Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication

4,192 views

Published on

Plant Molecular Cytogenetics www.molcyt.com
Conference Katowice, Poland September 2014
Chromosomes, in situ hybridization, genome organization and evolution

Published in: Education
  • Be the first to comment

Plant Molecular Cytogenetics - Postgenomics, Chromosomes and Domestication

  1. 1. Chromosomes, Crops and Superdomestication in Katowice Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com UserID/PW ‘visitor’ Pathh1: Twitter #PMC . Slideshare pathh1
  2. 2. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  3. 3. How do genomes evolve? –Gene mutation Genome very rarely evolution (human: 10−8/site/generation) –Chromosome evolution –Polyploidy and genome duplication (ancient & modern) –Repetitive sequences: mobility & copy number (10−4/generation in μsat) –Recombination –Epigenetic aspects: centromeres & expression
  4. 4. How do genomes evolve? – Gene mutation Genome very rarely evolution – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences: mobility & copy number – Recombination – Epigenetic aspects – centromeres & expression How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome and genome engineering – Breeding – Markers
  5. 5. Musa biodiversity and genomes: x=11 Red - AAA 2n=3x=33 – M. acuminata Palayam codan AAB (two bunch yellow, one green) Musa x Peyan ABB (green cooking banana) Njalipoovan AB (yellow) 2n=2x=22 M. acuminata x M. balbisiana Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Varkala, Kerala, India Peyan ABB
  6. 6. Retrotransposons Class I transposable elements RNA intermediate DNA transposons Class II transposable elements Cut-and-paste
  7. 7. Retroelements Sequences which amplify through an RNA intermediate • 50% of all the DNA!
  8. 8. Retroelements BAC sequences from Musa Calcutta 4 Homologous over the full length except for a 5kb insert • a Ty1-copia retroelement
  9. 9. Alignment of two homologous Musa BACs shows gaps in both B genome M. balbisiana and A genome M. acuminata MA4_82I11 MBP_81C12 MuhAT 1 XX TE MITE XX TE (SINGLE) MuhAT2 a XX TE (AGNABI) MuhAT3 MuhAT4 MITE(MBIR ) XX TE XX TE (MBT) 272 bp 102,190 bp 26, 410 bp 128,068 bp DNA transposons hAT are particularly frequent 8 bp TSD, and short TIRs of 5–27 bp transposase (sometimes degenerate) including a DDE site. Non-autonomous (MITE) derivatives of hAT with deletion coding sequence Menzel, Schmidt, Nouroz, HH Chr Res subject minor revision 2015
  10. 10. Musa balbisiana (MBP 81C12) Musa acuminata (MA4 82I11) hAT 1 1676 TE 384 bp TE + 781 MITE Transposed Element Sr. No. Primer Pairs Product Size (bp) Microsatellite (AT) 621 bp MBT Sequence 1. hAT18486 hAT19037 hAT 2 hAT 3 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC 4192 bp TE hAT 4 Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 23/09/2014 12
  11. 11. Musa balbisiana (MBP 81C12) Musa acuminata (MA4 82I11) hAT 1 1676 TE 384 bp TE + 781 MITE Transposed Element Sr. No. Primer Pairs Product Size (bp) Microsatellite (AT) 621 bp MBT Sequence 1. hAT18486 hAT19037 hAT 2 hAT 3 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC 4192 bp TE hAT 4 Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. 23/09/2014 13
  12. 12. A-genome specific hAT in three Musa accessions (2n=3x=33) Musa ‘Williams Cavendish’ (AAA) Musa (ABB) Musa (ABB)
  13. 13. 23/09/2014 15 Dot plot showing the complete Inverted repeat.
  14. 14. HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 23/09/2014 16 1KB 800 600 400 200 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element Lower bands amplifying the flanking sequences only Menzel, Nouroz, Heslop-Harrison, Schmidt 2014
  15. 15. Retroelement Markers LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR LTR Retrotransposon LTR Insertion IRAP – InterRetroelement PCR LTR Retrotransposon LTR LTR Retrotransposon LTR
  16. 16. IRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
  17. 17. Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al. 23/09/2014 19
  18. 18. BSV Expression in Banana Double stranded DNA is infective: Insect vector Unexpected epidemiology: Appearance after cold or tissue culture
  19. 19. Nuclear Copies of Banana Streak Virus in Banana
