This is the question For topic approval, you must include more.docx
•Download as DOCX, PDF•
0 likes•2 views
This is the question : For topic approval, you must include more specifics. For example, when I read your title, I am not specifically sure what your research will cover. Cyber Security is the Highest Threat to the IoT Infrastructure in what? In Heathcare? In What? Can you add something here to the title? IoT is a new age networking technology that has loop holes that are accessible to hackers and malware which can in turn destroying a network that an IoT device might be connected to, consequently, this means that there are many security vulnerabilities that need to be resolved in the network and hardware levels where? Do you have research (references) to back this up? For this study, the most valid population will be parties that have interacted with IoT devices in their homes and offices... ..........The population must be better defined. How would you apply qualitative and quantitative? For example, will one of your data collection methods be surveys or interviews? If so where would these interviews be conducted. Do you have access to your population? .
Report
Share
Report
Share
Recommended
Below are various theories and models that have been used and can 
Below are various theories and models that have been used and can be used in research (from Dr. Steve Brown)
Behavioral et. al.
Absorptive capacity Theory
Accountability Theory
Activity Theory
Adaptive Structuration Theory
Administrative Behavior Theory
Argumentation Theory
Asch Conformity
Behavioral Decision Model
Belief Action Outcome Framework
Chaos Theory
Cognitive Fit Theory
Cognitive Load Theory
Cognitive Behavioral Therapy
Classical Conditioning
Conditioned Emotional Response
Cognitive Dissonance
Cognitive “purposive” Behaviorism
Consequentialist Ethics
Critical Theory
Csíkszentmihályi’s Flow
Cultural Theory
Deontological Ethics
Diffusion of Innovations Theory
Dynamic Capabilities
Distributed Cognitions Theory
Embodied social presence theory
Equity theory
Evolutionary theory
Eysenck’s Theory
Expectancy-value theory
Expectation Confirmation Theory
False Memory Syndrome
Field Theory
Fishbein's Attitude
General Deterrence Theory
Gestalt Theory of Personality
General Strain theory
Goal Contagion Theory
Gompertz Model (based upon Social Conflict Theory)
Grounded Theory
Hermeneutics
Illusion of Control
Impression Management Theory
Information Processing Theory
Impression Management Theory
Information Asymmetry Theory
Information Security Management Theory
Institutional Theory
Integrated Systems Theory
Keller's Motivational Model
Language action perspective
Law of Effect
Law of Emotion
Learned Helplessness Theory
McClelland’s Needs Theory
Neutralization Theory
Operant Conditioning
Mitchel’s Personality theory
Prospect Theory
Protection Motivation Theory
Self Determination Theory
Self-Efficacy Theory
Social Action Theory
Social Conflict Theory
Social Cognitive Theory
Social Exchange Theory
Social Identity Theory
Social Influence Theory
Social Learning Theory
Socio Technical Systems Theory
Task Closure Theory
Technology Acceptance Model
Technology Threat Avoidance Theory
Theory of Contextualism
Theory of Contiguity
Theory of Equipotentiality
Theory of Planned Behavior
Theory of Protection Motivation
Theory of Reasoned Action
Theory of Planned Behavior
Trait Theory
Virtue Ethics
Unified theory of acceptance and use of technology (UTAUT)
Universal Law of Generalization
Non-Behavioral
Accountability obfuscation
Actor Network theory
Attack Tree and Vague Sets
Bayes Theorem
Bayesian Inference
Bayesian Belief Network
Bayesian Networks
Boundary Object Theory
Broadbent’s Filter Theory Model
Complexity Theory
Cooperative game theory
Conformity Theory
Critical Realism Theory
Customer Based Discrepancy Theory
Customer Focus Theory
Deferred Action Theory
Design Theory
Elaboration Likelihood Model
Fit-Viability Theory
Flow Theory
Game Theory
Garbage Can Theory
General Systems Theory
General Deterrence Theory
Hebbian Theory
Human Agency Theory
Information Warfare
Institutional theory
International Information Systems Theory
Internationalization Theory
Information Technology Portfolio
Knowledge Management
Noncooperative game theory
Organization Based Access C ...
INS653X Project Management.docx
This document provides an overview of a research project that aims to evaluate methods and approaches for trust and reputation in IoT networks. The introduction discusses how IoT enables connectivity but also faces security challenges that impact trust. The literature review covers characteristics of IoT, challenges to trust and reputation in IoT, and methods for evaluating trust and reputation. The research aims to understand trust models and review challenges to trust and reputation in IoT. Key questions focus on IoT technology, risks affecting trust, and trust evaluation methods.
PECB Webinar: The Internet of Things
Summary:
The Internet of Things has been touted as the centerpiece of many innovative devices as it grows to encompass nearly every type of product imaginable. Already, appliances, cars and even buildings are being equipped with the capability to access Wi-Fi and wired networks. This has led to new efficiencies and data-driven opportunities for enterprises across the board.
When you hear “the next big thing,” do you think they’re thinking big enough? Attend this webinar to find out more.
Presenter:
This webinar will be presented by Arthur Donkens, the managing partner of ITSX. Arthur has been active in information security since 1986, by advising, auditing and collaborating with more than 30 top class companies. Through his rich experience, he has been issued with credible certificates in information security, and has contributed in this sector by writing articles and whitepapers that are available. His moto is “Balancing security and business goals through well designed security architectures.”
Iot opportunities-challenges
This document summarizes a discussion between Tim O'Reilly and Cory Doctorow on opportunities and challenges in the Internet of Things (IoT). Some key points discussed include:
1) Using IoT technologies to completely rethink industries like healthcare by using sensors and data to improve outcomes.
2) IoT provides opportunities to enhance human abilities and give people "superpowers" through technologies like GPS and augmented reality.
3) IoT enables more efficient ways for people to work together collaboratively through networked physical objects and sensors.
4) Effecting change in the public sector can be challenging due to slow government processes, but progress can be made through markets, litigation, and technologies that "do the right thing
Running head INTERNET OF THINGS1INTERNET OF THINGS10.docx
Running head: INTERNET OF THINGS1
INTERNET OF THINGS10
Internet of Things
Ideation Process
Innovation technology is mainly concerned with the introduction of a new idea into the market. Any basic innovation technology has an ideation process as its basis. Ideation becomes the most basic step. During this stage, a thought is generated. From this thought, an idea is analyzed and provided. The analysis process is done purposefully to determine the feasibility of the implementation of the developed idea. Analysis also establishes the market demand of the idea that has been developed. It determines the possible profit, and this such of an idea would bring to the organization upon its implementation. This explanation will be discussed on the aspect of a new technology known as Internet of Things, which was designed with a main reason of providing internet faculties to all locations on the surface of the earth on each scale.
When an analysis has been completed, what follows afterwards is the aspect of idea implementation. Implementation of the idea is always followed by the testing of the idea (Gubbi et al., 2013). Here, the idea is tested for its validity to be established. The validity here is trying to answer the question of whether the idea is trying to answer the problem that led to its establishment and implementation. Validity also gives the corrections and accuracy on the assessment of the set system. In case the assessment gives the right thing that the set idea was meant to provide, then the idea is valued and worth to be used in the market. If a contrary occurs, then it becomes advisable for the idea to be scripted. Every system needs to pass the validity test for it to be reliable, although some experts argues that not all valid systems are reliable.
