1. Researchers at DOE JGI sequenced the genome of switchgrass (Panicum virgatum) to support the development of cellulosic biofuels.
2. They produced an initial draft genome assembly (v0.0) using 454 sequencing but it was fragmented.
3. To improve the assembly, they developed a genetic map of switchgrass using 250 offspring from a cross between cultivars AP13 and VS16.
4. They used the genetic map to order and orient contigs into chromosomes, producing version 1.0 of the switchgrass reference genome.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
This presentation highlights the basics and application of genome editing strategies in plants, strategies to reduce off-target mutation, identification of mutant analysis etc.
RNA-Seq Analysis of Blueberry Fruit Development and RipeningAnn Loraine
This document summarizes an RNA-Seq analysis of blueberry fruit development and ripening. Researchers sequenced RNA from five stages of fruit development to generate over 20 million reads per sample. Reads were aligned to the blueberry genome assembly to identify over 50,000 expressed genes and their expression profiles across stages. Analysis identified thousands of differentially expressed genes between stages and clusters of genes with similar expression patterns. Pathway analysis revealed metabolic pathways active during fruit development, including a potential new pathway for bixin biosynthesis with high expression during fruit maturation. Resources from the project include an online blueberry browser and gene expression data.
Multi Target Gene Editing using CRISPR Technology for Crop ImprovementTushar Gajare
This document provides an overview of a presentation on using CRISPR technology for multi-target gene editing in crop improvement. It begins with an introduction to genome editing and CRISPR-Cas9. It then discusses the CRISPR system, how CRISPR-Cas9 works, its history and applications for crop improvement including case studies in maize with high mutant efficiencies and targeted mutagenesis of multiple genes. The presentation covers advantages and limitations of the technology as well as future prospects.
An overview of agricultural applications of genome editing: Crop plantsOECD Environment
The presentation gives an overview of genome editing applications in relation to crop plants. The aim is to have a better understanding of the specific features of genome editing in comparison with classical breeding and genetic engineering techniques. It will give an overview of some examples of agricultural applications that may be on or close to the market or under research and development. It will also consider the possibility of foreseeing future applications (e.g. variations in CRISPR/Cas applications, DNA-free application, agricultural pest control), if possible.
This is a compilation of the Yeast genome project from the different databases and sources.
By:
Nazish Nehal,
M. Tech (Biotechnology),
University School of Biotechnology (USBT),
Guru Gobind Singh Indraprastha University (GGSIPU),
New Delhi (INDIA)
India has contributed to the International Rice Genome Sequencing Project by sequencing chromosome 11 through scientists at the University of Delhi and chromosome 12 through scientists at the Indian Agricultural Research Institute. Indian scientists developed a physical map of the target regions, screened a BAC library to identify relevant BAC clones, constructed BAC contigs to cover 70% of the minimum tiling path, and worked to fill gaps in the physical map through chromosome walking and identifying additional BACs. Purity of identified BACs was also checked to ensure high quality sequencing.
Transgene-free CRISPR/Cas9 genome-editing methods in plantsCIAT
"Transgene-free CRISPR/Cas9 genome-editing methods in plants" by Matthew R. Willmann, Ph.D. Director, Plant Transformation Facility College of Agriculture and Life Sciences, School of Integrative Plant Science, Cornell University.
This document provides an overview of biotechnology principles and applications. It defines biotechnology as the application of technology to modify biological organisms by adding genes from other organisms. The document discusses how genes are identified, isolated, and manipulated to introduce desired traits. It describes techniques such as homology cloning, complementary genetics, and map-based cloning used to isolate genes. The document explains how genes are introduced into plants using transformation methods like Agrobacterium and biolistics. It provides examples of transgenic crops and their applications in agriculture.
This presentation highlights the basics and application of genome editing strategies in plants, strategies to reduce off-target mutation, identification of mutant analysis etc.
RNA-Seq Analysis of Blueberry Fruit Development and RipeningAnn Loraine
This document summarizes an RNA-Seq analysis of blueberry fruit development and ripening. Researchers sequenced RNA from five stages of fruit development to generate over 20 million reads per sample. Reads were aligned to the blueberry genome assembly to identify over 50,000 expressed genes and their expression profiles across stages. Analysis identified thousands of differentially expressed genes between stages and clusters of genes with similar expression patterns. Pathway analysis revealed metabolic pathways active during fruit development, including a potential new pathway for bixin biosynthesis with high expression during fruit maturation. Resources from the project include an online blueberry browser and gene expression data.
Multi Target Gene Editing using CRISPR Technology for Crop ImprovementTushar Gajare
This document provides an overview of a presentation on using CRISPR technology for multi-target gene editing in crop improvement. It begins with an introduction to genome editing and CRISPR-Cas9. It then discusses the CRISPR system, how CRISPR-Cas9 works, its history and applications for crop improvement including case studies in maize with high mutant efficiencies and targeted mutagenesis of multiple genes. The presentation covers advantages and limitations of the technology as well as future prospects.
An overview of agricultural applications of genome editing: Crop plantsOECD Environment
The presentation gives an overview of genome editing applications in relation to crop plants. The aim is to have a better understanding of the specific features of genome editing in comparison with classical breeding and genetic engineering techniques. It will give an overview of some examples of agricultural applications that may be on or close to the market or under research and development. It will also consider the possibility of foreseeing future applications (e.g. variations in CRISPR/Cas applications, DNA-free application, agricultural pest control), if possible.
This is a compilation of the Yeast genome project from the different databases and sources.
By:
Nazish Nehal,
M. Tech (Biotechnology),
University School of Biotechnology (USBT),
Guru Gobind Singh Indraprastha University (GGSIPU),
New Delhi (INDIA)
India has contributed to the International Rice Genome Sequencing Project by sequencing chromosome 11 through scientists at the University of Delhi and chromosome 12 through scientists at the Indian Agricultural Research Institute. Indian scientists developed a physical map of the target regions, screened a BAC library to identify relevant BAC clones, constructed BAC contigs to cover 70% of the minimum tiling path, and worked to fill gaps in the physical map through chromosome walking and identifying additional BACs. Purity of identified BACs was also checked to ensure high quality sequencing.
Transgene-free CRISPR/Cas9 genome-editing methods in plantsCIAT
"Transgene-free CRISPR/Cas9 genome-editing methods in plants" by Matthew R. Willmann, Ph.D. Director, Plant Transformation Facility College of Agriculture and Life Sciences, School of Integrative Plant Science, Cornell University.
The document discusses genome sequencing in vegetable crops. It provides an overview of the history and different generations of sequencing including Sanger sequencing, second generation sequencing using platforms like Roche 454 and Illumina, and third generation sequencing. It then summarizes key vegetables whose genomes have been sequenced like potato, melon, cabbage, and discusses findings from their sequencing projects including genome size, number of predicted genes, and genes of interest identified.