  20. 20. Nuclear Copies of BSV in banana DNA Fibre in situ hybridization Harper, HH et al., Virology 1999 … cf D’Hont et al., Nature, 2012
  21. 21. Whole genome shotgun sequencing • Changing all cytogenomics (.org) work • Easily obtaining several-fold sequence coverage
  22. 22. D’Hont et al. Nature 2012 doi:10.1038/nature 11241
  23. 23. Musa Banana n=11 Sequence: D’Hont, inc HH et al. Nature 2012 Haploid: Nair, HH 2013
  24. 24. Whole genome duplications • The surprise to the sequencers: conserved synteny and relatively few breakpoints • The surprise to the cytogeneticists: sequencing shows whole genome duplications (=polyploidy) deep in the phylogenetic tree • The surprise to everyone: so few genes but multifunctional
  25. 25. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  26. 26. Brachiaria LTR element families Fabíola Carvalho Santos André Luiz Laforga Vanzela See poster Forage/pasture Urban Savanna/cerrado Forest Sugar cane Soybean/corn Brazil land use
  27. 27. Some probes show less hybridization to some chromosomes, perhaps indicating genome specificity. Fabíola Carvalho Santos André Luiz Laforga Vanzela See poster
  28. 28. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  29. 29. Wheat evolution and hybrids Triticum uratu 2n=2x=14 AA Aegilops speltoides Triticum dicoccoides Einkorn 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Bread wheat Triticum aestivum 2n=6x=42 AABBDD Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB relative 2n=2x=14 BB Triticum tauschii (Aegilops squarrosa) 2n=2x=14 DD Triticale xTriticosecale 2n=6x=42 AABBRR Rye Secale cereale 2n=2x=14 RR
  30. 30. Copyright restrictions may apply. Inter-retroelement (IRAP) analysis of Triticum tauschii ssp tauschii from Iran SSR/Microsats: all are different and no tree is supported Different sequence classes evolve at different rates Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
  31. 31. Crop standing Lodging in cereals Crop fallen
  32. 32. Use of repetitive DNA sequences as chromosome markers
  33. 33. Inheritance of Chromosome 5D Aegilops ventricosa DDNN dpTa1 pSc119.2 Genomic Ae.ventricosa ABDN Triticum persicum Ac.1510 AABB AABBDDNN Marne AABBDD VPM1 Dwarf A CWW1176-4 Rendezvous Piko Virtue 96ST61 × × × × Hobbit × {Kraka × (Huntsman × Fruhgold)}
  34. 34. Wheat Streak Mosaic Virus in North America Bob Graybosch, USDA
  35. 35. Wsm-1: only highly effective source of resistance to WSMV
  36. 36. Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
  37. 37. Chromosome evolution - Polyploidy • Selected natural – Wheat – Banana – Brachiaria – Proso millet • Synthetic – Triticale – Nicotiana
  38. 38. Proso millet (Panicum miliaceum): origins, genomic studies and prospects Pat Heslop-Harrison, Farah Badakshi and Harriet Hunt
  39. 39. Panicum sensu stricto c. 100 species; x=9 Evolution of Panicum miliaceum Proso millet P. virgatum 2n=4x=36 or 2x=18 ? ? ? ? ? ? P. miliaceum 2n=4x=36 P. capillare 2n=2x=18 P. repens 2n=4x=36 also 2n=18 to 54 P. sumatrense 2n=2x=18 or 4x=36 Global North-temperate Low genetic diverstiy Weedy forms • Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. 2014
  40. 40. • P. miliaceum: allotetraploid with maternal ancestor P. capillare and one genome shared with P. repens (also allotetraploid)  Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. March 2014
  41. 41. Chromosome and genome engineering Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Davey et al 2011 Annals of Botany
  42. 42. Nicotiana hybrid 4x + 4x cell fusions Each of 4 chromosome sets has distinctive repetitive DNA when probed with genomic DNA Patel et al Ann Bot 2011 Cell fusion hybrid of two 4x tetraploid tobacco species Four genomes differentially labelled Patel, Badakshi, HH, Davey et al 2011 Annals Botany
  43. 43. Arachis hypogaea - Peanut Tetraploid of recent origin, ancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals Botany 2013
  44. 44. •Arachis hypogea 2n=4x=40 probed with •(green) A. duranensis; (red) A. ipaënsis  Bertioli et al. Annals of Botany 2013
  45. 45. BAC in situ hybridization
  46. 46. Primula BAC mapping Gilmartin, Lu, HH & Badakshi 2015?
  47. 47. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa) DAPI metaphase blue Radish genomic red (2 radish chromosomes) far-red 45S rDNA Rfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica Tarja Niemelä, Seppänen, Badakshi, Rokka HH Chromosome Research 2012