Alternative
Solution
s
Most cases of the idealization process require alternatives to limit any possible risk or loss. Sometimes, it is evident that the innovative idea may bring some critical challenges in the implementation process. Some aspects that should be considered in the process include budget, and other critical resources that are required in the implementation process. For instance, the IoT can be used to supply internet connectivity in case the other alternative fails or vice versa. It is recommended that any form of learning and research should be done to control any possible discrepancies in the IoT technology. Any other technology can be implemented if it depicts the same functionality as the one described by the IoT.
Overview
The IoT refers to ever-growing technology that provides IP addresses to all objects and substances that one may imagine associating with. The assigned objects can promote communication amongst themselves. This technology tries to improve communication among individuals on a large scale by using the internet. The data grouping as well as digitizing the concept of IoT, calls for construction of four c ...
Infrastructure as Destiny — How Purdue Builds a Support Fabric for Big Data E...
Transcript of a discussion on how Purdue University provides IT as a service, using big data and the IoT technologies, to support such worthy goals as student retention analysis.
Recommended
Below are various theories and models that have been used and can
Below are various theories and models that have been used and can be used in research (from Dr. Steve Brown)
Behavioral et. al.
Absorptive capacity Theory
Accountability Theory
Activity Theory
Adaptive Structuration Theory
Administrative Behavior Theory
Argumentation Theory
Asch Conformity
Behavioral Decision Model
Belief Action Outcome Framework
Chaos Theory
Cognitive Fit Theory
Cognitive Load Theory
Cognitive Behavioral Therapy
Classical Conditioning
Conditioned Emotional Response
Cognitive Dissonance
Cognitive “purposive” Behaviorism
Consequentialist Ethics
Critical Theory
Csíkszentmihályi’s Flow
Cultural Theory
Deontological Ethics
Diffusion of Innovations Theory
Dynamic Capabilities
Distributed Cognitions Theory
Embodied social presence theory
Equity theory
Evolutionary theory
Eysenck’s Theory
Expectancy-value theory
Expectation Confirmation Theory
False Memory Syndrome
Field Theory
Fishbein's Attitude
General Deterrence Theory
Gestalt Theory of Personality
General Strain theory
Goal Contagion Theory
Gompertz Model (based upon Social Conflict Theory)
Grounded Theory
Hermeneutics
Illusion of Control
Impression Management Theory
Information Processing Theory
Impression Management Theory
Information Asymmetry Theory
Information Security Management Theory
Institutional Theory
Integrated Systems Theory
Keller's Motivational Model
Language action perspective
Law of Effect
Law of Emotion
Learned Helplessness Theory
McClelland’s Needs Theory
Neutralization Theory
Operant Conditioning
Mitchel’s Personality theory
Prospect Theory
Protection Motivation Theory
Self Determination Theory
Self-Efficacy Theory
Social Action Theory
Social Conflict Theory
Social Cognitive Theory
Social Exchange Theory
Social Identity Theory
Social Influence Theory
Social Learning Theory
Socio Technical Systems Theory
Task Closure Theory
Technology Acceptance Model
Technology Threat Avoidance Theory
Theory of Contextualism
Theory of Contiguity
Theory of Equipotentiality
Theory of Planned Behavior
Theory of Protection Motivation
Theory of Reasoned Action
Theory of Planned Behavior
Trait Theory
Virtue Ethics
Unified theory of acceptance and use of technology (UTAUT)
Universal Law of Generalization
Non-Behavioral
Accountability obfuscation
Actor Network theory
Attack Tree and Vague Sets
Bayes Theorem
Bayesian Inference
Bayesian Belief Network
Bayesian Networks
Boundary Object Theory
Broadbent’s Filter Theory Model
Complexity Theory
Cooperative game theory
Conformity Theory
Critical Realism Theory
Customer Based Discrepancy Theory
Customer Focus Theory
Deferred Action Theory
Design Theory
Elaboration Likelihood Model
Fit-Viability Theory
Flow Theory
Game Theory
Garbage Can Theory
General Systems Theory
General Deterrence Theory
Hebbian Theory
Human Agency Theory
Information Warfare
Institutional theory
International Information Systems Theory
Internationalization Theory
Information Technology Portfolio
Knowledge Management
Noncooperative game theory
Organization Based Access C ...
INS653X Project Management.docx
This document provides an overview of a research project that aims to evaluate methods and approaches for trust and reputation in IoT networks. The introduction discusses how IoT enables connectivity but also faces security challenges that impact trust. The literature review covers characteristics of IoT, challenges to trust and reputation in IoT, and methods for evaluating trust and reputation. The research aims to understand trust models and review challenges to trust and reputation in IoT. Key questions focus on IoT technology, risks affecting trust, and trust evaluation methods.
PECB Webinar: The Internet of Things
Summary:
The Internet of Things has been touted as the centerpiece of many innovative devices as it grows to encompass nearly every type of product imaginable. Already, appliances, cars and even buildings are being equipped with the capability to access Wi-Fi and wired networks. This has led to new efficiencies and data-driven opportunities for enterprises across the board.
When you hear “the next big thing,” do you think they’re thinking big enough? Attend this webinar to find out more.
Presenter:
This webinar will be presented by Arthur Donkens, the managing partner of ITSX. Arthur has been active in information security since 1986, by advising, auditing and collaborating with more than 30 top class companies. Through his rich experience, he has been issued with credible certificates in information security, and has contributed in this sector by writing articles and whitepapers that are available. His moto is “Balancing security and business goals through well designed security architectures.”
Iot opportunities-challenges
This document summarizes a discussion between Tim O'Reilly and Cory Doctorow on opportunities and challenges in the Internet of Things (IoT). Some key points discussed include:
1) Using IoT technologies to completely rethink industries like healthcare by using sensors and data to improve outcomes.
2) IoT provides opportunities to enhance human abilities and give people "superpowers" through technologies like GPS and augmented reality.
3) IoT enables more efficient ways for people to work together collaboratively through networked physical objects and sensors.
4) Effecting change in the public sector can be challenging due to slow government processes, but progress can be made through markets, litigation, and technologies that "do the right thing
Running head INTERNET OF THINGS1INTERNET OF THINGS10.docx
Running head: INTERNET OF THINGS1
INTERNET OF THINGS10
Internet of Things
Ideation Process
Innovation technology is mainly concerned with the introduction of a new idea into the market. Any basic innovation technology has an ideation process as its basis. Ideation becomes the most basic step. During this stage, a thought is generated. From this thought, an idea is analyzed and provided. The analysis process is done purposefully to determine the feasibility of the implementation of the developed idea. Analysis also establishes the market demand of the idea that has been developed. It determines the possible profit, and this such of an idea would bring to the organization upon its implementation. This explanation will be discussed on the aspect of a new technology known as Internet of Things, which was designed with a main reason of providing internet faculties to all locations on the surface of the earth on each scale.
When an analysis has been completed, what follows afterwards is the aspect of idea implementation. Implementation of the idea is always followed by the testing of the idea (Gubbi et al., 2013). Here, the idea is tested for its validity to be established. The validity here is trying to answer the question of whether the idea is trying to answer the problem that led to its establishment and implementation. Validity also gives the corrections and accuracy on the assessment of the set system. In case the assessment gives the right thing that the set idea was meant to provide, then the idea is valued and worth to be used in the market. If a contrary occurs, then it becomes advisable for the idea to be scripted. Every system needs to pass the validity test for it to be reliable, although some experts argues that not all valid systems are reliable.
Alternative
Solution
s
Most cases of the idealization process require alternatives to limit any possible risk or loss. Sometimes, it is evident that the innovative idea may bring some critical challenges in the implementation process. Some aspects that should be considered in the process include budget, and other critical resources that are required in the implementation process. For instance, the IoT can be used to supply internet connectivity in case the other alternative fails or vice versa. It is recommended that any form of learning and research should be done to control any possible discrepancies in the IoT technology. Any other technology can be implemented if it depicts the same functionality as the one described by the IoT.