Whole genome sequencing of arabidopsis thalianaBhavya Sree
This document summarizes the genome sequencing of Arabidopsis thaliana. It discusses that genome sequencing approaches began being discussed in 1984 and the Human Genome Project officially began in 1990. The Arabidopsis genome project was initiated in 1990 and was completed in 2000, sequencing approximately 115.4 Mb and predicting 25,498 genes. The outcomes of the sequencing project included characterization of coding regions, comparative analysis between accessions and other plant genera, and integration of the three plant genomes.
RNA-Seq analysis of blueberry fruit identifies candidate genes involved in ri...Ann Loraine
I presented these slides at the Plant Metabolic Network workshop held at the Plant Animal Genome Conference (PAG) XXII, January, 2014. The main goals of the talk were to describe RNA-Seq based annotation of a blueberry genome assembly and explain how we used PlantCyc enzyme data to associate blueberry genes with metabolic pathways.
Base editing is being used to induce precise mutations in rice in order to accelerate crop improvement. Researchers developed a base editing-mediated gene evolution method to diversify the sequence of the rice acetolactate synthase 1 (OsALS1) gene, which codes for the target of herbicide resistance. Multiple sgRNAs were used to introduce mutations across the OsALS1 locus. Novel mutations were identified that conferred resistance to the herbicide bispyribac-sodium. The resistant mutation was then introduced into an elite rice cultivar through base editing to generate a new herbicide tolerant variety. This demonstrates how base editing can be used to artificially evolve genes and introduce beneficial traits into commercial crops.
This document summarizes a presentation on characterizing extreme diversity in the human genome using a single haplotype genomic resource called CHM1. The presentation discusses how CHM1, which is a hydatidiform mole genome, provides a highly contiguous single haplotype representation of the genome that can help identify misassemblies in the current reference genome and regions with high genetic variation. It also describes how finishing additional diverse genomes and incorporating them into a population reference graph could help make the reference more representative of human genetic diversity.
Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increa...apaari
Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity by MK Reddy during the Regional Expert Consultation on Gene Editing in Agriculture and its Regulations Technical Session III
This document provides an overview of CRISPR/Cas9 genome editing. It discusses the history and limitations of prior genome engineering techniques like recombinant DNA and zinc finger nucleases. It then explains how CRISPR/Cas9 works as a RNA-guided DNA endonuclease and how this allows it to efficiently and specifically edit genomes. The document outlines several applications of CRISPR/Cas9 like generating knockout animals and cell lines. It also notes some concerns about using the technique for human genome editing.
The next generation of crispr–cas technologies and Applicationsiqraakbar8
The document discusses recent advances in CRISPR-Cas gene editing tools, including Cas9, Cas12a, and Cas13a. It describes how these tools work, how they can be used to make various genomic alterations through DNA repair pathways, and potential applications for basic research and medicine. Specifically, it outlines ongoing clinical trials using CRISPR-Cas to treat genetic diseases.
This document summarizes Mohd Kyum's PhD research on using CRISPR/Cas9 genome editing to induce haploidy in rice. The objectives were to generate knockout mutants of the OsMATL gene, which is responsible for haploid induction in maize, using CRISPR/Cas9 RNP complexes delivered via particle bombardment. Embryos of the rice variety Purple Line were bombarded with three different sgRNAs targeting OsMATL. Regenerated T0 plants were analyzed for mutations in the target gene using techniques like T7E1 assay, PCR-RFLP, and sequencing. Putative mutant plants showed a transformation efficiency of around 12.5% and are being further analyzed to characterize mutations induced
Overview on arabidopsis and rice genomeGopal Singh
This document summarizes the sequencing of the Arabidopsis and rice genomes. It describes that Arabidopsis was the first plant and third multicellular organism to have its genome sequenced, which was completed in 2000 through an international collaboration. The rice genome sequencing project began in 1997 and was completed in 2005, providing a 389Mb sequence with 95% accuracy. Both projects used BAC and PAC libraries to sequence the genomes. The Arabidopsis genome is 115Mb across 5 chromosomes, while the rice genome is larger at 400-430Mb across 12 chromosomes.
Marker assisted selection (MAS) is a technique used in animal breeding that uses genetic markers linked to traits of interest to indirectly select desirable individuals. MAS can improve traits more efficiently than traditional breeding by selecting early in an individual's life. The key advantages of MAS are that it allows selection based on traits that are difficult to measure, for recessive genes, and faster than phenotypic selection. Future challenges include reducing costs and developing methods for large-scale genotyping to implement MAS in large breeding populations.
Genomic sequencing allows researchers to determine the order of DNA nucleotides in whole genomes. There are two main approaches - hierarchical shotgun sequencing and whole genome shotgun sequencing. Hierarchical shotgun sequencing was used for the Human Genome Project. It involves first creating a physical map using markers like RFLPs, VNTRs, and STSs. The genome is then broken into large clones which are sequenced and assembled based on the physical map. Advances in genomic sequencing have led to sequencing of many important genomes like yeast, nematode, rice, fruit fly, and human. Genomic sequencing provides valuable information about gene structure and organization and aids in understanding genome function and evolution.
Recombinant protein expression in E.coliajithnandanam
Recombinant Protein expression in E.coli, Best suitable strains for protein expression, advantages of using E.coli for choosing the host for protein expression
Advanced Genome Engineering Services and Transgenic Model Generation
at MSU’s Transgenic and Genome Editing Facility
Huirong Xie, Elena Demireva, Nate Kauffman, Richard Neubig
Manipulation of gene expression in prokaryotesSabahat Ali
For expression of gene in a particular vector, always used strong regulatable promoter (lac promoter, trp promoter, tac promoter , trc promoter, pL promoter, T7 gene promoter)
use of dual plasmid system & fusion proteins
How we can increase our protein product yield?
Targeted Breeding Applications of CRISPR-CasKate Barlow
Doane Chilcoat, Director, Applied Technology Systems, DuPont Pioneer
CRISPR-Cas as an advanced plant breeding tool is a more efficient way to improve plants and help farmers produce more and better food, with fewer resources. The superior properties of CRISPR-Cas allows DuPont Pioneer scientists to develop innovative and sustainable seed products for growers similar to those realized through conventional plant breeding, but with even greater efficiency, accuracy and quality. Pioneer is leading the application of this tool to develop customized agriculture solutions. In this talk, potential product targets of this promising technology will be discussed. Approaches to fostering social license and developing an open innovation model for CRISPR-Cas will also be reviewed.
The document discusses minichromosome technology in plants. It begins by defining a minichromosome as an extremely small version of a chromosome that carries genes and transfers genetic information autonomously. It then discusses how minichromosomes can be produced through telomere truncation or from pre-existing B chromosomes. The behavior of minichromosomes during cell division and meiosis is explained. Methods for manipulating genes on minichromosomes through site-specific recombination and gene stacking are also summarized.
This 11-day excursion provides a comprehensive tour of Bali's most prominent tourist destinations, including Uluwatu Temple, Batu Bulan village, Bali Museum, Mount Batur volcano, Bedugul, and Tanah Lot temple. Each day consists of sightseeing activities like cultural performances, temple visits, and natural landscapes. The itinerary includes pickups from the airport, hotel accommodations each night, breakfast daily, and transportation between destinations, offering tourists a fully guided tour of top attractions across the island for a total price of $2,200.
