This document discusses how lupin and wheat proteins interact during baking in lupin-wheat bread and how they are extracted during digestion. It finds that most wheat proteins remain extractable after baking but some lose extractability when baked with lupin proteins. Lupin proteins fall into two categories based on extractability - alpha conglutins extract easily while beta, gamma, and delta conglutins do not extract, even under reducing conditions. The document hypothesizes this is due to varying degrees of cross-linking during baking. It provides insights into protein interactions and accessibility during bread production and digestion.
Extrusion applied in the food processing industry serves for upgrading carbohydrate- and protein-based raw materials. In the field of carbohydrate-based raw materials, starch by far accounts for the largest share.
Delivery Of Nutrients Through Food Systemssatputems
1. The document discusses various delivery systems for nutrients in foods, including powder particles, emulsions, molecular complexes, liposomes, microemulsions, and dispersed reversed surfactant systems.
2. It examines how different processing methods like cooking, boiling, baking can affect the retention of various heat-sensitive nutrients like vitamins A, C, D, E, folate, and minerals. Significant losses have been reported for many nutrients during processing.
3. Examples of food products incorporating heat-sensitive nutrients and their chemical forms are provided, including vitamin A in cookies, triple fortified salt, and SLN delivery systems, vitamin D in cheese, yogurt and ice-cream, and folic acid in
functional properties of whey protein concentratePallavi Yd
Whey protein concentrates are powders made from ultrafiltering whey to increase the protein concentration. They can range from 25-80% protein. Key functional properties of whey protein concentrates include water solubility, water absorption capacity, foaming ability, gel formation ability, and emulsifying ability. These properties make whey protein concentrates useful as ingredients in foods.
This document describes a shortening activated cake emulsifier called Masemul EF 25. It discusses how traditional emulsifiers are limited in cakes but Masemul EF 25 overcomes these limitations. The formulation for Masemul EF 25 is provided, consisting of various emulsifiers, lecithin, oil and texturizer. Processing instructions for making Masemul EF 25 via a texturizing plant are also included. A yellow cake recipe and instructions are provided to test Masemul EF 25, finding it performs excellently by decreasing density, increasing heights, providing excellent moistness and maintaining quality over 6 months.
GlutaMAX media provides a more stable form of glutamine that prevents degradation and ammonia buildup in cell cultures. The dipeptide form of glutamine in GlutaMAX media is gradually broken down, allowing for controlled release of glutamine to cells. This can improve cell viability and growth compared to standard glutamine, maintaining higher cell densities and viability over time. GlutaMAX media also provides equivalent or improved production of proteins from cultured cells.
This document summarizes a study that characterized the interaction between whey proteins and pectin and how it affects the emulsifying properties of whey proteins. The study found that adding pectin to whey protein solutions prevented large protein aggregates from forming. However, the protein-pectin complexes that did form were large in size, which could slow their diffusion to oil-water interfaces in emulsions. Different types of pectin (high esterified vs. low esterified) had different effects on emulsion properties like droplet size and stability. The addition of low esterified pectin led to smaller droplets and more stable emulsions compared to high esterified pectin or whey protein alone.
Welcome to the Remote Sensing – Beyond Images WorkshopCIMMYT
Remote sensing –Beyond images
Mexico 14-15 December 2013
The workshop was organized by CIMMYT Global Conservation Agriculture Program (GCAP) and funded by the Bill & Melinda Gates Foundation (BMGF), the Mexican Secretariat of Agriculture, Livestock, Rural Development, Fisheries and Food (SAGARPA), the International Maize and Wheat Improvement Center (CIMMYT), CGIAR Research Program on Maize, the Cereal System Initiative for South Asia (CSISA) and the Sustainable Modernization of the Traditional Agriculture (MasAgro)
Development of Stripe Rust Resistant Spring Bread Wheat Germplasm for CWANA:...ICARDA
The document summarizes ICARDA's spring bread wheat improvement program for Central and West Asia and North Africa (CWANA). The program aims to develop germplasm with resistance to multiple rust diseases like stem, leaf and yellow rust through targeted crossing and shuttle breeding between sites with different disease pressures. Key achievements include transferring and mapping genes for slow rusting, such as Sr2, Lr34 and Yr18. Challenges include genetic vulnerability when popular varieties have narrow genetic bases, which is addressed through diversifying germplasm.