Overview
The IoT refers to ever-growing technology that provides IP addresses to all objects and substances that one may imagine associating with. The assigned objects can promote communication amongst themselves. This technology tries to improve communication among individuals on a large scale by using the internet. The data grouping as well as digitizing the concept of IoT, calls for construction of four c ...
Infrastructure as Destiny — How Purdue Builds a Support Fabric for Big Data E...
Transcript of a discussion on how Purdue University provides IT as a service, using big data and the IoT technologies, to support such worthy goals as student retention analysis.
Growing Threats Make Application Security a Pervasive Necessity, Rather than ...
Transcript of a BriefingsDirect on how perimeter security is no longer adequate to protect enterprise data that resides in applications.
Intel and the Internet of Things
The document discusses the impact and growth of the Internet of Things (IoT). It summarizes perspectives from Intel Security executives on IoT. They state that IoT will have as big an impact as the industrial revolution and will be embedded in nearly all devices. By 2020, the IoT market is expected to reach $8.9 trillion with 26 billion connected devices. However, for IoT to succeed, security must be built into devices from the beginning as breaches could destroy businesses and privacy.
Research Paper TopicITS835 – Enterprise Risk Managemen.docx
Research Paper Topic
ITS835 – Enterprise Risk Management
Dr. Jerry Alsay
University of the Cumberlands
Introduction
All research reports begin with an introduction. (1 – 2 Pages)
Background
Provide your reader with a broad base of understanding of the research topic. The goal is to give the reader an overview of the topic, and its context within the real world, research literature, and theory. (3 – 5 Pages)
Problem Statement
This section should clearly articulate how the study will relate to the current literature. This is done by describing findings from the research literature that define the gap. Should be very clear what the research problem is and why it should be solved. Provide a general/board problem and a specific problem (150 – 200 Words)
Literature Review
Using your annotated bibliography, construct a literature review. (3-5 pages)
Discussion
Provide a discussion about your specific topic findings. Using the literature, you found, how do you solve your problem? How does it affect your general/board problem?
References
Running Head: CLOUD COMPUTING AND DATA SECURITY1
Cloud Computing and Data Security
Naresh Rama
Professor Dr.Jerry Alsay
07/14/2019
Cloud Computing and Data Security
Introduction
In today's world, the movement of data is from a store that is severe and it is located centrally to the storage of cloud, services in the cloud offer the flexibility, scalability, and concerns that are proportionate that concerns the issue of security. Safety is an aspect that is important and it associated with the computing of cloud because information can be stored on the cloud by the users with the help of providers that works in the service of the cloud. In the security f data and computing of the cloud, there are some problems that are available. They include backups of data that is improper and inadequate that have caused organizations been among those that are vulnerable to threats that re-associated with security measures.
Data that is found in an organization and is stored in files that are encrypted are interfered by these threats. Problem found under these investigations is significant to this study and these show that the threats that emerge because of backups concerning data that is improper lead to an issue that is significant in the security of data in the computing cloud and also security concerning data.
The study tends to shows that security of data and computing of data leads to the provision of ways that helps in the protection of data that is private and also information that is classified away from such threats. That may include attacks in the cyber sector and losses that occur in case of disasters (Strategic Cyber Security, 2011). This study has limitations that state that assurance of security to the computing of cloud is not available and that there is no protection of data that is vital in an organization to a hundred percent.
Background
Hacke ...
Bright talk intrusion prevention are we joking - henshaw july 2010 a
The document summarizes key statistics from a security summit presentation on increasing cybersecurity risks, threats, and challenges posed by factors like social networking, cloud computing, and targeted cyber attacks. It notes that defense in depth strategies are important but can be overlooked due to business priorities, and that sophisticated state-sponsored intrusions may be difficult to fully prevent given constant technology changes.
Internet & iot security
The document discusses internet of things (IoT) security. It begins by defining IoT and its security issues, including privacy, access control, policy enforcement, trust, mobile security, secure middleware, authentication and confidentiality. Examples of security breaches are provided. Recommendations for IoT security include designing for security, making devices more user-friendly, emphasizing technical knowledge, and re-evaluating business structures. Security principles like the Australian Privacy Principles and OWASP principles are covered. Predictions for the future of IoT security include more devices and DDoS attacks, the rise of smart cities, more use of artificial intelligence, more secure routers, use of software defined networking, and an end-to
GITA March 2015 Newsletter
The document is the March 2015 newsletter of the Graduate Information Technology Association (GITA). It includes the following:
- Leadership team and guest speaker for the upcoming meeting on internet of things.
- Summary of the previous meeting presentation on skills for career success.
- Updates on current IT projects including security, databases, Facebook, and the homeroom.
- Articles on cyber security job demand, using drones for archaeology, and wireless charging technology.
- Announcements about mentoring interns, community outreach projects, and help wanted positions.
ARTIFICIAL INTELLIGENCE IN CYBER SECURITY
Artificial intelligence techniques can help address challenges in cyber security that are difficult for humans to handle alone. Neural networks have proven effective for tasks like pattern recognition and classification that are well-suited to their speed of operation. Expert systems allow codifying security expertise to help with tasks like intrusion detection and response. As cyber threats evolve rapidly, applying learning approaches from artificial intelligence can help security systems adapt dynamically instead of relying only on fixed algorithms. Overall, artificial intelligence shows promise for enhancing cyber security capabilities by accelerating the intelligence of security systems.
How HudsonAlpha Innovates on IT for Research-Driven Education, Genomic Medici...
Transcript of a discussion on how HudsonAlpha leverages modern IT infrastructure and big data analytics to power research projects as well as pioneering genomic medicine findings.
Towards a Trustmark for IoT (May 2018)
This document proposes a trustmark for IoT devices to increase transparency and empower consumers. It would evaluate devices based on 5 dimensions: privacy, transparency, security, openness and stability. Compliance would be determined by companies publicly documenting how they meet evaluation criteria. The trustmark aims to highlight the most responsible companies and increase consumer trust in IoT. It is presented as an early concept for feedback and further development.
THE INTERNET OF THINGS PRIVACY AND SECURITYA Master ThesisSub.docx
THE INTERNET OF THINGS: PRIVACY AND SECURITY
A Master Thesis
Submitted to the Faculty
of
American Public University
by
Jose Lopez
In Partial Fulfillment of the
Requirements for the Degree
of
Master of Science
July 2017
American Public University
Charles Town, WV
The author hereby grants the American Public University System the right to display these contents for educational purposes.
The author assumes total responsibility for meeting the requirements set by United States copyright law for the inclusion of any materials that are not the author’s creation or in the public domain.
© Copyright 2016 by Jose Lopez
All rights reserved.
ABSTRACT OF THE THESIS
THE INTERNET OF THINGS: SECURITY AND PRIVACY
by
Jose Lopez
American Public University System, July 1 2017
Charles Town, West Virginia
Dr. William Stanley Pendergrass, Thesis Profesor
The internet of things have been a fast growing technology connecting all of us with what is around us making our lives easier. This constant interaction and sharing of information between devices is a security concern for everyone. The privacy of the technology users is been affected by this new type of technology that interacts with external devices to calculate locations, temperature, movement, speed and many other parameters that interact with the users every day. The study will be focused on the security and privacy concerns that any user should have and how this evolving technology will affect the future of the home users. This study will also show how a security breach or malware created by hackers can affect the real life of a user and how this threats can be controlled. Additionally to this paper it will discuss some of the security features available to the users to keep their internet environment connected and secure.
