Cathy Tie conducted a study to characterize the roles of RNF20 and RNF40 in class switching of B cells. She extracted mRNA from B cells and used PCR to amplify RNF20 and RNF40 cDNA, but initial primers were ineffective. Objectives included testing new primers and determining if overexpressing or depleting RNF20/RNF40 impacts class switching. Successful amplification of RNF20 and RNF40 would involve cloning the genes into a plasmid for bacterial expression and reintroducing them into B cells to observe effects on class switching. This may provide insights into DNA damage response pathways in antibody diversification and cancer.

1. Cathy Tie
Class Switching of B Cells
Characterizing RNF20 and RNF40 in
Characterizing RNF20 and RNF40 in Class Switching of
1
B Cells, by Cathy Tie

2. Introduction
• Somatic hypermutation and class switch recombination
(CSR) contribute to effective immune response
Characterizing RNF20 and RNF40 in Class Switching of B Cells
• B cells produce antibodies to clear pathogens and toxins
• CSR induced by activation-induced cytidine deaminase
(AID) gene at switch regions within the Ig locus
• Different antibody isotypes have distinct effector functions
• B cells switch from class IgM to IgA
Cathy Tie, 8 March 2013
• This study looks at proteins RNF20 and RNF40 in the
process of CSR
2

3. Antibody Isotypes
• The antibody class is
the constant region in
Characterizing RNF20 and RNF40 in Class Switching of
an antibody that can
only be replaced with
other constant regions
by CSR.
• It can change the
antibody effector
functions without
changing the antigen
B Cells, by Cathy Tie
binding site.
3

4. Class Switch
Recombination
(CSR)
• B cells switch from IgM to IgA
• Detection and processing of
Characterizing RNF20 and RNF40 in Class Switching of
the mutated residues by base
excision repair generates
double-stranded DNA breaks
(DSBs) at switch regions
• DSBs cause B cells to signal a
damage response to mend the
resultant breaks
• CSR removes portions in the
antibody heavy chain locus
from the chromosome
B Cells, by Cathy Tie
• The surrounding gene
segments rejoin in the heavy
chain to generate a different
antibody gene that produces
antibody of a different isotype
Durandy A (2003). "Activation-induced cytiddeaminase: a dual role in class-
switch recombination and somatic hypermutation". Eur. J. Immunol. 33 (8):
2069–73.
4

5. Activation-Induced Cytidine
Deaminase Protein (AID)
• Recent discovery of AID furthered our knowledge of somatic
hypermutation and class switch recombination (CSR)
Characterizing RNF20 and RNF40 in Class Switching of
• Mice and humans deficient in AID are incapable of somatic
hypermutation and CSR
• AID is the only B cell specific protein that is required for both
of these processes
• AID initiates antibody diversification by deaminating cytidines
within switch regions for class switch recombination
B Cells, by Cathy Tie
• Current research revolves around delineating the class switch
recombination processes including the DNA repair proteins
that repair the AID-induced DNA lesions
5

6. To what extent are RNF20 and
RNF40 crucial proteins in the class
Characterizing RNF20 and RNF40 in Class Switching of
switch recombination process in B
cells?
B Cells, by Cathy Tie
6

7. Procedures
• Extract mRNA from B cell line CH12F3-2 and construct
cDNA library using reverse transcriptase
Characterizing RNF20 and RNF40 in Class Switching of
• Amplify the RNF20 and RNF40 cDNAs from the cDNA
library using the Polymerase Chain Reaction (PCR)
technique with a specific primer pair
• Primers mark the target sequence to be amplified
• The size of the DNA molecule will be determined using the
agarose gel method
B Cells, by Cathy Tie
• Size will be compared to information indicated in the
National center for Biotechnology Information
7

8. Polymerase –
Chain Reaction
(PCR)
• Denaturation heats up the
reaction for melting of the
DNA template by disrupting
Characterizing RNF20 and RNF40 in Class Switching of
the hydrogen bonds
between complementary
bases
• Yields single-stranded DNA
molecules
• Primers mark the ends of
target sequence in the
annealing stage
• GADPH primers were used
as the control
B Cells, by Cathy Tie
• RNF20 ‘UTR, RNF40 ‘TUR,
and RNF20/40 clone with
extensions were tested
8