Extrusion applied in the food processing industry serves for upgrading carbohydrate- and protein-based raw materials. In the field of carbohydrate-based raw materials, starch by far accounts for the largest share.
Delivery Of Nutrients Through Food Systemssatputems
1. The document discusses various delivery systems for nutrients in foods, including powder particles, emulsions, molecular complexes, liposomes, microemulsions, and dispersed reversed surfactant systems.
2. It examines how different processing methods like cooking, boiling, baking can affect the retention of various heat-sensitive nutrients like vitamins A, C, D, E, folate, and minerals. Significant losses have been reported for many nutrients during processing.
3. Examples of food products incorporating heat-sensitive nutrients and their chemical forms are provided, including vitamin A in cookies, triple fortified salt, and SLN delivery systems, vitamin D in cheese, yogurt and ice-cream, and folic acid in
functional properties of whey protein concentratePallavi Yd
Whey protein concentrates are powders made from ultrafiltering whey to increase the protein concentration. They can range from 25-80% protein. Key functional properties of whey protein concentrates include water solubility, water absorption capacity, foaming ability, gel formation ability, and emulsifying ability. These properties make whey protein concentrates useful as ingredients in foods.
This document describes a shortening activated cake emulsifier called Masemul EF 25. It discusses how traditional emulsifiers are limited in cakes but Masemul EF 25 overcomes these limitations. The formulation for Masemul EF 25 is provided, consisting of various emulsifiers, lecithin, oil and texturizer. Processing instructions for making Masemul EF 25 via a texturizing plant are also included. A yellow cake recipe and instructions are provided to test Masemul EF 25, finding it performs excellently by decreasing density, increasing heights, providing excellent moistness and maintaining quality over 6 months.
GlutaMAX media provides a more stable form of glutamine that prevents degradation and ammonia buildup in cell cultures. The dipeptide form of glutamine in GlutaMAX media is gradually broken down, allowing for controlled release of glutamine to cells. This can improve cell viability and growth compared to standard glutamine, maintaining higher cell densities and viability over time. GlutaMAX media also provides equivalent or improved production of proteins from cultured cells.
This document summarizes a study that characterized the interaction between whey proteins and pectin and how it affects the emulsifying properties of whey proteins. The study found that adding pectin to whey protein solutions prevented large protein aggregates from forming. However, the protein-pectin complexes that did form were large in size, which could slow their diffusion to oil-water interfaces in emulsions. Different types of pectin (high esterified vs. low esterified) had different effects on emulsion properties like droplet size and stability. The addition of low esterified pectin led to smaller droplets and more stable emulsions compared to high esterified pectin or whey protein alone.
Welcome to the Remote Sensing – Beyond Images WorkshopCIMMYT
Remote sensing –Beyond images
Mexico 14-15 December 2013
The workshop was organized by CIMMYT Global Conservation Agriculture Program (GCAP) and funded by the Bill & Melinda Gates Foundation (BMGF), the Mexican Secretariat of Agriculture, Livestock, Rural Development, Fisheries and Food (SAGARPA), the International Maize and Wheat Improvement Center (CIMMYT), CGIAR Research Program on Maize, the Cereal System Initiative for South Asia (CSISA) and the Sustainable Modernization of the Traditional Agriculture (MasAgro)
Development of Stripe Rust Resistant Spring Bread Wheat Germplasm for CWANA:...ICARDA
The document summarizes ICARDA's spring bread wheat improvement program for Central and West Asia and North Africa (CWANA). The program aims to develop germplasm with resistance to multiple rust diseases like stem, leaf and yellow rust through targeted crossing and shuttle breeding between sites with different disease pressures. Key achievements include transferring and mapping genes for slow rusting, such as Sr2, Lr34 and Yr18. Challenges include genetic vulnerability when popular varieties have narrow genetic bases, which is addressed through diversifying germplasm.