THE INTERNET OF THINGS
THE INTERNET OF THINGS
Keywords: internet of things (IoT), security, privacy, hackers
TABLE OF CONTENTS
CHAPTER PAGE
I. INTRODUCTION…………………………………………………………….1
Problem Statement….........................................................................................1
Purpose……………………………………………………….………………..2
Significance of the Study……………………...………………………………2
II. LITERATURE REVIEW…………...………..……………………………….2
Internet of Things…...........................................................................................3
Security…..........................................................................................................3
Privacy...............................................................................................................4
III. METHODOLOGY……………………………………………..………….....5
Hypotheses……………………………………………………………………5
Research Design………………………………………………………………5
Variables………………………………………………………………………5
Sampling Plan…………………………………………………………………5
Data Collection..................................................................................................6
Analysis………………………………………………………………………..6
Limitations……………………………………………………………………..6
IV ...
After Cutting its Big Data Teeth on Wall Street, Vichara Technologies Grows t...
Transcript of a Briefings Direct podcast on how one consultancy is looking to expand its horizons for big-data analytics.
Blacks In Technology BMI Tech Workshop preso
The document discusses what it means to be a "geek" and focuses on providing advice and information for pursuing a career in information technology, emphasizing the importance of hands-on learning, obtaining certifications in areas like networking and security, and having a passion for the field in order to find success. It also highlights how being a "geek" can be financially lucrative as exemplified by the multi-billion dollar net worths of tech industry leaders like Bill Gates, Larry Ellison, and Steve Jobs.
Internet of things
The document discusses the Internet of Things (IoT) and its implications. It notes that when objects can be digitally represented, they can be connected to surrounding objects and databases, becoming greater than themselves. When many objects act in unison, it is known as "ambient intelligence." However, the development of IoT also raises concerns around cyber attacks, privacy breaches, and potential economic losses from security issues. It can also disrupt existing business models and increase competition. For industries and governments, it highlights the need for continuous skills upgrading to prepare for digital workplaces.
Using AI to Solve Data and IT Complexity -- And Better Enable AI
A discussion on how the rising tidal wave of data must be better managed, and how new tools are emerging to bring artificial intelligence to the rescue.
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
More Related Content
Similar to This is the question For topic approval, you must include more.docx
Growing Threats Make Application Security a Pervasive Necessity, Rather than ...
Transcript of a BriefingsDirect on how perimeter security is no longer adequate to protect enterprise data that resides in applications.
Intel and the Internet of Things
The document discusses the impact and growth of the Internet of Things (IoT). It summarizes perspectives from Intel Security executives on IoT. They state that IoT will have as big an impact as the industrial revolution and will be embedded in nearly all devices. By 2020, the IoT market is expected to reach $8.9 trillion with 26 billion connected devices. However, for IoT to succeed, security must be built into devices from the beginning as breaches could destroy businesses and privacy.
Research Paper TopicITS835 – Enterprise Risk Managemen.docx
Research Paper Topic
ITS835 – Enterprise Risk Management
Dr. Jerry Alsay
University of the Cumberlands
Introduction
All research reports begin with an introduction. (1 – 2 Pages)
Background
Provide your reader with a broad base of understanding of the research topic. The goal is to give the reader an overview of the topic, and its context within the real world, research literature, and theory. (3 – 5 Pages)
Problem Statement
This section should clearly articulate how the study will relate to the current literature. This is done by describing findings from the research literature that define the gap. Should be very clear what the research problem is and why it should be solved. Provide a general/board problem and a specific problem (150 – 200 Words)
Literature Review
Using your annotated bibliography, construct a literature review. (3-5 pages)
Discussion
Provide a discussion about your specific topic findings. Using the literature, you found, how do you solve your problem? How does it affect your general/board problem?
References
Running Head: CLOUD COMPUTING AND DATA SECURITY1
Cloud Computing and Data Security
Naresh Rama
Professor Dr.Jerry Alsay
07/14/2019
Cloud Computing and Data Security
Introduction
In today's world, the movement of data is from a store that is severe and it is located centrally to the storage of cloud, services in the cloud offer the flexibility, scalability, and concerns that are proportionate that concerns the issue of security. Safety is an aspect that is important and it associated with the computing of cloud because information can be stored on the cloud by the users with the help of providers that works in the service of the cloud. In the security f data and computing of the cloud, there are some problems that are available. They include backups of data that is improper and inadequate that have caused organizations been among those that are vulnerable to threats that re-associated with security measures.
Data that is found in an organization and is stored in files that are encrypted are interfered by these threats. Problem found under these investigations is significant to this study and these show that the threats that emerge because of backups concerning data that is improper lead to an issue that is significant in the security of data in the computing cloud and also security concerning data.
The study tends to shows that security of data and computing of data leads to the provision of ways that helps in the protection of data that is private and also information that is classified away from such threats. That may include attacks in the cyber sector and losses that occur in case of disasters (Strategic Cyber Security, 2011). This study has limitations that state that assurance of security to the computing of cloud is not available and that there is no protection of data that is vital in an organization to a hundred percent.
Background
Hacke ...
Bright talk intrusion prevention are we joking - henshaw july 2010 a
The document summarizes key statistics from a security summit presentation on increasing cybersecurity risks, threats, and challenges posed by factors like social networking, cloud computing, and targeted cyber attacks. It notes that defense in depth strategies are important but can be overlooked due to business priorities, and that sophisticated state-sponsored intrusions may be difficult to fully prevent given constant technology changes.
Internet & iot security
The document discusses internet of things (IoT) security. It begins by defining IoT and its security issues, including privacy, access control, policy enforcement, trust, mobile security, secure middleware, authentication and confidentiality. Examples of security breaches are provided. Recommendations for IoT security include designing for security, making devices more user-friendly, emphasizing technical knowledge, and re-evaluating business structures. Security principles like the Australian Privacy Principles and OWASP principles are covered. Predictions for the future of IoT security include more devices and DDoS attacks, the rise of smart cities, more use of artificial intelligence, more secure routers, use of software defined networking, and an end-to
GITA March 2015 Newsletter
The document is the March 2015 newsletter of the Graduate Information Technology Association (GITA). It includes the following:
- Leadership team and guest speaker for the upcoming meeting on internet of things.
- Summary of the previous meeting presentation on skills for career success.
- Updates on current IT projects including security, databases, Facebook, and the homeroom.
- Articles on cyber security job demand, using drones for archaeology, and wireless charging technology.
- Announcements about mentoring interns, community outreach projects, and help wanted positions.
ARTIFICIAL INTELLIGENCE IN CYBER SECURITY
Artificial intelligence techniques can help address challenges in cyber security that are difficult for humans to handle alone. Neural networks have proven effective for tasks like pattern recognition and classification that are well-suited to their speed of operation. Expert systems allow codifying security expertise to help with tasks like intrusion detection and response. As cyber threats evolve rapidly, applying learning approaches from artificial intelligence can help security systems adapt dynamically instead of relying only on fixed algorithms. Overall, artificial intelligence shows promise for enhancing cyber security capabilities by accelerating the intelligence of security systems.
How HudsonAlpha Innovates on IT for Research-Driven Education, Genomic Medici...
Transcript of a discussion on how HudsonAlpha leverages modern IT infrastructure and big data analytics to power research projects as well as pioneering genomic medicine findings.
