Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

3,264 views

Published on

Published in: Education, Technology
0 Comments
6 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
3,264
On SlideShare
0
From Embeds
0
Number of Embeds
845
Actions
Shares
0
Downloads
590
Comments
0
Likes
6
Embeds 0
No embeds

No notes for slide
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Trude Schwarzacher schwarzacher.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Patg Heslop-Harrison www.molcyt.com
  • Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

    1. 1. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers
    2. 2. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
    3. 3. DasypyrumDasypyrum breviaristatumbreviaristatum 2n=4x=282n=4x=28 Is itIs it AAAAAAAA oror AAAABB?? D. villosum (genomic DNA green) × D. breviaristatum (red) Meiotic metaphase I in a F1 hybrid showing autotetraploid nature Galasso et al.
    4. 4. Wheat evolution and hybridsWheat evolution and hybrids Triticum uratu 2n=2x=14 AA Einkorn Triticum monococcum 2n=2x=14 AA Bread wheat Triticum aestivum 2n=6x=42 AABBDD Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB Triticum dicoccoides 2n=4x=28 AABB Aegilops speltoides relative 2n=2x=14 BB Triticum tauschii (Aegilops squarrosa) 2n=2x=14 DD Triticale xTriticosecale 2n=6x=42 AABBRR Rye Secale cereale 2n=2x=14 RR
    5. 5. Satellite DNA probe green
    6. 6. Evolution of Wheats - PolyploidyEvolution of Wheats - Polyploidy Common Ancestor 2n=2x=14 Aegilops ventricosa 2n=4x=28 DDNN Triticum tauschii 2n=2x=14 DD Aegilops uniaristata 2n=2x=14 NN Triticum aestivum 2n=6x=42 AABBDD Triticum durum 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Aegilops sp. 2n=2x=14 BB Aegilops 2n=2x=14 Triticum 2n=2x=14
    7. 7. Lodging in cereals
    8. 8. Use of repetitiveUse of repetitive DNA sequences asDNA sequences as chromosomechromosome markersmarkers
    9. 9. Aegilops tauschiiAegilops tauschii in Iranin Iran Dpta1 dpTa1- Repetitive banding pattern does correlate with taxonomic grouping
    10. 10. Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
    11. 11. Wild diploid bananaWild diploid banana Cavendish : ‘Western’ banana cultivar 2n=3x=33; AAA genomes
    12. 12. RetroelementsRetroelements Sequences which amplify through an RNASequences which amplify through an RNA intermediateintermediate 50% of all the DNA!
    13. 13. Alignment of two BACs shows gaps in both A and B genome MA4_82I11 MBP_81C12 MuhAT 1 MuhAT2 a XX TE (SINGLE)XX TE MITE XX TE (AGNABI) MuhAT3 MuhAT4 MITE(MBIR ) XX TE XX TE (MBT) 272 bp 102,190 bp 26, 410 bp 128,068 bp DNA transposons hAT are particularly frequent hAT (named from hobo (Drosophila), Ac-Ds (maize), and Tam3 (Antirrhinum) transposon are characterized by an 8 bp TSD8 bp TSD, and short TIRs of 5–27 bpshort TIRs of 5–27 bp flanking a transposase (sometimes degenerate) including a DDE site. Non-autonomous (sometimes called MITEs, miniature inverted transposable elements) derivatives of hAT elements are also found, with deletion of most of the coding sequence, and may amplify to huge copy numbers. Menzel, Schmidt, Nouroz, HH in prep 2013
    14. 14. RetroelementsRetroelements Homologous BAC sequences from Calcutta 4 Homologous over the full length except for a 5kb insert a Ty1-copia retroelement
    15. 15. 01/07/13 19 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
    16. 16. 01/07/13 20 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
    17. 17. A-genome specific hAT in three Musa hybrids (2n=3x=33) Musa ‘Williams Cavendish’ (AAA) Musa (ABB) Musa (ABB)
    18. 18. 01/07/13 22 Dot plot showing the complete Inverted repeat.
    19. 19. 01/07/13 23 HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 1KB 800 600 400 200 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
    20. 20. Retroelement Markers Retrotransposon LTRLTR Retrotransposon LTRLTR RetrotransposonLTR LTR Retrotransposon LTRLTR Insertion IRAP – InterRetroelement PCR Retrotransposon LTRLTR RetrotransposonLTR LTR
    21. 21. IRAP diversity in MusaIRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
    22. 22. 01/07/13 26Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
    23. 23. Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
    24. 24. Timing of LTR Retrotransposon insertion in Musa Red 0 to 2 Mya, yellow 2 to 4 Mya, green 4 to 6 Mya and blue older D’Hont et al. 2012
    25. 25. The Banana GenomeThe Banana Genome Seven countries + international organization coordinated by Angelique D’Hont - France (CIRAD, Genoscope)
    26. 26. 523 Mb DH-Pahang genome size (flow cytometry) 27.5 million Roche/454 single reads 16 x coverage 2.1 million Sanger reads 4 x coverage 50.3 x of Illumina data 54 BAC sequences (1%)
    27. 27. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Six-way Venn diagram showing the distribution of shared gene families (sequence clusters) among M. acuminata, P. dactylifera, Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium distachyon genomes.
    28. 28. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Whole-genome duplication events.
    29. 29. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
    30. 30. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
    31. 31. 1010 µµmm DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes copiacopia elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) 5MeC
    32. 32. 1010 µµmm C.H Teo and Schwarzacher 5MeC DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes gypsygypsy elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) Teo &Teo & Schwarzacher inSchwarzacher in prep 2013prep 2013
    33. 33. Arachis hypogaeaArachis hypogaea - Peanut- Peanut Tetraploid of recent origin,Tetraploid of recent origin, ancestors separated only 3 My agoancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, PHH et al. Embrapa, Brasília. Annals Botany in press 2013
    34. 34. A2n=4x=40probed (A.duranered)A.ipaënsis  Be
    35. 35. Arachis duranensis BAC probes on A. hypogea chromosomes Right: green BAC AD52G19;red AD79O23 Below: red AD51I17 Below right: green AD179B13;red 5S rDNA
    36. 36. paradox in the evolution of genome structure: the predominant repetitive DNA genome fraction is in evolutionary flux, whilst, at the same time, low copy number DNA is conserved over evolutionary time
    37. 37. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa) DAPI metaphase blue Radish genomic red (labels 2 radish chromosomes and 45S rDNA) Rfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica Tarja Niemelä, Seppänen, Badakshi, Rokka HH Chromosome Research 2012
    38. 38. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
    39. 39. Anything special about cropAnything special about crop genomes?genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Potato 900 Mbp 48 4 Modifed leaf Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Peanut 2,800 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 Fruit mesocarp Banana 523 Mbp 2x 33 3 Fruit mesocarp Heslop-Harrison 2012. www.tinyurl.com/domest
    40. 40. 50 years of plant breeding50 years of plant breeding progressprogress Global production figuresGlobal production figures Agronomy& Nitrogen Genetics Transgenic Bt insect-resistant maize (& herbicide tolerant)
    41. 41. CytoGenomics …CytoGenomics … The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool
    42. 42. www.molcyt.comwww.molcyt.com phh4@le.ac.ukphh4@le.ac.uk Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
    43. 43. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers

    ×