ul><li>Dispersed widely – often transposable elements </li></ul><ul><li>Different families of these repeats have different evolutionary histories and consequences </li></ul><ul><li>Molecular cytogenetics, comparative genomics and sequence-based studies of species and hybrids show </li></ul><ul><li>- evolution of these sequences </li></ul><ul><li>tracks chromosomes through evolution </li></ul><ul><li>helps genome and chromosome engineering </li></ul>
    9. 16. <ul><li>Where each arrow is a single repeat unit </li></ul><ul><li>- often a multiple of 180 bp but up to 10kb long </li></ul><ul><li>Head-to-tail organization </li></ul><ul><li>CGACTAGT CGACTAGT CGACTAGT G GACTAGT CGACTAGT CGACTAGT </li></ul>Crocus spp Probed pCvKB8 Frello, HH 2004.
    10. 18. Triticum aestivum 2n=6x=42 DAPI pSc119.2 dpTa1 High copy number – low diversity in each of 3 genomes
    11. 20. dpTa1 pSc119.2 Genomic Ae.ventricosa Inheritance of Chromosome 5D Aegilops ventricosa DDNN ABDN AABBDDNN Marne AABBDD CWW1176-4 Rendezvous Piko VPM1 Dwarf A 96ST61 Virtue × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)} Triticum persicum Ac.1510 AABB
    12. 21. Correlation between genetic relationships and similarity of dpTa1 hybridization 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 Coefficient of parentage Proportion of chromosome arms with identical in situ signal
    13. 22. <ul><li>Eyespot (fungus Pseudocercosporella ) resistance from Aegilops ventricosa introduced to wheat by chromosome engineering </li></ul><ul><li>Many diseases where all wheat varieties are highly susceptible </li></ul>
    14. 23. Crop standing Lodging in cereals Crop fallen
    15. 24. ancestral Low-copy number High-copy number Low-copy number High-copy number Low-copy number High-copy number High copy spp: homogenized, amplification from a limited number of master copies Low copy spp: much variation Schwarzacher, Contento & HH 2009
    16. 25. Arabidopsis species – species specific 178bp tandem repeat motif HH et al. Chromosome Research 2003
    17. 26. 2n = 26 10 from A. thaliana 2n=2x=10 16 from A. arenosa 2n=2x=16 Kamm, HH et al .
    18. 27. S.vav42!248 Afacer1 T.mono106/42!133pt1 T.mono106/42!155pt1 Ae.umb106/208!1911 Ae.umb106/208!1810 Ae.umb106/208!2012 S.vav147!259pt1 Pet w 25/208!088 Pet w 25/208!077 S.vav106/208!215pt1 S.vav106/208!204pt2 S.vav106/208!215pt2 S.vav25/208!182 S.mon42!136 Pet 22594 25/42!3324 Pet 22594 25/42!3425 CS/325/208!1820 S.vav25/208!193 T.tau25/147!2524pt2 CS/325/147!2322pt2 L.moll25/42!156 Pet w25/147!123 CS/325/208!1719 CS/325/147!2120 Pet w25/147!3231 Ae.umb25/147!124 Ae.umb25/208!168 L.moll25/42!167 119Repeat2 Pet w 25/208!099 S.mon147!1811 S.vav106/208!204pt1 119Repeat3 S.vav147!2711pt1 S.mon25/147!081 T.mono25/208!1212 S.vav42!237pt1 S.vav42!237pt2 T.tau25/147!2625 T.tau25/147!2726 Ae.umb25/208!157 T.tau25/208!1517 T.tau106/42!177 Ae.umb25/42!091 L.moll25/42!189 CS/325/208!1618 T.tau25/147!2524pt1 CS/325/147!2322pt1 Pet 22594 25/208!2325 Pet 22594 25/147!1918 Pet 22594 25/208!2426 T.tau25/208!1315 T.tau25/208!1416 Ae.umb25/147!135 Ae.umb25/147!146 Ae.umb25/208!179 915 120bp repeat unit family in Triticum , Aegilops and Secale species 119Repeat1 Homology between sequences 70-100% in Triticum/Aegilops and Secale species Contento, HH, Schwarzacher 2009 Pet 2259425!315 Colour blocks represent species High copy, High diversity T.tauschii (D genome) S. cereale (R genome)
    19. 28. 119 repeats: showing homogenization and amplification High copy species Low copy species Drosophila: Kuhn, HH et al. 2009/2011 Medicago: watch this space: Mondin et al.