This document summarizes the key steps in a digital signal processing project on simulating a basic digital camera model. It discusses face detection using the Viola-Jones algorithm and Haar-like features. It then covers adding noise to images, designing mean and median filters to reduce noise, and optimizing filter performance. The document also discusses histogram equalization for color enhancement and a technique for contrast enhancement that considers color shifting and the human visual system.
The document discusses genome sequencing in vegetable crops. It provides an overview of the history and different generations of sequencing including Sanger sequencing, second generation sequencing using platforms like Roche 454 and Illumina, and third generation sequencing. It then summarizes key vegetables whose genomes have been sequenced like potato, melon, cabbage, and discusses findings from their sequencing projects including genome size, number of predicted genes, and genes of interest identified.
Whole genome sequencing of arabidopsis thalianaBhavya Sree
This document summarizes the genome sequencing of Arabidopsis thaliana. It discusses that genome sequencing approaches began being discussed in 1984 and the Human Genome Project officially began in 1990. The Arabidopsis genome project was initiated in 1990 and was completed in 2000, sequencing approximately 115.4 Mb and predicting 25,498 genes. The outcomes of the sequencing project included characterization of coding regions, comparative analysis between accessions and other plant genera, and integration of the three plant genomes.
RNA-Seq analysis of blueberry fruit identifies candidate genes involved in ri...Ann Loraine
I presented these slides at the Plant Metabolic Network workshop held at the Plant Animal Genome Conference (PAG) XXII, January, 2014. The main goals of the talk were to describe RNA-Seq based annotation of a blueberry genome assembly and explain how we used PlantCyc enzyme data to associate blueberry genes with metabolic pathways.
Base editing is being used to induce precise mutations in rice in order to accelerate crop improvement. Researchers developed a base editing-mediated gene evolution method to diversify the sequence of the rice acetolactate synthase 1 (OsALS1) gene, which codes for the target of herbicide resistance. Multiple sgRNAs were used to introduce mutations across the OsALS1 locus. Novel mutations were identified that conferred resistance to the herbicide bispyribac-sodium. The resistant mutation was then introduced into an elite rice cultivar through base editing to generate a new herbicide tolerant variety. This demonstrates how base editing can be used to artificially evolve genes and introduce beneficial traits into commercial crops.
This document summarizes a presentation on characterizing extreme diversity in the human genome using a single haplotype genomic resource called CHM1. The presentation discusses how CHM1, which is a hydatidiform mole genome, provides a highly contiguous single haplotype representation of the genome that can help identify misassemblies in the current reference genome and regions with high genetic variation. It also describes how finishing additional diverse genomes and incorporating them into a population reference graph could help make the reference more representative of human genetic diversity.
Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increa...apaari
Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity by MK Reddy during the Regional Expert Consultation on Gene Editing in Agriculture and its Regulations Technical Session III
This document provides an overview of CRISPR/Cas9 genome editing. It discusses the history and limitations of prior genome engineering techniques like recombinant DNA and zinc finger nucleases. It then explains how CRISPR/Cas9 works as a RNA-guided DNA endonuclease and how this allows it to efficiently and specifically edit genomes. The document outlines several applications of CRISPR/Cas9 like generating knockout animals and cell lines. It also notes some concerns about using the technique for human genome editing.
The next generation of crispr–cas technologies and Applicationsiqraakbar8
The document discusses recent advances in CRISPR-Cas gene editing tools, including Cas9, Cas12a, and Cas13a. It describes how these tools work, how they can be used to make various genomic alterations through DNA repair pathways, and potential applications for basic research and medicine. Specifically, it outlines ongoing clinical trials using CRISPR-Cas to treat genetic diseases.
This document summarizes Mohd Kyum's PhD research on using CRISPR/Cas9 genome editing to induce haploidy in rice. The objectives were to generate knockout mutants of the OsMATL gene, which is responsible for haploid induction in maize, using CRISPR/Cas9 RNP complexes delivered via particle bombardment. Embryos of the rice variety Purple Line were bombarded with three different sgRNAs targeting OsMATL. Regenerated T0 plants were analyzed for mutations in the target gene using techniques like T7E1 assay, PCR-RFLP, and sequencing. Putative mutant plants showed a transformation efficiency of around 12.5% and are being further analyzed to characterize mutations induced
Overview on arabidopsis and rice genomeGopal Singh
This document summarizes the sequencing of the Arabidopsis and rice genomes. It describes that Arabidopsis was the first plant and third multicellular organism to have its genome sequenced, which was completed in 2000 through an international collaboration. The rice genome sequencing project began in 1997 and was completed in 2005, providing a 389Mb sequence with 95% accuracy. Both projects used BAC and PAC libraries to sequence the genomes. The Arabidopsis genome is 115Mb across 5 chromosomes, while the rice genome is larger at 400-430Mb across 12 chromosomes.
Marker assisted selection (MAS) is a technique used in animal breeding that uses genetic markers linked to traits of interest to indirectly select desirable individuals. MAS can improve traits more efficiently than traditional breeding by selecting early in an individual's life. The key advantages of MAS are that it allows selection based on traits that are difficult to measure, for recessive genes, and faster than phenotypic selection. Future challenges include reducing costs and developing methods for large-scale genotyping to implement MAS in large breeding populations.
Genomic sequencing allows researchers to determine the order of DNA nucleotides in whole genomes. There are two main approaches - hierarchical shotgun sequencing and whole genome shotgun sequencing. Hierarchical shotgun sequencing was used for the Human Genome Project. It involves first creating a physical map using markers like RFLPs, VNTRs, and STSs. The genome is then broken into large clones which are sequenced and assembled based on the physical map. Advances in genomic sequencing have led to sequencing of many important genomes like yeast, nematode, rice, fruit fly, and human. Genomic sequencing provides valuable information about gene structure and organization and aids in understanding genome function and evolution.
Recombinant protein expression in E.coliajithnandanam
Recombinant Protein expression in E.coli, Best suitable strains for protein expression, advantages of using E.coli for choosing the host for protein expression
Advanced Genome Engineering Services and Transgenic Model Generation
at MSU’s Transgenic and Genome Editing Facility
Huirong Xie, Elena Demireva, Nate Kauffman, Richard Neubig
Manipulation of gene expression in prokaryotesSabahat Ali
For expression of gene in a particular vector, always used strong regulatable promoter (lac promoter, trp promoter, tac promoter , trc promoter, pL promoter, T7 gene promoter)
use of dual plasmid system & fusion proteins
How we can increase our protein product yield?
Targeted Breeding Applications of CRISPR-CasKate Barlow
Doane Chilcoat, Director, Applied Technology Systems, DuPont Pioneer
CRISPR-Cas as an advanced plant breeding tool is a more efficient way to improve plants and help farmers produce more and better food, with fewer resources. The superior properties of CRISPR-Cas allows DuPont Pioneer scientists to develop innovative and sustainable seed products for growers similar to those realized through conventional plant breeding, but with even greater efficiency, accuracy and quality. Pioneer is leading the application of this tool to develop customized agriculture solutions. In this talk, potential product targets of this promising technology will be discussed. Approaches to fostering social license and developing an open innovation model for CRISPR-Cas will also be reviewed.