  48. 48. BACs from different species have different repeat distributions – and hence different patterns of hybridization
  49. 49. Organelle sequences from chloroplasts or mitochondria Sequences from viruses, Agrobacteriumor other vectors Transgenes introduced with molecular biology methods Genes, regulatory and non-coding single copy sequences Dispersed repeats: Transposable Elements Repetitive DNA sequences Nuclear Genome Tandem repeats DNA transposons copied and moved via DNA Retrotransposons amplifying via an RNA intermediate Centromeric repeats Structural components of chromosomes Telomeric repeats Repeated genes Simple sequence repeats or microsatellites Subtelomeric repeats 45S and 5S rRNA genes Blocks of tandem repeats at discrete chromosomal loci DNA sequence components of the nuclear genome Heslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences Other genes
  50. 50. MuTRR 180 bp X MuTRR MuTRF MuTRF 220 bp Monkey retroelement • The original 177bp repeat fits nicely around the nucleosome allowing a tight coiling • The repeat unit with the retroelement foot print, the 63bp box, has a much more open configuration • It is maintained as it brings a CG and CNG site that allows control via methylation Insertion and subsequent loss C.H Teo and Schwarzacher
  51. 51. A B C DNA sequence Centromere TE Tandem repeat monomer TE Transposable element Single copy DNA Metaphase chromosome Spindle microtubules pulling apart chromatids 147bp plus 5-70bp linker = 150-220bp 100bp plus 55bp linker = 155bp D E F G H I Kinetochore Henikoff et al 2013 C: antibody to CENH3 variant Heslop-Harrison & Schwarzacher 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://wp.me/p2Ewqp-7h
  52. 52. Domestication • Most species domesticated 10,000 years ago: cereals, legumes/pulses, brassicas, fruits, cows/sheep/pigs, silkworm/bees) • Few species more recently (rabbits, fish; trees, biofuel crops) • A few dropped out of production • First steps: productive, reproduce easily, disease-free, edible/tasty, harvestable … Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom
  53. 53. Domestication • … • A few dropped out of production • Second steps: more productive, harvestable • Third step: fitting for sustainable intensification • Proso millet: the most water-efficient cereal • Superdomestication and design of crops Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom www.tinyurl.com/superdom
  54. 54. Outputs –CROPS – Fixed energy Inputs –Light –Heat –Water –Gasses –Nutrients –Light –Heat –Water –Gasses –Nutrients (Ecosystem services)
  55. 55. Conventional Breeding • Cross the best with the best and hope for something better Superdomestication • Decide what is wanted and then plan how to get it – Variety crosses – Mutations – Hybrids (sexual or cell-fusion) – Genepool – Transformation
  56. 56. Economic growth • Separate into increases in inputs (resources, labour and capital) and technical progress • 90% of the growth in US output per worker is attributable to technical progress Robert Solow – Economist
  57. 57. 1.2E+09 1E+09 800000000 600000000 Agronomy 400000000 200000000 0 52 years of plant breeding progress GM maize Maize Rice, paddy Wheat Population /10 Genetics 1961 1970 1980 1990 2000 2010 2013
  58. 58. United Nations Millennium Development Goals-MDGs 1990 to 2015 • Goal 1 – Eradicate extreme poverty and hunger • Goal 2 – Achieve universal primary education • Goal 3 – Promote gender equity and empower women • Goal 4 – Reduce child mortality • Goal 5 – Improve maternal health • Goal 6- Combat HIV/AIDS, malaria and other diseases • Goal 7 - Ensure environmental sustainability • Goal 8 - Develop a global partnership for development
  59. 59. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  60. 60. How do genomes evolve? – Gene mutation Genome very rarely evolution – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences: mobility & copy number – Recombination – Epigenetic aspects – centromeres & expression How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome and genome engineering – Breeding – Markers Pat Heslop-Harrison & Trude Schwarzacher www.molcyt.com Pathh1 on slideshare