    20. 29. <ul><li>Mutation </li></ul><ul><li>Rearrangement </li></ul><ul><li>Duplication </li></ul><ul><li>Deletion </li></ul><ul><li>Homogenization </li></ul><ul><li>Sequences </li></ul><ul><li>Genes / motifs </li></ul><ul><li>Repetitive DNA </li></ul><ul><li>Chromosomes </li></ul><ul><li>Chromosome sets (‘Genomes’) </li></ul><ul><li>Genotypes/CVs </li></ul><ul><li>Species </li></ul><ul><li>Genera and above </li></ul><ul><li>Crops / wild species </li></ul><ul><li>Selection </li></ul><ul><li>Speciation </li></ul>
    21. 30. <ul><li>Arachis hypogaea – 2n=4x=40 </li></ul><ul><li>In situ hybridization of two BACs including repeats </li></ul><ul><li>Contrasting distribution of their major repeat families </li></ul>Ana Claudia Guerra Araujo et al in prep 2011, EMBRAPA, Brazil
    22. 32. Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Davey et al 2011 Annals of Botany
    23. 34. Hybrids involving 2 genomes A and B, diploid and triploid but all sterile Red AAA Palayam codan AAB (two bunch yellow, one green) Peyan ABB (green cooking banana), Njalipoovan AB (yellow) Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Peyan Varkala, Kerala, India,
    24. 37. www.crocusbank.org Saffron Diversity and Origins
    25. 38. <ul><li>From C. cartwrightianus by autotriploidy </li></ul><ul><li>C. cartwrightianus crossed with a related species involving unreduced gamete </li></ul><ul><li>F1 hybrid between 2 species crossed with 3 rd species with an unreduced gamete </li></ul>1 2 3 1 2 3 1 2 3 John Bailey 5 III + 3 II + 3 I 8 III ?
    26. 39. Crocus sativus Pachytene DAPI
    27. 40. Late Pachytene Crocus sativus Anti-ASY-1 associates with the lateral element (antibody from Arabidopsis, Chris Franklin lab, Birmingham)
    28. 41. <ul><li>Current commercial varieties </li></ul><ul><li>Wild collections </li></ul><ul><ul><li>Landraces </li></ul></ul><ul><ul><li>Germplasm banks </li></ul></ul><ul><ul><li>Different populations </li></ul></ul><ul><ul><li>Individuals </li></ul></ul><ul><li>New diversity </li></ul><ul><ul><li>Hybridization </li></ul></ul><ul><ul><li>Cell fusion </li></ul></ul><ul><ul><li>Induced mutations </li></ul></ul><ul><ul><li>Tissue culture </li></ul></ul>How is diversity reflected in the genome?