The document discusses minichromosome technology in plants. It begins by defining a minichromosome as an extremely small version of a chromosome that carries genes and transfers genetic information autonomously. It then discusses how minichromosomes can be produced through telomere truncation or from pre-existing B chromosomes. The behavior of minichromosomes during cell division and meiosis is explained. Methods for manipulating genes on minichromosomes through site-specific recombination and gene stacking are also summarized.
This 11-day excursion provides a comprehensive tour of Bali's most prominent tourist destinations, including Uluwatu Temple, Batu Bulan village, Bali Museum, Mount Batur volcano, Bedugul, and Tanah Lot temple. Each day consists of sightseeing activities like cultural performances, temple visits, and natural landscapes. The itinerary includes pickups from the airport, hotel accommodations each night, breakfast daily, and transportation between destinations, offering tourists a fully guided tour of top attractions across the island for a total price of $2,200.
This document summarizes the key steps in a digital signal processing project on simulating a basic digital camera model. It discusses face detection using the Viola-Jones algorithm and Haar-like features. It then covers adding noise to images, designing mean and median filters to reduce noise, and optimizing filter performance. The document also discusses histogram equalization for color enhancement and a technique for contrast enhancement that considers color shifting and the human visual system.
This document contains a resume for Amol Warad, who has over 10 years of experience in IT roles including VMware and Windows administration, firewall administration, and networking. He currently works as the Manager of IT at Can-Pack India Pvt Ltd, where his responsibilities include managing Windows servers, VMware servers, routers, switches, backups, security software, and network uptime. He has previous experience in similar IT roles at other companies.
This document does not contain any substantive content to summarize. It only contains random characters without any meaningful words or sentences. Therefore, I am unable to provide a useful 3 sentence summary as there is no essential information to extract from the given text.
El documento proporciona 10 consejos para realizar actividad física en verano y evitar lesiones. Recomienda evitar el sobreentrenamiento dando tiempo al cuerpo para descansar y recuperarse; estirar con asiduidad para mantener la flexibilidad; respetar el principio de progresividad aumentando la intensidad gradualmente; mantener una alimentación e hidratación adecuadas; prevenir desequilibrios musculares con ejercicios de fortalecimiento; elegir un calzado apropiado; realizar calentamiento antes y después de la activ
The document discusses the benefits of exercise for mental health. Regular physical activity can help reduce anxiety and depression and improve mood and cognitive functioning. Exercise boosts blood flow, releases endorphins, and promotes changes in the brain which help regulate emotions and stress levels.
The document summarizes a meeting agenda discussing the Council on Rural Services' (CORS) non-federal match (NFM) status and continuous improvement efforts. It notes that CORS has requested an NFM waiver for the past two years and is on track to need another waiver. Presenters will provide an overview of NFM requirements, the current NFM shortfall, and opportunities for maximizing NFM sources going forward in compliance with federal regulations.
The document describes 6 title cards for a film. Each title card will have a ghostly, glitching effect where the text continuously moves to different spots quickly. The title cards will appear at various times from 00:40 to 02:55 and will include the film's title, release date, production company, and theater announcement. The font size will range from 40pt to 100pt depending on what information is being displayed.
This document discusses strategies to improve chickpea productivity in marginal environments in sub-Saharan Africa and South Asia. It outlines genomic and genetic resources developed, including reference sets, genetic maps, genome sequencing, and marker assays. It also describes trait mapping efforts identifying QTL for drought tolerance. Molecular breeding approaches like MABC, MARS, and genomic selection are discussed along with efforts to build capacity in national agricultural research systems in these regions.
RNA-Seq transcriptome analysis of Gonium pectorale cell cycleJennifer Shelton
This document summarizes an RNA-Seq analysis of the cell cycle transcriptome in the multicellular green alga Gonium pectorale. RNA was collected from G. pectorale cells across four time points in the cell cycle and sequenced. Differentially expressed genes were identified, including genes related to mitosis that were highly expressed at specific time points. Preliminary hierarchical clustering analysis grouped genes by expression patterns across the cell cycle. The goal is to compare the G. pectorale cell cycle transcriptome to Chlamydomonas to investigate changes in gene expression related to the evolution of multicellularity.
The document discusses using genotyping-by-sequencing (GBS) to analyze the population structure and genetic diversity of African cassava. GBS was performed on over 3,300 cassava samples from germplasm banks across Africa. Analysis identified about nine subpopulations and showed that improved varieties have ancestry from multiple subpopulations. GBS can help breeders better understand cassava diversity and develop genomic tools and resources to accelerate cassava breeding.
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle.Jennifer Shelton
This document summarizes Dr. Tara N. Marriage's RNA-Seq analysis of the cell cycle transcriptome in the multicellular alga Gonium pectorale. RNA was extracted from G. pectorale cells collected hourly across a 24 hour period and pooled into time points corresponding to different cell cycle phases. RNA-Seq libraries were constructed and sequenced, and the reads were mapped and analyzed for differential gene expression. Preliminary results identified over 2400 differentially expressed genes across the cell cycle and hierarchical clustering of expression profiles. Several key cell cycle genes were found to be differentially expressed during mitosis. The analysis is ongoing to further investigate cell cycle regulation and changes contributing to multicellularity in Gonium compared
Modern techniques of crop improvement.pptx finalDr Anjani Kumar
This document discusses modern techniques for crop improvement, including genome editing, gene silencing, cisgenics, site directed mutagenesis, and programmed cell death. It begins with an introduction noting the increasing global population and need to improve crop yields. Genome editing uses engineered nucleases to insert, delete, or replace DNA in living organisms. CRISPR/Cas9 is highlighted as a powerful and precise genome editing technique. Gene silencing techniques like RNA interference can be used to "switch off" genes and improve crop traits. These modern techniques allow for more targeted genetic modifications of crops compared to traditional breeding methods and have potential for meeting future agricultural demands.
This document provides an overview of rice genomics. It discusses the history of genomics from the 1980s development of DNA markers and PCR, to major milestones like the sequencing of rice genomes in 2002. It describes the International Rice Genome Sequencing Project's clone-by-clone sequencing approach. The rice genome was found to contain over 37,000 genes and significant repetitive elements. Comparative genomics with other cereals revealed conserved synteny. The 3,000 Rice Genomes Project aims to sequence a diverse set of rice varieties to explore genetic diversity.
This document summarizes the progress of sequencing the Medicago truncatula genome. Key points include:
- M. truncatula is an important forage crop and model legume with a relatively small genome that is being sequenced to further legume research.
- Initial whole genome shotgun sequencing at low coverage identified highly repetitive regions. A mapped BAC approach is now being used.
- Over 1,000 BACs have been sequenced with a goal of completing the euchromatic regions of four chromosomes. Other chromosomes are being sequenced at other institutions.