Towards a Trustmark for IoT (May 2018)
This document proposes a trustmark for IoT devices to increase transparency and empower consumers. It would evaluate devices based on 5 dimensions: privacy, transparency, security, openness and stability. Compliance would be determined by companies publicly documenting how they meet evaluation criteria. The trustmark aims to highlight the most responsible companies and increase consumer trust in IoT. It is presented as an early concept for feedback and further development.
THE INTERNET OF THINGS PRIVACY AND SECURITYA Master ThesisSub.docx
THE INTERNET OF THINGS: PRIVACY AND SECURITY
A Master Thesis
Submitted to the Faculty
of
American Public University
by
Jose Lopez
In Partial Fulfillment of the
Requirements for the Degree
of
Master of Science
July 2017
American Public University
Charles Town, WV
The author hereby grants the American Public University System the right to display these contents for educational purposes.
The author assumes total responsibility for meeting the requirements set by United States copyright law for the inclusion of any materials that are not the author’s creation or in the public domain.
© Copyright 2016 by Jose Lopez
All rights reserved.
ABSTRACT OF THE THESIS
THE INTERNET OF THINGS: SECURITY AND PRIVACY
by
Jose Lopez
American Public University System, July 1 2017
Charles Town, West Virginia
Dr. William Stanley Pendergrass, Thesis Profesor
The internet of things have been a fast growing technology connecting all of us with what is around us making our lives easier. This constant interaction and sharing of information between devices is a security concern for everyone. The privacy of the technology users is been affected by this new type of technology that interacts with external devices to calculate locations, temperature, movement, speed and many other parameters that interact with the users every day. The study will be focused on the security and privacy concerns that any user should have and how this evolving technology will affect the future of the home users. This study will also show how a security breach or malware created by hackers can affect the real life of a user and how this threats can be controlled. Additionally to this paper it will discuss some of the security features available to the users to keep their internet environment connected and secure.
THE INTERNET OF THINGS
THE INTERNET OF THINGS
Keywords: internet of things (IoT), security, privacy, hackers
TABLE OF CONTENTS
CHAPTER PAGE
I. INTRODUCTION…………………………………………………………….1
Problem Statement….........................................................................................1
Purpose……………………………………………………….………………..2
Significance of the Study……………………...………………………………2
II. LITERATURE REVIEW…………...………..……………………………….2
Internet of Things…...........................................................................................3
Security…..........................................................................................................3
Privacy...............................................................................................................4
III. METHODOLOGY……………………………………………..………….....5
Hypotheses……………………………………………………………………5
Research Design………………………………………………………………5
Variables………………………………………………………………………5
Sampling Plan…………………………………………………………………5
Data Collection..................................................................................................6
Analysis………………………………………………………………………..6
Limitations……………………………………………………………………..6
IV ...
After Cutting its Big Data Teeth on Wall Street, Vichara Technologies Grows t...
Transcript of a Briefings Direct podcast on how one consultancy is looking to expand its horizons for big-data analytics.
Blacks In Technology BMI Tech Workshop preso
The document discusses what it means to be a "geek" and focuses on providing advice and information for pursuing a career in information technology, emphasizing the importance of hands-on learning, obtaining certifications in areas like networking and security, and having a passion for the field in order to find success. It also highlights how being a "geek" can be financially lucrative as exemplified by the multi-billion dollar net worths of tech industry leaders like Bill Gates, Larry Ellison, and Steve Jobs.
Internet of things
The document discusses the Internet of Things (IoT) and its implications. It notes that when objects can be digitally represented, they can be connected to surrounding objects and databases, becoming greater than themselves. When many objects act in unison, it is known as "ambient intelligence." However, the development of IoT also raises concerns around cyber attacks, privacy breaches, and potential economic losses from security issues. It can also disrupt existing business models and increase competition. For industries and governments, it highlights the need for continuous skills upgrading to prepare for digital workplaces.
Using AI to Solve Data and IT Complexity -- And Better Enable AI
A discussion on how the rising tidal wave of data must be better managed, and how new tools are emerging to bring artificial intelligence to the rescue.
Similar to This is the question For topic approval, you must include more.docx (14)
Growing Threats Make Application Security a Pervasive Necessity, Rather than ...
Growing Threats Make Application Security a Pervasive Necessity, Rather than ...
Research Paper TopicITS835 – Enterprise Risk Managemen.docx
Research Paper TopicITS835 – Enterprise Risk Managemen.docx
Bright talk intrusion prevention are we joking - henshaw july 2010 a
Bright talk intrusion prevention are we joking - henshaw july 2010 a
How HudsonAlpha Innovates on IT for Research-Driven Education, Genomic Medici...
How HudsonAlpha Innovates on IT for Research-Driven Education, Genomic Medici...
THE INTERNET OF THINGS PRIVACY AND SECURITYA Master ThesisSub.docx
THE INTERNET OF THINGS PRIVACY AND SECURITYA Master ThesisSub.docx
After Cutting its Big Data Teeth on Wall Street, Vichara Technologies Grows t...
After Cutting its Big Data Teeth on Wall Street, Vichara Technologies Grows t...
Using AI to Solve Data and IT Complexity -- And Better Enable AI
Using AI to Solve Data and IT Complexity -- And Better Enable AI
More from glennf2
This is the other book link.Any questions please contact via[e.docx
This is the other book link.
Any questions please contact via
[email protected]
https://phoenix.vitalsource.com/books/9781483342047/pageid/15
ChaeArvie
NewBaby17 or
NewBaby17!!
Correctional Counseling
Robert Hanser
Scott Mire
2011
1 The Role of the Correctional Counselor
CHAPTER OBJECTIVES
After reading this chapter, you will be able to:
· 1. Identify the functions and parameters of the counseling process.
· 2. Discuss the competing interests between security and counseling in the correctional counseling process.
· 3. Know common terms and concerns associated with custodial corrections.
· 4. Understand the role of the counselor as facilitator.
· 5. Identify the various personal characteristics associated with effective counselors.
· 6. Be aware of the impact that burnout can have on a counselor’s professional performance.
· 7. Identify the various means of training and supervision associated with counseling.
PART ONE: A BRIEF INTRODUCTION TO COUNSELING AND CORRECTIONS
There are many myths concerning the concept of counseling. Although the image of the counseling field has changed dramatically over the past two or three decades, much of society still views counseling and therapy as a mystic process reserved for those who lack the ability to handle life issues effectively. While the concept of counseling is often misunderstood, the problem is exacerbated when attempting to introduce the idea of correctional counseling. Therefore, the primary goal of this chapter is to provide a working definition of correctional counseling that includes descriptions of how and when it is carried out. In order to understand the concept of correctional counseling, however, the two words that derive the concept must first be defined: “corrections” and “counseling.” In addition, a concerted effort is made to identify the myriad of legal and ethical issues that pertain to counselors working with offenders.
It is very difficult to identify a single starting point for the counseling profession. In essence, there were various movements occurring simultaneously that later evolved into what we now describe as counseling. One of the earliest connections to the origins of counseling took place in Europe during the Middle Ages (Brown & Srebalus, 2003). The primary objective was assisting individuals with career choices. This type of counseling service is usually described by the concept of “guidance.” In the late 1800s Wilhelm Wundt and G. Stanley Hall created two of the first known psychological laboratories aimed at studying and treating individuals with psychological and emotional problems (Brown & Srebalus, 2003). Around the same time (1890), Sigmund Freud began treating mental patients with his patented technique of psychoanalysis. As a result, the origins of counseling can be traced to two different but simultaneous movements: (1) guidance and (2) psychotherapy.
Guidance
Guidance has been used as a concept to describe the process of helping individuals identify and .
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the first part of this assignment for your review. I only need the highlighted part done.
Identify a
population and a sample for your research.