    29. 42. Wsm-1: only highly effective source of resistance to WSMV
    30. 43. Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
    31. 45. C Figure 5: Root tip metaphase (A, B and D) and meiotic prophase (C) chromosomes after FISH and immunostaining with antibody against 5-methyl cytosine (5meC). The diploid D-genome ( Ae. tauschii ) chromosomes show heavy methylation (green) along all arms (A) including some, but not all, Afa/dpTA1 sites (red). In hexaploid wheat lines N02Y2016, N02Y5075 and ‘Millennium’ (B, C and D) more uneven methylation is observed with many centromeres showing less DNA methylation. At pachytene (C), DNA methylation levels (green) of the alien Th. intermedium arm (line N02Y5075, arrow, red) are similar to the average wheat chromatin, but notably the translocated Th. intermedium arms show low methylation in mitotic metaphase (arrows in B). The line ‘Millennium’ (D) has no alien chromatin, and most of its D-genome chromosomes (red) show DNA methylation levels (green) similar to the other wheat chromosomes. Afa/dpTa1 Anti 5 meC Ae. tauschii DNA Anti 5 meC Th. intermedium Anti 5 meC Th. intermedium DNA Anti 5 meC Niaz Ali, Trude Schwarzacher 2012
    32. 46. Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
    33. 47. <ul><li>… </li></ul><ul><li>Dotplot comparisons at scale of 10,000s bp </li></ul><ul><li>Two Musa chromosomes are >95% homologous with gaps </li></ul><ul><li>Faisal Nouroz 2012 </li></ul>
    34. 48. Brassica rapa (AA) Brassica nigra (BB) Brassica juncea (AABB) Brassica napus (AACC) Brassica carinata (BBCC) Brassica oleracea (CC) 2n=20 2n=36 2n=34 2n=16 2n=38 2n=18 The Brassica genus is monophyletic, from single common ancestor. What has changed in the DNA sequences?
    35. 49. B. napus (AACC, 2n=4x=38) – hybridized with C-genome CACTA element red B. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix et al. The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation. Plant Journal
    36. 50. Alix, HH et al Plant J 2008
    37. 51. 01/10/11 Dotter plot of Brassica oleracea var. alboglabra clone BoB028L01 x Brassica rapa subsp. pekinensis clone KBrB073F16 with transposable elements. Brassica oleracea (C genome) sequence Brassica rapa (A genome) sequence Dot-plots of genomic sequence from homoeologous pairs of BACs An inversion Region of low homology Region of high homology between A and C sequence Transposed (moved) sequence 500bp Insertion-gap pair: present in A 4kb Insertion-gap pair: present in C genome gi 195970379 vs. gi 199580153 Microsatellite kb Sequence level at scale of 100s to 1000s of bp – analysis by dotplot