- Gene predictions from the sequenced data find a gene density of about one gene per 6.5-7.6 kb and over 13,000 genes identified
This document discusses high-throughput DNA sequencing technologies and their application to genome assembly projects. It provides a brief history of DNA sequencing, from early chemical and chain termination methods to current massively parallel sequencing technologies. It also describes several long-read sequencing technologies, including Pacific Biosciences SMRT sequencing and Oxford Nanopore sequencing. Examples are given of genome projects utilizing these technologies along with short-read sequencing data.
Genome editing with engineered nucleasesKrishan Kumar
Genome editing uses engineered nucleases to insert, replace or remove DNA from the genome. These nucleases create targeted double-strand breaks which are repaired through natural DNA repair processes, allowing for changes to the genome sequence. Three main engineered nuclease systems for genome editing are ZFNs, TALENs, and CRISPR-Cas9. CRISPR uses a guide RNA and Cas9 nuclease to make precise cuts at targeted DNA sequences for editing. It has advantages over ZFNs and TALENs in being cheaper, easier to design, and more efficient. Genome editing holds promise for applications in crops, medicine, and research.
Functional annotation of invertebrate genomesSurya Saha
Functional annotation of the Asian citrus psyllid genome identified genes, assigned gene ontology terms, and mapped genes to pathways. Gene ontology and pathway analysis of differentially expressed genes between infected and uninfected psyllids identified enriched terms involved in the cytoskeleton, endocytosis, and mitochondrial dysfunction. Improved functional annotation using GOanna added depth to the gene ontology annotation and identified additional enriched pathways related to response to hypoxia and regulation of cytoskeletal remodeling.
PAGAsia19 - The Digitalization of Ruili Botanical Garden Project: Production...GigaScience, BGI Hong Kong
A 3 part talk presented at PAG Asia 2019 in Shenzhen- The Digitalization of Ruili Botanical Garden Project: Production, Curation and Re-Use. Presented by Huan Liu (CNGB), Scott Edmunds (GigaScience) & Stephen Tsui (CUHK). 8th June 2019
The document summarizes research on temperate bacteriophages that infect mycobacteria. It describes isolating two new phages, Hetaeria and QuinnKiro, and characterizing their genomes, which were found to contain stoperator sequences near genes related to lysis. Mass spectrometry analysis of infected cells identified over half of predicted proteins in Hetaeria, revealing functions and modifications. Future work aims to compare proteomics of lytic and temperate phages.
Access to large-scale omics datasets i.e. genomics, transcriptomics, proteomics, metabolomics, phenomics, etc. has revolutionized biology and led to the emergence of systems approaches to advance our understanding of biological processes. With decreasing time and cost to generate these datasets, omics data integration has created both exciting opportunities and immense challenges for biologists, computational biologists, biostatisticians and biomathematicians. Genomics, transcriptomics, proteomics, and metabolomics together they help to bring out the best of characters in plants.
This document summarizes the work of Hans Jansen and Christiaan Henkel with long read nanopore sequencing. They have sequenced several genomes including carp, eel, king cobra, and Agrobacterium using MinION. Their longest reads were 120 kbp and 93.5 kbp. They also established the MinION Access Program to improve genomes by resolving repeats. As part of this, they formed the MinION Analysis and Reference Consortium to standardize protocols and understand variability between labs. Their work with the E. coli genome demonstrated sources of variation in read counts, lengths, and alignments between labs.
Establishment of an in vitro propagation and transformation system of Balani...PGS
This lecture was a part of Plant Genetics Seminars - PGS 2017/2018 at Assiut University. These seminars organized by Dr. Ahmed Sallam, Department of Genetics, Faculty of Agriculture, Assiut University
Abstract
Balanites aegyptiaca is a drought-tolerant but salt-sensitive tree species distributed in the tropical and arid lands in Africa and Asia; the seeds were used in biodiesel production. This study aimed to establish an in vitro propagation system of two B. aegyptiaca provenances from nodal and cotyledon explants. The explants were placed on Murashige and Skoog medium supplemented with different concentrations of 6-benzyladenine (BA) and thidiazuron (TDZ) for shoot induction. BA was significantly more effective in shoot induction from nodal explants. Three different Agrobacterium tumefaciens strains (EHA105, GV3101, and LBA4404) harboring the plasmid pCAMBIA2301 containing the nptII marker and gus reporter genes were used to establish a transformation system in B. aegyptiaca. Strain GV3101 resulted in the highest survival rates and highest number of explants positive in the GUS assay. This selected A. tumefaciens strain was used to introduce pBinAR containing the sequence encoding ERD10 (early responsive to dehydration 10) to produce salt-tolerant B. aegyptiaca plants.
This document summarizes a presentation on using CRISPR-Cas9 for crop improvement. It begins with an introduction to CRISPR-Cas9 and how it is used to edit genomes by removing, adding, or altering DNA sequences. It then discusses the mechanism of the CRISPR-Cas9 complex and how it creates breaks in DNA that are repaired. The document reviews several case studies where CRISPR was used to modify crops, including creating low-gluten wheat and improving rice. It finds that CRISPR can efficiently edit multiple genes simultaneously with few off-target effects. The conclusion states that CRISPR is revolutionizing agriculture by enabling the creation of higher yielding, more resistant crop varieties without transgenes.
This document discusses cisgenesis and intragenesis, which involve genetically modifying a crop plant using genes isolated from a crossable donor plant or from the same plant species, respectively. It defines cisgenic and intragenic plants and outlines their similarities and differences. It describes the prerequisites and various methods for constructing intragenic vectors and producing marker-free cisgenic/intragenic plants. The document presents several case studies demonstrating the development and evaluation of cisgenic plants with improved disease resistance. It discusses regulations around cisgenic/intragenic crops in different countries and potential benefits compared to transgenic and conventional breeding approaches.
Crop genetic improvement and utilization in china. xinhai liExternalEvents
This document summarizes a case study on crop genetic resources in China. It discusses 1) the collection and conservation of crop germplasm resources in China through various national actions, 2) genomic characterization of crops like rice, wheat, millet, cotton through genome sequencing efforts that have identified genes for traits like yield, quality and stress resistance, and 3) advances in crop molecular breeding in China using techniques like marker-assisted selection, double haploid breeding, and transgenic breeding to develop new crop varieties with desired traits. The document concludes with perspectives on further improving germplasm through basic research and using novel techniques.
Next Generation Sequencing Technologies and Their Applications in Ornamental ...Ravindra Kumar
This document summarizes research on DNA sequencing and genome sequencing techniques. It discusses early Sanger sequencing and the development of next-generation sequencing platforms like Roche 454, Illumina, Ion Torrent, and SOLiD. The document also presents two case studies, one on sequencing the carnation genome and another on obtaining the rose transcriptome to identify genes related to traits of interest. Overall, the document provides a high-level overview of the evolution of DNA sequencing technologies and their applications in sequencing plant genomes and transcriptomes.