This document summarizes research on achieving sustainable leaf rust control in durum wheat. It discusses the importance of leaf rust, major resistance genes that have been identified and overcome by evolving rust races, and efforts to develop slow rusting resistance through gene pyramiding. Key findings include identification of multiple major genes conferring resistance, the breakdown of these genes over time, efforts to combine minor genes to provide more durable slow rusting resistance, and the need to continue broadening genetic resistance.
The Mediterranean is located between Europe, Africa, and Asia. It has a mild climate and has historically been an important trade route. The cuisine of Mediterranean countries has been influenced by many ancient civilizations and is known for its use of olive oil, grains, vegetables, fruits, herbs, seafood, and red wine consumed in moderation. Key characteristics include fresh, simple ingredients and sharing meals with others. The Greek and Turkish cuisines both reflect Mediterranean influences and make significant use of ingredients like olive oil, garlic, onions, lentils, rice, yogurt, breads, and seafood.
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...ICARDA
CIMMYT has developed high-yielding, rust-resistant bread wheat germplasm through strategies that focus on durable resistance. Breeding efforts utilize race-nonspecific adult plant resistance conferred by combinations of minor genes with additive effects. A recent 5-year cycle developed lines with 12% higher yields and improved resistance to yellow rust. Of 728 advanced lines tested, over 40% had high yields and immunity/resistance to yellow rust. Testing also found that over 40% of lines had good resistance to stem rust race Ug99. CIMMYT's strategy is to deploy varieties with near-immune, durable resistance to provide long-term genetic control of rust diseases.
The document discusses several major fungal diseases that affect wheat crops:
1. Rusts, caused by fungi of the genus Puccinia, including stem rust, leaf rust, and stripe rust. They produce spores that can spread rapidly under wet conditions.
2. Loose smut and kernel bunt, caused by fungi that infect wheat flowers and seeds, resulting in powdery black or dark masses where healthy kernels should be.
3. Powdery mildew, caused by Erysiphe graminis, which produces white powdery growth on wheat leaves, stems, and flowers that later turns black and dries out plants.
4. Foot rot, caused by Pythium fungi in the soil
Turkish cuisine is rich and diverse due to Turkey's geographic location between Asia and Europe. It incorporates influences from surrounding cultures over centuries. Common dishes include soups, kebabs, pilafs, dolma stuffed vegetables, pastries like baklava, mezes like cacik yogurt dip, and salads like coban salad. Popular drinks are black tea, Turkish coffee, and ayran yogurt drink. Desserts include baklava, sutlac rice pudding, and Turkish delight. Special occasion foods prepared communally include elaborate wedding and Ramadan meals. Overall, Turkish cuisine showcases Turkey's cultural heritage and variety of regional influences.
What do women and men farmers want in their maize varietiesCIMMYT
Women farmers in Eastern Africa have different preferences than male farmers for traits in maize varieties. The document analyzes data from choice experiments conducted in Kenya to determine willingness to pay for various traits. Key findings include: Women do not prefer large grain size as much as men and value traits like storability and drought tolerance more. When socioeconomic factors are controlled for, men have a higher willingness to pay for closed tip ears. Women value drought tolerance and resistance to the striga weed twice as much as men. Men's willingness to pay for low nitrogen tolerance was much higher than women's. The top preferred traits overall were storability, drought tolerance, striga resistance, and lodging resistance.
Transforming Maize-legume Value Chains –A Business Case for Climate-Smart Ag...CIMMYT
CIMMYT Senior Cropping Systems Agronomist Christian Thierfelder presented on climate-smart agriculture in southern Africa in a webinar titled Climate Resilient Agriculture Success Stories – Making a Case for Scale Up.