9. Polymerase –
Chain Reaction
(PCR)
• Each primer binds to one DNA
strand produced during
denaturation
Characterizing RNF20 and RNF40 in Class Switching of
• Temperature is raised to
replicate the DNA strands by
the use of Phusion
• Phusion DNA polymerase
facilitates the binding and
joining of the complementary
nucleotides that are free in
solution (dNTPs), thereby
synthesizing new double
stranded DNA molecules
• Phusion DNA polymerase
B Cells, by Cathy Tie
functions in the 5’ to 3’
direction
• Free nucleotides in the
solution are only added to the
3’ end of the primers
constructing the
complementary strand of the
targeted DNA sequence
9

10. Characterizing RNF20 and RNF40 in Class Switching of
Electrophoresis
B Cells, by Cathy Tie
PCR products (DNA molecules) move from top (negative charge) to bottom (positive charge) between the
spaces in the agarose gel. Smaller molecules tend to travel faster than larger molecules.
10

11. Procedures cont’d
• PCR purification cleans the DNA of the gene
• RNF20 and RNF40 PCR products will be ligated with a
Characterizing RNF20 and RNF40 in Class Switching of
specifically cut drug resistant vector
• Parts of RNF20 and RNF40 will be digested by restriction
enzyme to fit with vector
• PCR product and vector combined by ligation, forming a
plasmid that is resistant to the drug ampicillin
• Pasmid placed into bacteria for continual generation
B Cells, by Cathy Tie
• RNF20 and RNF40 return to B cell line, observe the effect
on CSR
11

12. Objectives
• Test control primers (GADPH) with Taq
• Test the combinations of cDNA oligo DT and hexamer
with various primers
Characterizing RNF20 and RNF40 in Class Switching of
• Test different primers and Phusion in gradient PCR with
cDNA
 RNF20 5’/3’UTR
 RNF20 Clone
 RNF40 5’/3’UTR
 RNF40 Clone
• Understand the importance of the ubiquitin system in
B Cells, by Cathy Tie
antibody diversification and DNA damage response
• Use a flow cytometry assay to determine whether
overexpression of removal of RNF20/RNF40 impacts
CSR
12

13. •
Summary of Hypotheses
Characterizing RNF20 and RNF40 in Class Switching of
B Cells, by Cathy Tie
13

14. Characterizing RNF20 and RNF40 in Class Switching of
ladder GADPH Primers with cDNA
B Cells, by Cathy Tie
GADPH Primers
Through electrophoresis analysis, the control reveals successful bands at 350 – 400 base pairs
14

15. Characterizing RNF20 and RNF40 in Class Switching of
B Cells, by Cathy Tie
GADPH and RNF20/40 ‘UTR Primers
Electrophoresis analyses of cDNA, generated from oligo dT-mediated reverse transcription with GAPDH
and RNF20 and RNF40 ‘UTR primers. RNF20 and RNF40 ‘UTR primers result in streaking with the
absence of DNA bands 15

16. ladder RNF40 ‘UTR with 4+ RNF40 ‘UTR with 7+
Characterizing RNF20 and RNF40 in Class Switching of
ladder RNF20 ‘UTR with 4+ RNF20 ‘UTR with 7+
B Cells, by Cathy Tie
RNF20/40 ‘UTR Primers w/ 4+ and 7+ cDNA
Two samples of cDNA, generated from oligo dT-mediated reverse transcription, were tested with
RNF20/40 ‘UTR primers and Taq; no bands present
16

17. RNF40 ‘UTR with 4+ RNF40 clone with 4+
RNF20 ‘UTR with 4+ RNF20 clone with 4+
Characterizing RNF20 and RNF40 in Class Switching of
B Cells, by Cathy Tie
RNF20/40 ‘UTR and Clone Primers
Consistent cDNA sample was tested with the four primers above. Clone primers consisted of
extensions which will be later digested by enzymes for ligation with vector; no bands present
17

18. Characterizing RNF20 and RNF40 in Class Switching of
B Cells, by Cathy Tie
RNF20/40 ‘UTR and Clone Primers with
hexamer cDNA
Same primers were tested with oligo DT and random hexamer cDNA samples. Phussion
also proved to be more effective than Taq at PCR. No bands present. 18

19. Standard Curve for 100 base pairs (bp) Ladder
• Control GAPDH primers resulted in
DNA bands
Characterizing RNF20 and RNF40 in Class Switching of
• From slide 11, bands by GAPDH with
cDNA 4+ and 7+ migrated 14mm and
13.5mm from the well
• Standard 100 bp curve shows that they
are 350 bp and 400 bp respectively
• 4+ DNA molecule is smaller than the
7+ molecule
• GADPH primers succeeded in
expressing GADPH genes, as NCBI
B Cells, by Cathy Tie
states that the correct size is 350 bp
• The -1kp ladder curve will be used to
measure the size of the RNF20 and
RNF40 amplified molecules
19