This document summarizes Sujai Kumar's presentation on insights into planarian regeneration from sequencing the genome of Girardia tigrina. Key points include:
1) G. tigrina is a freshwater planarian species with remarkable regenerative abilities. Sequencing its genome provides resources to study the genetic basis of regeneration.
2) Kumar's team generated a draft genome assembly, predicted genes, and performed functional annotation to create genomic resources for G. tigrina.
3) These resources are being used to identify genes and pathways involved in regeneration, perform orthology analysis across species, and study cis-regulatory elements in regeneration.
Similar to Towards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremy (20)
This document discusses human genetic variation and provides an activity to demonstrate it. It begins by explaining that while humans share 99.9% identical DNA, the 0.1% difference accounts for phenotypic diversity. An activity asks students to inventory traits in pairs, finding most are similar but some differ. Histograms show traits like sex are discrete while height is continuous. The document then presents an activity where students "roll through life" and track behavioral choices and genetic risks to see how they interact to impact health outcomes like heart attacks. It aims to show how genetics and environment combine to influence health and disease.
William Arndt increased the performance of HMMER3 on Genepool by modifying it to use buffered I/O and multiple threads more efficiently. The original HMMER3 was inefficient because it read sequence files from disk repeatedly instead of buffering them in memory. The modified version stores sequences and HMMs in buffers that multiple threads can search simultaneously, reducing I/O time from 25% to less than 1% and allowing full utilization of Genepool nodes. Future work includes porting these improvements to other NERSC systems and upgrading algorithms to use modern vector instructions.
The document compares the hg19 and hg38 versions of the human genome reference. It notes that hg38 includes 261 alternative loci compared to only 9 in hg19. hg38 also includes non-nuclear genomes while hg19 did not. The presence of alternative loci adds complexity to RNA-seq quantification by mapping reads to multiple locations, though overall gene expression levels remain highly correlated between the two references.
LAB SET-UP INSTRUCTIONS FOR EXERCISES ON AMAZON EC2Shaojun Xie
This document provides instructions for setting up a Red Hat Enterprise Linux 7 virtual machine on Amazon EC2 to use for completing exercises in a Red Hat course. It describes creating a free AWS account, launching a t2.micro instance of RHEL7 using the AWS console, and connecting to the instance securely over SSH using the private key that is downloaded during instance launch. The document stresses the importance of shutting down the instance when not in use to conserve compute hours provided by the AWS Free Tier.
This document summarizes the steps taken in an ATAC-seq analysis: 1) Process and align the reads using Bowtie2 and samtools; 2) Call peaks using various peak callers such as PeaKDEck and HOMER; 3) Investigate the location of peaks and find they are enriched near transcription start sites and correlated with gene expression. The analysis resulted in identifying around 30,000 open regions covering 8 million base pairs of the genome on average.
Variation in crop genomes and heterosis Shaojun Xie
Variation in crop genomes and heterosis
This document discusses sources of genetic variation in crop genomes including single nucleotide polymorphisms, insertions/deletions, transposons, epigenetics, and expression level differences. It explores how prevalent these types of variation are and how they behave in plant breeding. The document also discusses heterosis, or hybrid vigor, and how transgressive segregation contributes to phenotypic diversity. Molecular mechanisms underlying heterosis like dominance, overdominance, and gene expression levels in hybrids are examined. While many genes are expressed at mid-parent levels in hybrids, some are uniquely present or expressed. The potential role of improved gene interactions restoring proper developmental transitions and stress responses in hybrids is proposed.
Walmart Business+ and Spark Good for Nonprofits.pdfTechSoup
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...Diana Rendina
Librarians are leading the way in creating future-ready citizens – now we need to update our spaces to match. In this session, attendees will get inspiration for transforming their library spaces. You’ll learn how to survey students and patrons, create a focus group, and use design thinking to brainstorm ideas for your space. We’ll discuss budget friendly ways to change your space as well as how to find funding. No matter where you’re at, you’ll find ideas for reimagining your space in this session.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
Towards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremy
1. 1
Towards a Reference Genome for
Switchgrass (Panicum virgatum)
Jeremy Schmutz, Jarrod Chapman,
Jerry Jenkins, Jane Grimwood, Kerrie
Barry, Gerald A. Tuskan, Daniel S.
Rokhsar & many others
2. DOE Joint Genome Institute
Mission: Serving as a genomic user facility in support of DOE mission science
• Funded by Biological Environmental Science (BER)
• Walnut Creek, CA
• ~270 employees
• HiSeq (9), MiSeq (6), PacBio (2), 454 (1)
• Includes partner laboratories such as HudsonAlpha
funded for specific goals
Bioenerg
y
Carbon cycling Biogeochemistry
Plants FungiMicrobes Metagenomes
2
3. JGI & BRCs
• Development of next-generation
bioenergy crops
• Discovery and design of enzymes and
microbes with novel biomass-degrading
capabilities
• Development of transformational
microbe-mediated strategies for biofuel
production 3
4. JGI Plant Program
Flagship Plant Genomes
Flagship
Comparative
Genomics
Resequencing
& Population
Diversity
Transcriptomics
& sequence based functional assays for
Flagship Plants
Community Organization
Plant
Customi
-zation
QTLs and
Genotype/
Phenotype
Links
4
5. JGI Plant Flagship Genomes
1. Provide complete genomic resources and
genomes of direct DOE mission importance
2. Support efforts for cellulosic biofuel
development and feedstock customization
3. Foster communities to develop research
programs around DOE plants
4. Build a solid foundation for diversity and
functional studies
5
7. Introduction to switchgrass
Plus:
• High cellulosic yields, marginal land, low input
plant
• Existing agronomy knowledge and breeding
from planting as a forage crop
• Perennial crop which can be annually harvested
after establishment
• Widespread native species in North America,
resistant to American pests
• Presumably large adaptive variation across the
growing regions
Minus:
• Widespread native species in North America,
very difficult to contain large scale plantings of
improved varieties
• Obligate outcrossing polyploid species 7
8. Switchgrass is difficult
Obligate outcrossing tetraploid!
• Difficult to inbreed
• 4 copies of genes (or maybe 2,
or 1 or more)
• Variation within and between
subgenomes
• Genome is only a reference for
one plant AP13, not for all
switchgrass or even all
Panicum virgatum individuals A1 A2 B1 B2
A C A A
A A C C
A T C G
C C
8
10. Switchgrass Reference Project
• Goal : Produce a reference genome of AP13
that can be used for everything from marker
assisted breeding and QTL identification to
direct functional work on understanding cell
wall biosynthesis
• Project has spanned several phases:
1. Resource development
2. Initial whole genome shotgun sequencing (v0.0)
3. Localization and assembly on chromosomes
(v1.0)
4. Ongoing improvement through direct
sequencing of localized regions (v2.0)
10
11. Project origins
• Started as a BRC project to
produce a reference genome
(initiated by JBEI in Nov.2008)
• Cultivar selected by the group:
Alamo AP13
• DNA was isolated by Jeff
Bennetzen’s group @UGA and
Rod Wing’s group@AU for BAC
libraries and sequencing
• Began sequencing in early 2010,
work for developing resources
was in progress
11
13. BAC libraries & BES
• Generated BAC libraries with 2
cut cites, 330k BES and some
clone based sequencing,
average insert size 110kb and
144kb.