Describe
who will be chosen and how they will be accessed via your survey.
Determine
the data collection process.
Describe
the format of the survey and the basic item content to be gathered.
Determine
how the survey will be distributed and collected.
.
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt: Explain the role of reason within theology as it seeks to deepen its
understanding of the mysteries of faith.
This paper requires MLA formatting that includes:
a. 12-point font
b. double-spaced sentences
c. title and personal identification
d. a separate works cited page properly formatted
e. specific bibliographical form for print and electronic sources in your works cited
f. a specific form for parenthetical (in-text) citations of the sources listed in your works cite
g. certain sources do not qualify for works cited. You will be penalized if you use them. These are: Wikipedia, standard dictionary or encyclopedia (web or paper), any website not .edu.
h. every website you use has to be .edu or
.
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another. Plus discussion
Presentation on Threats to the Global Environment
Overview
Congratulations! The members of the United Nations found great value in the two analyses you provided. They are now asking you to develop a PowerPoint presentation that addresses four of the most critical threats to the global environment. Critical threats include:
Energy sources.
Globalization.
Lack of educational opportunities.
Inappropriate use of technology.
Civil war.
Poor health of entire population.
Cultural taboos.
Climate change.
Instructions
Step I. Narrow the List from Eight to the Four Most Critical Threats
To complete this step, complete the following tasks in order:
Review research on each of the eight threats.
Determine what you believe to be the current and potential future impacts of each threat on the global environment.
Choose the four threats that you see as the most critical by considering which pose the greatest or most immediate risk.
Step II. Create the PowerPoint Presentation
The completed version of this presentation will include a minimum of 16 slides. Your audience consists of the United Nations General Assembly.
PPT Content and Structure
Title Slide:
Include your name, course title, current date, and the name of your instructor.
Introduction Slide:
List the four threats you chose, and in the Notes section offer a brief narrative justifying these choices
Body Slides:
The slide content is listed in the outline below. For each body slide you develop, please include a paragraph in the Notes section explaining how the details you have provided in the slide are pertinent to the United Nations’ discussion on selecting and prioritizing goals.
For your first threat (this is the threat you consider to be the greatest risk/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your second threat (this is the threat you consider to be the second greatest risk/second highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how those countries are affected (please give examples).
One slide on the effects of this threat on the world population as a whole.
One slide including a chart, graph, or compelling visual that relates to the content you present in body slides a–c.
For your third threat (this is the threat you consider to be the third greatest threat/highest priority):
One slide on a brief history and assessment of the threat.
One slide on the countries most affected by the threat, and how.
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.
The file is attached.
Due date is
13th of November
Course: Crime and State in History
Course description and lecture outline:
This course explores dramatic, historical transformations in the perception and definition of crime and the administration of criminal law. Popular assumptions in common law countries about the evolution of law enforcement, prosecutions and the rights of the accused, the role of counsel, judges and juries in public trials, as well as punishment, are broadly examined. The course approach sets criminal law evolution in an organic, socio-political context—nothing happens in a vacuum—and moves from the arrival of the Normans in England to the early nineteenth-century, traces the adoption of the English criminal law system in Canada [ French /aboriginal Canada, the NWMP & opening of the west ], and thereafter shifts into selected issues in law, crime and society such as the historical treatment of women, war crimes, the current age of ‘terrorism,’ and the health of the rule of law in the 21st century.
1-
Introduction
(Conceptualizing Legal History and Origins of Canada's System)
The Roman legacy, what William found after Hastings by way of local ‘criminal law’
2-
Eighteenth Century England
3-
Nineteenth Century England: The Great Transformation - Reform or More Efficient Repression?
4-
The Reception of English Criminal Law in Canad
5-
Law Enforcement, the Rise of Police and Public Prosecutions
6-
The Criminal Trial and Legal Personnel
7-
Punishment
8-
Conquest, the Experience of Native Peoples and Minorities
9-
The Experiences of Women
10-
Politics and the Rule of Law in Canada
.
This is the worlds most famous operatic soprano at the moment, An.docx
This is the world's most famous operatic soprano at the moment,
Anna Netrebko
, a Russian singer who has the most unlikely story you will ever hear. She trained for opera, but when she couldn't land singing roles early in her career, she decided to take a job as a janitor in an opera house just to stay close to the music she loved. She did this for a while, and one day the opera conductor agreed to hear her sing. Astounded by what he had found, he supported her and promoted her, and the rest is history. She's now opera's world superstar, and while
Micaëla
isn't a show-stopping role, here she is singing it. What do you think? She plays
Micaëla differently.
How would you describe the difference in sound between her voice
Anna Netrebko
and the other soprano,
Barbara Frittoli
? Anything you would like to say is fair game. Share moments - a note, phrase, etc. that you find impressive.
(By the way, the thing she steps on at the end is the embers of the fire just left behind by the Carmen, the gypsies and Don José after they left to move their smuggled goods.)
.
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)
Critical Thinking Posts
for the course. It must be posted on Canvas by 8pm on Wednesday, January 8th, 2020
.
Remember, this is an opportunity for you to take a position on a
media and culture issue
using your informed opinion by the theory and concepts you are learning about in this course.
Your answer must be a balance between what you think with what you have read, watched, listened to (provided by Dr. Dorsey-Elson), heard stated during a relevant mini-lecture AND/OR information you attained from a credible source (which you must state so that Dr. Dorsey-Elson can verify its validity).
Your critical thinking writing post is completed correctly when you respond directly to the questions that Dr. Dorsey-Elson posts and you use complete sentences that are proofread for grammatical errors. Late critical thought posts will NOT be graded.
Please write a 12 to 15 sentence response to the following multi-part question:
Find the website of a magazine you are familiar with and interested in. Explore the website. Identify three things that the magazine does online that it doesn’t do in print. Explain what you think the differences are in terms of impact on readers. Be specific and to the point.
.
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for y.
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stairway to Heaven 1946) dir. Michael Powell & Emertic Pressburger
in this critical l journal u just have to talk about the color
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1:
The purpose of this assignment is to get you to begin your term project through the creation of an introduction as well as the identification of three (3) trends that will impact your industry of choice or specific job within your industry of choice. Again, the purpose of the term project is to expose you deeper into one of the many individual subsectors that comprise the tourism and hospitality industry.
As part of your industry sector final assignment, you will need to become a quick study expert. Well, maybe not an expert; however, you will need to become familiar with many aspects of the industry including staffing, costs, competition, etc... Since no business operates in a vacuum, as a future business owner or manager you will need to keep on top of the industry and societal trends. This assignment will require you to identify current industry trends. Further, you will need to describe how the current trends will affect your industry sector of choice and how these trends will personally affect your involvement/actions within this industry sector of choice.
· Identify
(2-trends)
found within newspapers/newsletters/trade journals
(no older than 2-years)
and
(1-trend)
found within a refereed journal article
(no older than 3-years)
concerning societal or industry trends affecting your industry sector of choice.
o Briefly describe the trend
o Describe how and why this trend affects your industry of choice
o Describe how this personally affects your involvement/actions within this industry sector of choice (personal weaknesses or opportunities)
For this paper:
· Start with an introduction that states the purpose of the term assignment (e.g. identify and present trends affecting my industry subsector of choice)
· Include a bibliography of at least three references
· Strong conclusion noting one major implication of trends impact on your subsector
Paper Directions
Single-spaced
11 or 12 point font
Pages numbered on the bottom center of each page
Document title (e.g. Assignment 1)
Use of page layout to ensure clear and efficient reader comprehension
Proofed and grammatically correct
FULL NAME
LEFT MARGIN FOR BOTH YOU AND YOUR TEAM MEMBERS
DATE
LEFT MARGIN
CLASS TITLE
LEFT MARGIN
MY NAME
LEFT MARGIN
Part 2:
Purpose of the Assignment
The purpose of this assignment is to expose your deeper into one of the many individual sectors that comprise the tourism and hospitality industry. Additionally, this assignment will require you to consider viable career tracts including job titles, job roles, and responsibilities, character traits for success, and future job outlook and salary prospects. Finally, this assignment will require you to identify, solicit, and complete a face-to-face interview with an individual currently working in this position to gain a greater appreciation and understanding for the identified career track as well as an expanded network of professional co.