    38. 53. 9-bp TSD (TATCCTATT) 6-bp TIR and 66-bp imperfect sub-TIR 551-bp BART1 TE TSD TIR TIR TSD 01/10/11 TATCCTATT G C G C AA TT GTC AATA ATAGCAC TTTTT GAAG TTT ATG TCTCAAAATAGCACT AGAAGGAG AAAGTCACAAAAAT GATA TTCATTAAAG GGTA AAATAT CTCTTATATCCTTGGTTT AAAA TTAAATAAACAAAC AAAAA TAAAT AAAAA TAAAT AAAAAAAA TG AAAAAAAA GAAAT TTTTTTT ATAGTTTCAGATTATATGTTTTCAGATTCG ATTTTTTTTTT ATTTTTTT ATTTTTTT CGAA ATTTTTTTTT T ATTTTTTTT CAA ATTTTCTTTTT ATAATTT AAAAA TACTTTTTGAAACTG TTTTTTT A ATTTTT ATTTTTT ATTTTAGTATTT ATTTTTT AT AAAA TTTTAA ACCC TAATTCCTAA ACCCC C ACCCC TTAACTCTAA ACCC TAAGGTTTGGATTAATTA ACCC AATGGATATAA GTGT ATATTT ACCT CTTTAATGAA ACCT ATTTTTGTGACTTT GAATCTTG AGTGCTA C TTTG G GA ACA AAA A CTTGGTTTG GTGCTAT CCTA GTC TT TT T C T C TATCCTATT TACCACCCTTCTTTGTTC AATACTTTTTACAGTTTTTGGAAAGGACATGTTTCTTCTATCATCACTTAATGGTTATATATGTATGAGAAGTTTGAAAGAGATTACACTGTTTTGGAATATTAAAAAAAAAAGATATTACAAGATCTGATTTTGTTTGTATTTTAAAATT CTACCAAATCTCTCCTCAAAATCTTG GTCAAAGTCCAAAAATCCAAATATCTCAGTTAAATTCCACCAAATATGAAATCCTAAAACTTTTCCAAAATAGTTCAATAAGCCCT TAGTG TTTGGTG AAGTGAATGGATGCTCGCATTAGTTACTAT GAGCCGATTCTCGCTCTTGCG AAAGCTAAAGAGGAAAAGGCCTTCG CATTGCAGAAGAGCTGGCTGCC AGCGAGCAAGAGGTTTTCAATATT GGCTTGTGGAAAATTTGTTGC CACTTTTGCTTTACTAAGGAATGAAATAATACTTGTTTTTTTTTTTCATGGTTAATATTAGAAGATATAATTTCCTTTGAAGTTAGATTACGTTTCTTTAT GTCGACGAAGTGAAGAAATATTG TCTTGTTTAT GGTTCCTTCTAGTCCCAACC TTTTTTCAAGAAGGTACAGTACGTGTCAGGATTTATATGGATATACACA Brassica rapa with inserted 542bp sequence not present in B. oleracea. 9bp TSD (red letters and arrow) and TIR (blue). Flanking primers used in PCR (next slide) as blue arrows on sequence Faisal Nouroz 2011
    39. 54. Brassica rapa (AA) Brassica nigra (BB) Brassica juncea (AABB) Brassica napus (AACC) Brassica carinata (BBCC) Brassica oleracea (CC) Young Old
    40. 55. 700 bp hAT Microsatellite 715 bp hAT 1016 bp in LINE 258 MITE 402 bp hAT 237 bp Mariner Like Inversion 914 bp LINE 2781 bp MuDR Like 505 bp Unknown 1655 bp in B.rapa 380 in B.rapa 670 bp hAT 819 bp Unknown 524 bp SINE 216 bp SINE 1189 bp Mariner Like 3869 bp TE 1080 bp LINE 242, 644 & 274 bp SINEs Brassica oleracea (C genome; EU642504.1) Brassica rapa (A genome; AC189298.1) TEs in B. oleracea 1284 bp Unknown
    41. 56. DAPI O. violaceus genomic DNA DAPI Xianhong Ge, Farah Badakshi, Heslop-Harrison and Schwarzacher 2012
    42. 57. Zyp1 Asy-1 O.violaceus Run 16 slide 5/7 Alien chromosome is partly unpaired and partly paired with Brassica chromosomes
    43. 58. <ul><li>Finding genes, controlling expression: using biodiversity </li></ul><ul><li>Recombining genes </li></ul><ul><li>Combining genomes </li></ul><ul><li>Chromosome engineering </li></ul><ul><li>Understanding </li></ul>
    44. 59. <ul><li>How many genes are there? </li></ul><ul><li>1990s: perhaps 100,000 in human </li></ul><ul><li>2000: 25,000 </li></ul><ul><li>How does this give the range of functions and control? </li></ul>Najl Valeyev
    45. 60. Susanne Barth, Ulrike Anhalt, Celine Tomaszewski
    46. 61. <ul><li>Anhalt, Barth, HH </li></ul><ul><li>2009 </li></ul><ul><li>Formidable genetic and environmental interactions </li></ul>
    47. 62. Anhalt UCM, Heslop-Harrison JS, Piepho HP, Byrne S, Barth S. 2009. Quantitative trait loci mapping for biomass yield traits in a Lolium inbred line derived F2 population . Euphytica 170: 99-107.