• Clones available from CUGI
www.genome.clemson.edu
With: Pam Ronald’s Group @ JBEI
PLOS1 April 2012, Shama et al.
13
14. EST & transcripts
• 510,000 Sanger ESTs from 9 tissues with C. Tobias
• 169,079 Sanger ESTs from cell wall, 11.5 million 454
ESTs from VS16 and AP13 with BESC/Noble
Table 1. Switchgrass 454-cDNA libraries and 454-ESTs
NCBI SRA
accession #
JGI lib
code Tissues
Plant growth
stage/conditions
# of good
ESTs
Mean
length (bp)
Summer VS16 454 data
SRX026147 CFBB Whole shoot Leaf development 259,106 201
SRX026148 CFBC Whole root Leaf development 205,466 222
SRX026149 CFBF Whole shoot Stem elongation 194,426 194
SRX026150 CFBG Whole root Stem elongation 174,053 190
SRX026151-2 CFCZ Whole shoot Reproductive stage 219,230 189
SRX026153-4 CFFA Whole root Reproductive stage 234,107 205
SRX026155-6 CFFB
Panicles
including seeds Reproductive stage 220,933 212
1,507,321 202
Alamo AP13 454 data
SRX057824 CCXN Whole shoot Stem elongation 733,173 202
SRX057825 CCXO Whole root Stem elongation 667,612 206
SRX057830 CFXX Whole shoot Leaf development 1,236,020 419
SRX057831 CFXY Whole root Leaf development 1,214,630 375
SRX057828 CFXW Whole shoot Stem elongation 1,357,290 223
SRX057829 CGGO Whole root Stem elongation 1,040,192 404
SRX057827 CGFF Whole shoot Reproductive stage 547,278 320
SRX057826 CGFC Whole root Reproductive stage 998,691 388
SRX057834 CGTX
Panicles
including seeds Reproductive stage 1,096,949 384
SRX057833 CGFI Whole shoot
Stem elongation 2
w/drought 362,346 213
SRX057832 CGGU Whole root
Stem elongation 2
w/drought 918,585 337
10,172,766 316
11,680,087
Sub-total
Total
Sub-total
Development of an integrated
transcript sequence database and a
gene expression atlas for gene
discovery and analysis in switchgrass
(Panicum virgatum L.) – Zhang et al.
2013 Plant Journal.
http://switchgrassgenomics.noble.org
14
15. Foxtail millet
• Foxtail millet sequenced with 8x sanger sequence
• Demonstrate using it as a comparative basis to
reconstruct switchgrass chromosomes
Nature Biotech May 13, 201215
17. Tetraploid Switchgrass
Began with 8.3x 454 linear sequencing and added 6.5x
454 XLR+ longer sequencing (14.5x total coverage)
78% longer read length
54% longer HQ length
2x the yield per run
17
18. V0.0 Release PAG 2012
• Linear 454 > 200 bp
• Sampled both the “A”
and “B” genomes in
the tetraploid
• Assembled using
Newbler V2.6
• Results:
• Contig N50 of 3.8 Kb
• 1.466 Gb of total
sequence assembled.
• 80 contigs > 50 Kb
• 1,663 contigs > 25Kb
18
19. Annotation?
• Annotation was based solely
on Sanger ESTs homology
(foxtail millet, rice,
Brachypodium, and
sorghum)
• 65,878 total loci containing
protein-coding transcripts
• 4,193 total alternatively
spliced transcripts
For primary transcripts:
• Average number of exons: 4.1
• Median exon length: 160
• Median intron length: 126
• Complete genes: 47,302
• Incomplete gene with start codon: 5,862
• Incomplete gene with stop codon: 10,459
19
20. Is this a genome?
How do we organize these fractured 410k
pieces into a reference genome and put
them into the correct subgenome?
The Map! The Map! The Map!
20
21. Genetic map AP13 x VS16
Switchgrass mapping population planted out at Noble
21
22. Mapping strategy
VS16
250 offspring (F1) of VS16xAP13
sequenced in pools of 10-12 (depth <~1X)
Find short sequences that are:
(1) Polymorphic in one parent
(2) Found in only one subgenome
(3) Not found in the other parent
These are simple markers to track by
resequencing F1 offspring.
Directly observe recombination in the
polymorphic parent.
AP13
X
Select markers like:
AAAAAAAATCTCGTATGCATGGAGTACTAAATGAAGTCTATTTGCAAAAC A 15 T 12
AAAAAAAATCTCTCCAGGGCAAAAATAAAAAAATGAAAAAGAAAAAAAAA A 13 C 14
AAAAAAAATCTTCGTGAGGAATTTTCTGTGCACTTTAAGTCTTCAATAAC A 12 G 14
113,325 AP13-derived markers and 236,622
VS16-derived markers
Mapping population: Malay Saha
Map development: Jarrod Chapman 22
23. Initial VS16 map examples
First round of the map based on 106 offspring
and VS16 specific subgenome differences and
covers ~87K markers 23
24. New map examples
1. Second mapping
round uses all 250
offspring, AP13
subgenome
differences
2. Added additional
markers from WGS
assembly
3. 130k typed
subspecific genome
markers + 418k
markers that are
linked to these
24
26. Organizing assembly with map
• Original Newbler Assembly:
• 14.5x read coverage
• 556,117 contigs (1,466.3 Mb)
• V0.0 Release at PAG Jan 2012:
• 410,030 contigs (1,358.1 Mb)
• 73,010 contigs (426 Mb) mapped
and annotated to 21,624 FTM
genes.