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agurre, The Wrath 1972) dir. Werner Herzog
in this critical l journal u just have to talk about the Understated or subversive stylization
it have to be 3 pages
it is a critique paper so u don't have to put headlines like body, conclusion or intro
.
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in conjunction with an article.
Read an article on aligning interests with a career. For example:
“When I Grow Up: Lessons scientists would share with their younger selves”
Journal #1: What career interests you the most and why? Explain in
detail your career interest and tell why you feel that you would be
successful in your chosen field.
6 soft skills everyone needs and employers look for
Technical skills may get you an interview, but these six soft skills will get you the job.
By Larry Buhl
In a 2008 survey of more than 2,000 businesses in the state of Washington, employers said entry-level
workers in a variety of professions were lacking in several areas, including problem solving, conflict resolution
and critical observation.
You'll likely see these "soft skills" popping up in job descriptions, next to demands for technical qualifications.
Employment experts agree that tech skills may get you an interview, but these soft skills will get you the job—
and help you keep it:
Communication skills
This doesn't mean you have to be a brilliant orator or writer. It does mean you have to express yourself well,
whether it's writing a coherent memo, persuading others with a presentation or just being able to calmly explain
to a team member what you need.
Teamwork and collaboration
Employers want employees who play well with others—who can effectively work as part of a team. "That
means sometimes being a leader, sometimes being a good follower, monitoring the progress, meeting
deadlines and working with others across the organization to achieve a common goal," says Lynne Sarikas,
the MBA Career Center Director at Northeastern University.
Adaptability
This is especially important for more-seasoned professionals to demonstrate, to counter the (often erroneous)
opinion that older workers are too set in their ways. "To succeed in most organizations, you need to have a
passion for learning and the ability to continue to grow and stretch your skills to adapt to the changing needs of
the organization," Sarikas says. "On your resume, on your cover letter and in your interview, explain the ways
you've continued to learn and grow throughout your career."
Problem solving
Be prepared for the "how did you solve a problem?" interview question with several examples, advises Ann
Spoor, managing director of Cave Creek Partners. "Think of specific examples where you solved a tough
Journal #2: What qualities and goals do you have and how do they fit
in with your career interest? Based on the soft skills discussed in this
article, discuss one that is a strength for you and one with which you
struggle. Share your hopes and plans for the next five years.
http://oas.monster.com/RealMedia/ads/click_lx.ads/us.monster.en/career-advice/six-soft-skills-everyone-needs-hot-jobs/913302949/Middle1/default/empty.gif/71416c562f6c616d5332344.
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current module. The assignment requires that you prepare ONE 200-250-word statement in paragraph form to present a snapshot of:
· your point of view (POV) about the module topic (identify this before turning to the assigned reading)
· key evidence and themes pertaining to the module topic that stands out to you upon completing the assigned reading (include endnotes to cite the information you are extracting from the reading)
· a concluding comment and/or question that captures an aspect of your POV after reading the assigned chapter.
The module topic is Regionalism and Internationalism
!"#$%&'(")&*&+,+-"./,"01,2%"3'4"5$4&66,$("7(%,84$%&'(
!1%/'492:-";<"=$4*&(";&>>
?'[email protected],-"A$%&("!B,4&@$("C,2,[email protected]/"C,*&,DE"F'><"GHE"#'<"G"9IJJI:E"KK<"LMLN
O16>&2/,+"6P-"./,"A$%&("!B,4&@$("?%1+&,2"!22'@&$%&'(
?%$6>,"QCA-"http://www.jstor.org/stable/2503626
[email protected]@,22,+-"RSTIRTGRRJ"RS-RU
Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp. JSTOR's Terms and Conditions of Use provides, in part, that unless
you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you
may use content in the JSTOR archive only for your personal, non-commercial use.
Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at
http://www.jstor.org/action/showPublisher?publisherCode=lamer.
Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed
page of such transmission.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected]
The Latin American Studies Association is collaborating with JSTOR to digitize, preserve and extend access to
Latin American Research Review.
http://www.jstor.org
http://www.jstor.org/stable/2503626?origin=JSTOR-pdf
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/action/showPublisher?publisherCode=lamer
A NATION DIVIDED:
The Quest for Caribbean Integration
W. Marvin Will
University of Tulsa
Recognizing that the traditional five-state subregion of Central
America departed from European colonialism as a federated entity, Ralph
Lee Woodward subtitled his seminal history of Central America "A Nation
Divided." In his view, "the social and economic history of the isthmus
suggests that its peoples share considerably in their problems and circum-
stances, even though their political experience has been diverse. But it is
also clear that their so.
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
'THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(discussion)
The proposed health policy chosen is titled Health and Economic Recovery Omnibus Emergency
Solution
s Act” or simply the HEROES Act. The policy was introduced in the house on 05/12/2020 with the main objective of responding to the Covid-19 disease outbreak by factoring in its impacts on the economy, public health, local and state governments, Americans as well as various businesses. The bill also has other provisions and these include providing emergency supplemental materials to the federal agencies during the FY 2020. What’s more, the bill also ensures that the state, local and territorial governments have the assistance required to fight emergencies such as the global pandemic (Congress.gov, 2020). In addition, the HEROES Act expands paid sick days, as well as ensuring that the family and medical leaves are long enough and addresses the issues of unemployment, nutrition and other health concerns. With regard to fighting the global pandemic, the bill pushes for funding and ensuring that the Covid-19 requirements including testing and contact tracing are properly done, as well as the elimination of cost sharing specifically for Covid-19 treatments (Congress.gov, 2020). Most significantly, the bill also proposes that all employers should develop and engage in the implementation of infectious disease exposure control plans as well as ensuring that employees are well trained and can easily access the PPEs with reference to the global pandemic.
The Corona Virus pandemic has caused several losses of lives in addition to numerous hospitalizations in the US. Being a highly infectious disease, it is of utmost significance to understand the prevalence of the disease and for the highly susceptible populations, necessary measures should be undertaken to reduce the spread. One of the measures proposed by WHO include containment measures, contact tracing, keeping distance and washing hands among others. Since WHO has proved that these measures may help in the prevention of Covid-19 and other infectious diseases, it is evident that the HEROES bill, if passed, may help in reducing the number of Covid-19 cases, especially by ensuring that the WHO guidelines on containing the pandemic are adhered to, as well as ensuring that employers comply to the containment measures as well as ensuring that their employers are safe. Moreover, another significant component of the bill is that it addresses the impacts of Covid-19 on the US economy, together with ensuring that the disease does not affect individuals, as well as their businesses. All these support the benefits of this bill and how it will aid in opening the economy, honoring heroes as well as sending money to the Americans as asserted by the National Law Review (2020).
.
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following: Healthy people 2020 is a guide to promote preventative care. Review Primary, Secondary and Tertiary prevention and relate this to women and children at risk in your community. Identify those risk factors that a prevention program could impact the health of the group you identify. Include citations and use APA format. The 500 words does not include the citations.