20. Discussion
• Problems remain in the Polymerase Chain Reaction (PCR)
method, specifically in the function of primers
 Inefficiency of primers
 Buffer or temperature range was optimal
Characterizing RNF20 and RNF40 in Class Switching of
 Genes were expressed at very low levels
• Conclusion
 Primers below are not effective in expressing RNF20 and RNF40
RNF20 5’UTR: ATGTCAGGAATTGGAAATAAAAG
RNF20 3’UTR: GCCAATGTAGATGCGATGGAA
RNF20 Clone F: GAACGGATCCCACCATGTCAGGAATTGGAAATAAAAG
RNF20 Clone R: TGTCGCGGCCGCTCAAGCGTAATCTGGAACATCGTATGGGTATGATCCGCCAATGTAGATGCGATGGAA
RNF40 5’UTR: ATGTCTGGCCTCAGCAACA
RNF40 3’UTR: GCTGATGTACACACGGTGG
RNF40 Clone F: GAACGCTAGCCACCATGTCTGGCCTCAGCAACA
B Cells, by Cathy Tie
RNF40 Clone R: TGTCGCGGCCGCTCAAGCGTAATCTGGAACATCGTATGGGTATGATCCGCTGATGTACACACGGTGG
• Require more effective RNF20 and RNF40 primers in
combination with Phusion in PCR
• Successful PCR products, shown through electrophoresis
analyses, will be cut and ligated with a vector to form a
plasmid resistant to ampicillin
20

21. Discussion and Future Steps
• Drug-resistant plasmids will be exponentially generated
• Overexpression of proteins will affect CSR
Characterizing RNF20 and RNF40 in Class Switching of
• Protein depleted cells should exhibit no defects in
proliferation, as reduced CSR is only due to the functions
of RNF20 and RNF40
• The effects of the proteins’ knockdown by
immunofluorescence will show the roles of the proteins
• Roles involved DNA damage response (DDR) will translate
B Cells, by Cathy Tie
to knowledge about cancer classification and development
 DDR protects against tumour progression spreading to daughter
cells
21

22. Conclusion
Bibliography Acknowledgements
 Lodish, Harvey F., James E. Darnell, and David Baltimore. Molecular Cell
• Thank you to my
Characterizing RNF20 and RNF40 in Class Switching of
Biology. 5th ed. New York: W.H. Freeman and Co., 2004. Print.
 Ramachandran, Shaliny , Richard Chahwan, Rajeev M. Nepal, Darina mentors, Dr. Martin
Frieder, Stephanie Panier, Sergio Roa, Ahmad Zaheen, Daniel Durocher,
Matthew D. Scharff, and Alberto Martin. "The RNF8/RNF169 Ubiquitin Ligase and Shaliny R., at the
Cascade Facilitates Class Switch Recombination." PNAS 107 (2010): 1-6.
Print. Martin Laboratory at
 Ward, Irene, Michel Nussenzweig, Bernardo Reina-San-Martin, Junjie Chen, the University of
Ferenc Livak, Andre Nussenzweig, Lieping Chen, Marilia Cascalho, Julie Lau,
Koji Tamada, Kay Minn, and Alexandru Olaru. "53BP1 is required for class Toronto for providing
switch recombination.." The Journal of Cell Biology 165.4 (2004): 459-464.
Print. guidance and
• Ppvsu Nina . "PLOS Biology: V(D)J Recombination and the Evolution of the
aaai ,
o
l laboratory equipment
Adaptive Immune System." PLOS Biology : Publishing science, accelerating
research. N.p., 3 Oct. 2003. Web. 1 Dec. 2012. for this project
B Cells, by Cathy Tie
<http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.0000016>
 Edry E, Koralov SB, Rajewsky K, Melamed D.Spontaneous class switch
recombination in B cell lymphopoiesis generates aberrant switch junctions
and is increased after VDJ rearrangement. J Immunol. 2007;179(10):6555-
6560.
 "Polymerase Chain Reaction (PCR)."National Center for Biotechnology
Information. N.p., n.d. Web. 1 Dec. 2012. <
http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/TechPCR.shtml>
 Yount, Lisa. Genetics and genetic engineering. New York: Facts on File,
1997. Print.
22