26
27. 27
Bin contigs into
Linkage Groups
(189,942 binned)
Subgenome
duplicates
(35,683 removed)
Collapse
subgenomes
contigs
(36,467 collapsed)
Scaffold each
linkage group using
5.5x, 2x250, 800bp
MiSEQ
Scaffold using 18x,
2x100, 4KB & 5kb
LFPE
Scaffold using 6x,
2x100, 9kb LFPE
Eliminate
redundant ends on
adjacent scaffolded
contigs
Position scaffolds
on genetic map
THIS SYSTEM IS NOT STATIC AND IS EASILY EXTENDED TO INCLUDE
ADDITIONAL DATA, CLONE SEQUENCE, LONG READ DATA, …
Assembly process
Order scaffolds
using P. hallii
synteny
Starting with
117,792 contigs
Scaffolding Performed
Using Abyss
28. Panicum hallii (panic grass)
28
Panicum hallii
• Native southwest grass
• Closely related (~4 MYR) to
tetraploid switchgrass
• Drought tolerance model
• 660Mb, mostly inbred
• w/Tom Juenger at UT-Austin
29. P. Hallii synteny
• 31mers used to identify shared
content
• P. virgatum scaffolds binned
on P. hallii
• Orientation of P. virgatum
scaffolds relative to P. hallii
determined using BLAT
65 P. virgatum
scaffolds ordered on
P. hallii super_61
Before After
29
30. 30
CHR 01: 2,291 corrections, 459 bp average
(100bp to 4KB), 1.05 Mb removed from 44.7 Mb
Adjacent subgenome duplicates
Original scaffold
Corrected scaffold (1.4kb eliminated)
31. Map Integration
• 548,932 AP13 specific subgenome
markers used to position scaffolds and
syntenic blocks
• 56,088 map joins (with 10kb Ns) were
made for 18 (2x9) linkage groups
• Map positions contain sizable blocks of
contigs (10-20) that align to the same map
position, cannot be ordered or orientated-
placed within the context of other
scaffolds
31
34. Clone alignments against scaffolds
34
158KB clone on syntenic block 107KB clone on syntenic block
35. Chromosome Assignments
• Asked switchgrass “power” users for recommendation
on naming
• Assigned using shared 21mer content with S. italica
• Designation of "a" assigned to the P. virgatum LG that
contained more shared 21mers with S. italica
35
36. Panicum virgatum V1.0 release
36
• Read coverage: 14.5x
• Release size: 1.22 Gb
• Contig L50: 5.7 KB
• 636.1 MB of sequence
in chromosomes
• 593.4 bits off
chromosomes,
includes duplicate
sequences
37. Annotation – resources
• Latest JGI pipeline for integrating RNA-seq data and
available EST data
• Included: Original sanger ESTs, 454 ESTs, minimal
FLcDNAs, 370 million pairs from GLBRC cultivars,
710 million pairs of RNA-seq data from germinating
seed, stem-node, stem-internode, blade, immature
flower
• Homology: rice, brachy, foxtail, sorghum, maize,
arabi, soybean, poplar and swiss prot
37
39. Annotation results
• Primary transcripts (loci): 98,007
• Alternative transcripts: 27,432
• Total transcripts: 125,439
• For primary transcripts:
– Average number of exons 3.9
– Median exon length 183
– Median intron length 133
39
Length EST support Peptide homology
100% 57,584 7,311
95% 62,327 33,251
90% 63,848 41,653
75% 66,121 58,319
50% 68,391 77,960
PLEASE
DO NOT
GET ATTACHED
TO GENE NAMES!
41. Paralogous gene analysis
41
• Genes “A”, “B”, and remaining
contigs aligned using BLASTP
• Alignments Screened:
• >80% identity and >80%
coverage
• Length of query and target
amino acid sequences had to be
within 20% of one another
• There are a total of:
• 29,357 “A” genes
• 27,522 “B” genes
• 41,128 genes in remaining
contigs
• 98,007 total genes
42. SNP rates in chromosomes
42
AP13 VS16
Heterozygous SNPs 1,449,600 581,106
Homozygous SNPs 10,406 1,482,882
Heterozygous INDELs 864 924
Homozygous INDELs 1,920 9,391
Assembly Length 1,103.8 Mb 1,103.8 Mb
Callable Bases 466.0 Mb 241.6 Mb
Heterozygous Rate (Callable) 3.111 per Kb 2.405 per Kb
Homozygous Rate (Callable) 0.022 per Kb 6.137 per Kb
44. Towards switchgrass 2.0
1. Build new AP13 and VS16 maps from recent
sequence data (116 genotypes + 250 originals) to
help with subgenome localization
2. Upgrade mate pair data for AP13 to new, longer,
better, stronger mate pairs
3. Continue directed clone based sequencing of
switchgrass important regions
4. Version 2.0 of the genome with ~3-400Mb of locally
sequenced contigs, integrated into chromosomes
44
PLEASE
DO NOT
GET ATTACHED
TO ORDER!
45. Improvement project
45
Short Scaffolds: Selected
properly projecting clones.
??
Not
Selected
Selected
Cell Wall EST
Redundant
Clone
Long Scaffolds: Tiling path covering cell wall genes.
Long
Scaffs
Short
Scaffs
Total
Chromosomes 335 3,237 3,572
Remaining 6 1,182 1,188
Total 341 4,419 4,760
46. Improvement project
46
• 96 well clone based pool with individual indexes
• Sequenced as 2x250 on HiSeq2500, assembled and minimal
manual finishing
• Add 96 paired, sized libraries run as ¼ MiSeq run as needed
47. Switchgrass V2.0
47
Bin contigs and
clones into linkage
Groups
Remove
subgenome
duplicates from
clones and contigs
Scaffold each
linkage group using
2x250, 800bp pairs
Scaffold using LMP
pairs
Eliminate
redundant ends on
adjacent scaffolded
contigs
Position scaffolds
on genetic map
Order scaffolds
using P. hallii
synteny
New
Genetic
Map
WGS
Contigs
Clone
Contigs
New
HiSeq
Frags
New
LMP
Pairs
New
Genetic
Map
48. Current JGI switchgrass projects
1. Community diversity project for up to 50 genotypes (12
sampled to date) – Laura Bartley
2. eQTL study of 90 genotypes (2 samples per) for biomass/cell
wall trait variants – with Laura Bartley and Malay Saha
3. BRC switchgrass projects, QTL mapping, engineered mutants
48
Purpose Class Targets Genotypes Contributors
Support Genetics
Mapping
Parents
Biparental mapping parents,
NAM parents
22
Saha, Brummer,
Tobias, Wu,
Bonos
Diversity
Each phylogenetic group
from Lui et al. 2012,
including octaploids;
Mexican and NE accessions
9
Casler, Auer,
Juenger
Genome Stucture
Determination
Genomic
variants
dihaploid, selfed,
intermediate genome size
10
Wu, Tobias,
Brummer
Baseline Data
Interesting
phenotypes
Transformed genotype,
Other
1 Wang
Current total 42
49. Panicum hallii projects
1. Produce draft assembly V1.0 for Panicum hallii
2. Diploid panicum eQTLs for segregating
drought/biomass traits in HAL x FIL cross
3. Diversity sampling
49
Hall’s Panicgrass diversity west Texas
to east Texas, Juenger Lab FIL2HAL HAL X FIL2
51. Acknowledgments
DOE JGI
Jane Grimwood (HA)
Jerry Jenkins (HA)
Jarrod Chapman
Shengqiang Shu
Dan Rokhsar
Kerrie Barry
BESC
Gerald Tuskan, ORNL
Katrien Devos, UGA
Yi-Ching Lee, Noble
Malay Saha, Noble
Michael Udvardi, Noble
Jiyi Zhang, Noble
JBEI
Pam Ronald, UC-Davis
Manoj Sharma, UC-Davis
Rita Sharma, UC-Davis
Others
Laura Bartley, OU
Christian Tobias, SGEC
Chris Saski, CUGI (BAC libs)
Tom Juenger, UT-Austin
Funding Sources
DOE DE-AC02-05CH11231
ARRA UC Berkeley
51
52. Questions for discussion
• How often should we update the
switchgrass genome and annotation?
• What else can the JGI do that would be
immediately useful for the switchgrass
community?
• JGI CSP2015 deadline for LOI will be
March 2014
• Comprehensive community proposals are
greatly preferred!
52