    48. 63. Kim, HH, Cho et al. 2011 Science Signaling Circadian Clock regulation after Leloup & Goldbeter cf Andrew Millar in Arabidopsis X X Y Y Z Z
    49. 64. <ul><li>Synchronization without external regulators </li></ul>
    50. 65. Live version: YouTube – pathh1 channel phaseportrait.avi
    51. 67. Heslop-Harrison 2012. www.tinyurl.com/domest Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Potato 900 Mbp 48 4 Modifed leaf Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Soybean 1,100 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 Fruit mesocarp Banana 500 Mbp 33 3 Fruit mesocarp
    52. 68. United Nations Millennium Development Goals - MDGs <ul><li>Goal 1 – Eradicate extreme poverty and hunger </li></ul><ul><li>Goal 2 – Achieve universal primary education </li></ul><ul><li>Goal 3 – Promote gender equity and empower women </li></ul><ul><li>Goal 4 – Reduce child mortality </li></ul><ul><li>Goal 5 – Improve maternal health </li></ul><ul><li>Goal 6- Combat HIV/AIDS, malaria and other diseases </li></ul><ul><li>Goal 7 - Ensure environmental sustainability </li></ul><ul><li>Goal 8 - Develop a global partnership for development </li></ul>
    53. 70. Pat Heslop-Harrison [email_address] www.molcyt.com pw/user: ‘visitor’ and AoBBlog.com
    54. 71. <ul><li>Mutation </li></ul><ul><li>Rearrangement </li></ul><ul><li>Duplication </li></ul><ul><li>Deletion </li></ul><ul><li>Homogenization </li></ul><ul><li>Sequences </li></ul><ul><li>Genes / motifs </li></ul><ul><li>Repetitive DNA </li></ul><ul><li>Chromosomes </li></ul><ul><li>Chromosome sets (‘Genomes’) </li></ul><ul><li>Genotypes/CVs </li></ul><ul><li>Species </li></ul><ul><li>Genera and above </li></ul><ul><li>Crops / wild species </li></ul><ul><li>Selection </li></ul><ul><li>Speciation </li></ul>
    55. 72. Many of the repetitive sequences are retrotransposons and DNA transposons Some are microsatellite motifs Some are satellites – including the most rapidly evolving sequences Repetitive DNA rapid evolution in copy number, location and sequence, with diverse turnover mechanisms often marks the major differences between closely related species it is hard to analyse by next generation or whole-genome sequencing methods
    56. 73. Pat Heslop-Harrison phh4@le.ac.uk Twitter: pathh1 www.molcyt.com pw/user: ‘visitor’
    57. 74. <ul><li>Gypsy elements are present in 25% of all BAC clones </li></ul>Barley gypsy: Vershinin, Druka, Kleinhofs, HH: Planf Mol Biol 2002; cf Brassica Alix & HH Plant Mol Biol 2005
    58. 75. Schematic representation of insertion in Brassica rapa and other Brassica genomes. Green, red, blue and black boxes showing DNA motifs. ……………… ..………………. 1 246 TSD TIR 542-bp TE TIR TSD 790 1000 Rapa185F Rapa177R Rapa8002 Rapa141F B. rapa (47186-48200) B. oleracea (66,350-66750) B. rapa (AA) B. juncea (AABB) ……………… ..………………. B. napus (AACC) ……………… ..………………. ……………… ..………………. ……………… ..………………. = A = T = C =G B. nigra (BB) B. oleracea (CC) B. carinata (BBCC) B. oleracea (GK97361) Hexaploid Brassica (carinata x rapa)
    59. 76. <ul><li>Stochastic fluctuations </li></ul><ul><ul><li>preserve stable oscillations </li></ul></ul><ul><ul><li>ensure robustness of the oscillations to cell-to-cell variations </li></ul></ul><ul><li>Robustness analysis requires stochastic simulation </li></ul>JongRae Kim et al. Stochastic noise and synchronisation during Dictyostelium aggregation make cAMP oscillations robust. PLoS Computational Biology 2007
    60. 77. Jeong-Rae Kim, HH & Kwang-Hyun Cho. J Cell Sci 2010
    61. 79. <ul><li>Higher yielding </li></ul><ul><li>Disease-resistance </li></ul><ul><li>Well-adapted </li></ul><ul><li>Better nutrition use </li></ul><ul><li>BIOTIC & ABIOTIC STRESS </li></ul>Mutant cultivars no mutation negative mutation Crop improvement by mutation techniques Pierre Lagoda
    62. 81. <ul><li>Tandem Repeats </li></ul><ul><li>Simple Sequence Repeats </li></ul><ul><li>Dispersed Repeats </li></ul><ul><li>Functional Repeats </li></ul><ul><li>Retroelements </li></ul><ul><li>Genes </li></ul>Typical Fraction 10% 5% 10% 15% 50% 10%

    ×