  61. 61. Chromosomes, Crops and Superdomestication in Katowice Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com UserID/PW ‘visitor’ Pathh1: Twitter #PMC . Slideshare pathh1
  62. 62. Major Genomic Components • Tandem Repeats • Simple Sequence Repeats • Dispersed Repeats • Functional Repeats • Retroelements • Genes Typical Fraction 10% 5% 10% 15% 50% 10%
  63. 63. A D’Hont et al. Nature 2012 doi:10.1038/na ture11241 Whole-genome duplication events.
  64. 64. Satellite DNA probe green
  65. 65. Differences between genomes Major differences in the nature and amount of repetitive DNA • 45S rDNA • dpTa1 tandem repeat
  66. 66. 146 bp around histones
  67. 67. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  68. 68. • Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC content of the sequence and (red, smooth line) sequence curvature. While GC and AT rich regions of a sequence generally correlate with curvature, the kinked region shows curvature with low GC content.
  69. 69. • How do genomes evolve? • How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome engineering – Markers
  70. 70. Genome engineering • Introgression of chromosomes – Brassica – Raphanus – Wheat – Thinopyrum
  71. 71. Chromatin • Packaging
  72. 72. UK Wheat 1948-2007 52,909 data points, 308 varieties From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from the past and opportunities for the future. SCRI website.
  73. 73. Rules for successful domestication • There aren’t any! • Crops come from anywhere (new/old world; temperate/tropical; dry/humid) • They might be grown worldwide • Polyploids and diploids (big genomes-small genomes, many chromosomes-few chromosomes) • Seeds, stems, tubers, fruits, leaves
  74. 74. DNA methylation is unevenly distributed on 10 m Musa chromosomes copia elements in methylated regions, but also in some low methylated regions (arrows) 5MeC
  75. 75. DNA methylation is unevenly distributed on 10 m C.H Teo and Schwarzacher Musa chromosomes 5MeC gypsy elements in methylated regions, but also in some low methylated regions (arrows) Teo & Schwarzacher in prep 2013
  76. 76. Genome evolution • How do genomes evolve? – Mutation very rarely (human: 10−8/site/generation) – Chromosome evolution – Polyploidy and genome duplication (ancient and modern) – Repetitive sequences – mobility & copy number (10−4 μsat) – Recombination – Epigenetic aspects – centromeres & expression • How can we exploit knowledge of genome evolution? – Biodiversity – Chromosome engineering – Breeding – Markers
  77. 77. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 85
  78. 78. The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool Molecular cytogenetics …
  79. 79. How to use diversity • Cross two varieties • Genome manipulations • Cross two species and make a new one • Cell fusion hybrids • Chromosome manipulation • Backcross a new species • Generate recombinants • Chromosome recombinations • Transgenic approaches • Use a new species
  80. 80. Nothing special about crop genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Rapeseed B. napus 1125 Mbp 38 4 Cotyledon oil/protein Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Soybean 1,100 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 2 Fruit mesocarp Banana 500 Mbp 33 3 Fruit mesocarp Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B978- 0-12-381466-1.00001-8 Tinyurl.com/domest
  81. 81. DNA sequence Centromere TE Tandem repeat monomer TE Transposable element Single copy DNA Metaphase chromosome Spindle microtubules pulling apart chromatids 147bp plus 5-70bp linker = 150-220bp Kinetochore Heslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013)
  82. 82. Genes!
  83. 83. EvolutionEpigeneticsDevelopment Phenotype Multiple abnormalities Genetic changes non-reverting Changes seen, some reverting (Male/Female) Normal Differentiation Cause Chromosomal loss, deletion or translocation Gene mutation / base pair changes Telomere shortening (Retro)transposon insertion Retrotransposon activation SSR expansion Methylation Heterochromatinization Chromatin remodelling Histone modification
  84. 84. Outputs –CROPS – Fixed energy Inputs –Light –Heat –Water –Gasses –Nutrients
  85. 85. Outputs –CROPS – Fixed energy 93 Inputs –Light –Heat –Water –Gasses –Nutrients – Light – Heat – Water – Gasses – Nutrients

×