.
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz: It consists of the vocabulary you learned from Lesson B in Unit 2.
Authorities
Initiate
Sustainable
Contrary to
Controversy
Undeniable
Neglect
Predator
Prey on
Upkeep
You will write your own sentences using each of the vocabulary words. The sentence
must be an
original sentence
created by you, AND it must use the vocabulary word correctly.
Your sentence
MUST
demonstrate that you understand the meaning of the word.
.
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not be overlapped with in-class discussion. Hopefully Fall 2021 we will be back to normal! This final response essay will be due DECEMBER 6 which is an extended deadline. How does Do the Right Thing and Daughters of the Dust balance carefully and deliberate filmmaking with delivering clear messages about social justice? Sometimes when a film tries too hard for a message, the craft of filmmaking might get overlooked. Compare and contrast how these two films do/do not do that with some clear examples of a moral message either reinforcing or compromising the scene/filmmaking.
.
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you can't not have more than 200 words. Please no plagiarism. You can have one or two quotes. Make sure have a topic sentence, answer what, how, why, in what way, who, How does (he/she) know, and so what. Also use the last story, there is three and use the last one about "Don't take notes with a laptop"
.
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions talking about.
Chin, J. L. & Trimble, J. E. (2015).
Diversity and leadership.
Los Angeles, CA: Sage.
The Three Cs of Managing Diversity: Composition-Core-Climate Managing organizational diversity starts with developing an organization’s strategic planning to be inclusive of diversity and directed toward organizational and systemic change. It presumes a commitment to goals of diversity leadership. It makes the business case for training to move leaders and members toward a goal where diversity means good business; it brings in customers, expands the customer base, promotes a climate where all voices are included, and strives toward a workforce composition that is diverse and delivers its products or services in a culturally competent manner. The senior author has defined this to mean addressing the Three Cs of Diversity: recruiting and retaining a diverse Composition of the workforce and clientele, developing the Core of business products and services to be delivered in a culturally competent manner, and promoting a welcoming and inclusive workplace Climate within the organization. Moodian (2009) views contemporary leadership and leadership success as attainable through intercultural competence and stresses the importance of moving away from ethnocentric leadership philosophies given the growing dominance of diverse workforces and greater racial/ethnic heterogeneity of populations in countries throughout the world today. He suggests a strategic planning process or business plan that is inclusive of diversity and offers seven steps toward managing diversity for organizational change. “The business case is about capturing talent, understanding markets, utilizing diverse perspectives for innovation, knowing how and how not to pitch products, and ultimately, how to generate employee commitment” (Moodian, 2009, p. 39). The seven steps include the following: Generating Executive Commitment—Nothing happens in an organization without buy-in from the top. Diversity needs to be a goal embraced by leaders within an organization and starts with a visioning process. Assessment—This process helps the organization understand its current state regarding diversity. This essentially means doing a SWOT analysis of the Three Cs; this might include assessing composition of the workforce and its clientele, assessing policies and procedures that might pose internal barriers for hiring and promotion, assessing climate of the organization for inclusion and respect for all dimensions of diversity, and marketing strategies and business goals that are inclusive of diversity. This helps identify needs, set priorities, and to define goals and objectives for a strategic plan that is inclusive of diversity and provides data to serve as benchmarks. Diversity Council—The establishment of such councils provides a formal mechanism within the organization that serves the purpose of getting feedback to and f.
This is what I need, nothing more or less-All Is removed in th.docx
The document requests editing services to remove all first-person pronouns from an essay, restructure sentences that are fragmented, run-on, or unprofessional, and ensure the formatting is correct according to Chicago style without any changes.
More from glennf2 (20)
This is the other book link.Any questions please contact via[e.docx
This is the other book link.Any questions please contact via[e.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the second part to a team assignment. I have attach the fi.docx
This is the prompt Explain the role of reason within theology as it.docx
This is the prompt Explain the role of reason within theology as it.docx
This is two separate assignments that should agree with one another..docx
This is two separate assignments that should agree with one another..docx
This is the second assignment.The file is attached.Due date is .docx
This is the second assignment.The file is attached.Due date is .docx
This is the worlds most famous operatic soprano at the moment, An.docx
This is the worlds most famous operatic soprano at the moment, An.docx
this is the second (of five)Critical Thinking Postsfor the c.docx
this is the second (of five)Critical Thinking Postsfor the c.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
This lab has two parts – please answer all parts.Lab 7 Biotechn.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
this journal have to talk about Movie the name of the movie is (Stai.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
This is a 2 part assignment. Part 1The purpose of this as.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
this journal have to talk about Movie the name of the movie is (Agur.docx
This journal can be done as a stand-alone journal or in .docx
This journal can be done as a stand-alone journal or in .docx
This journal assignment is a formative assignment for the current .docx
This journal assignment is a formative assignment for the current .docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
THIS JOB IS A REPLY TO THE BELOW INFORMATION DONE BY STUDENT -(disc.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is to be a 500 word discussion on the following Healthy people.docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your fourth vocabulary quiz It consists of the vocabulary .docx
This is your final response essay. Sorry these last units could not .docx
This is your final response essay. Sorry these last units could not .docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is will a summary you cant not have more than 200 words. Pleas.docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is the text info pg 239 and 240 that the attached instructions .docx
This is what I need, nothing more or less-All Is removed in th.docx
This is what I need, nothing more or less-All Is removed in th.docx
Recently uploaded
BBR 2024 Summer Sessions Interview Training
Qualitative research interview training by Professor Katrina Pritchard and Dr Helen Williams
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
DRUGS AND ITS classification slide share
Any substance (other than food) that is used to prevent, diagnose, treat, or relieve symptoms of a
disease or abnormal condition
How to Make a Field Mandatory in Odoo 17
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama UniversityAkanksha trivedi rama nursing college kanpur.
Natural birth techniques are various type such as/ water birth , alexender method, hypnosis, bradley method, lamaze method etcThe History of Stoke Newington Street Names
Presented at the Stoke Newington Literary Festival on 9th June 2024
www.StokeNewingtonHistory.com
Hindi varnamala | hindi alphabet PPT.pdf
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
Advanced Java[Extra Concepts, Not Difficult].docx
This is part 2 of my Java Learning Journey. This contains Hashing, ArrayList, LinkedList, Date and Time Classes, Calendar Class and more.
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar KanvariaHow to Manage Your Lost Opportunities in Odoo 17 CRM
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
ANATOMY AND BIOMECHANICS OF HIP JOINT.pdf
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Recently uploaded (20)
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
Pride Month Slides 2024 David Douglas School District
Pride Month Slides 2024 David Douglas School District
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
How to Manage Your Lost Opportunities in Odoo 17 CRM
How to Manage Your Lost Opportunities in Odoo 17 CRM
This is the question For topic approval, you must include more.docx
- 1. This is the question : For topic approval, you must include more specifics. For example, when I read your title, I am not specifically sure what your research will cover. Cyber Security is the Highest Threat to the IoT Infrastructure in what? In Heathcare? In What? Can you add something here to the title? IoT is a new age networking technology that has loop holes that are accessible to hackers and malware which can in turn destroying a network that an IoT device might be connected to, consequently, this means that there are many security vulnerabilities that need to be resolved in the network and hardware levels where? Do you have research (references) to back this up? For this study, the most valid population will be parties that have interacted with IoT devices in their homes and offices... ..........The population must be better defined. How would you apply qualitative and quantitative? For example, will one of your data collection methods be surveys or interviews? If so where would these interviews be conducted. Do you have access to your population?