Maize for Asian tropics: Chasing the moving targetCIMMYT
This document discusses challenges and opportunities for maize research and development in the Asian tropics. It notes the highly variable climate conditions maize faces, including drought, heat stress, excess moisture, and more frequent weather extremes due to climate change. It emphasizes the need for stress-resilient maize varieties and agronomic practices that can protect yields under both optimal and stressful conditions. The document outlines CIMMYT's efforts in stress-resilient maize breeding using new tools like high-throughput phenotyping, genomics, and doubled haploid technology integrated with conventional breeding methods. Close partnerships with various Asian countries and donors are highlighted as important for making progress on this "moving target" of maize improvement for the
Tropical maize genome: what do we know so far and how to use that informationCIMMYT
The document discusses tropical maize genomics, outlining what is currently known about tropical maize genomes from projects like the maize HapMaps. It describes how genomic information can be used to unlock genetic variation in tropical maize germplasm and drive molecular breeding efforts through approaches like genome-wide association studies, marker-assisted selection, and the development of multiple panels of SNP markers. The document also explores how plant breeding will increasingly be driven by big data and artificial intelligence.
Social inclusion of young people and site-specific nutrient management (SSNM)...CIMMYT
The document outlines the agenda for the 13th Asian Maize Conference held in Ludhiana, Punjab, India from 8-10 October 2018. It discusses maize production trends globally and in key countries like China, USA, and Brazil. It also summarizes maize production in Nepal, highlighting challenges like low productivity. The author presents results from an experiment comparing Nutrient Expert recommendations to farmer practices, finding a significant yield increase using the former approach. The conclusion is that Nutrient Expert can help address efficient nutrient management and increase yields and profits for farmers.
Identification of quantitative trait loci for resistance to shoot fly in maizeCIMMYT
This document discusses a study that identified quantitative trait loci (QTL) associated with resistance to shoot fly in maize. The researchers studied two maize inbred lines, CM143 and CM144, and their F2:3 progenies. They measured traits related to shoot fly resistance, such as egg count, leaf injury, and dead heart percentage, in the parents and progenies over time. Phenotypic correlations between traits were calculated. The progenies were genotyped using SSR markers and a genetic linkage map was constructed. QTL analysis identified several QTL associated with traits like leaf width, length, area, injury, and stem girth on different chromosomes. The QTL explained phenotypic variances ranging from 7-
Outbreak of Fusarium ear rot on Maize in ThailandCIMMYT
This study identified Fusarium verticillioides as the main causal agent of ear rot in maize in Thailand. Over two growing seasons, the fungus was isolated from fields in six locations, where disease incidence and severity varied. Sixty inbred maize lines were evaluated for resistance to F. verticillioides under artificial inoculation. Lines Ki30, Ki45 and Ki59 showed the lowest disease severity scores. Additionally, 20 pre-commercial and 3 commercial maize hybrids were evaluated for natural infection in field trials across locations. Variation in disease incidence and severity was observed among hybrids and locations.
Comparative Analysis of Biochemical & Physiological Responses of Maize Genoty...CIMMYT
This study compared the biochemical and physiological responses of six maize genotypes under waterlogging stress conditions. The genotypes differed in their canopy cover, chlorophyll content, membrane damage, and antioxidant enzyme activity when exposed to waterlogging over six days. CML 54 x CML 487, BIL 219 and CML 487 showed the best performance under stress, with higher antioxidant enzyme activities and less membrane damage and chlorophyll loss. CML 54 and CML 486 were the most susceptible. The tolerant genotypes will be targets for future breeding programs to develop waterlogging tolerance in maize.
This document summarizes research on achieving sustainable leaf rust control in durum wheat. It discusses the importance of leaf rust, major resistance genes that have been identified and overcome by evolving rust races, and efforts to develop slow rusting resistance through gene pyramiding. Key findings include identification of multiple major genes conferring resistance, the breakdown of these genes over time, efforts to combine minor genes to provide more durable slow rusting resistance, and the need to continue broadening genetic resistance.
The Mediterranean is located between Europe, Africa, and Asia. It has a mild climate and has historically been an important trade route. The cuisine of Mediterranean countries has been influenced by many ancient civilizations and is known for its use of olive oil, grains, vegetables, fruits, herbs, seafood, and red wine consumed in moderation. Key characteristics include fresh, simple ingredients and sharing meals with others. The Greek and Turkish cuisines both reflect Mediterranean influences and make significant use of ingredients like olive oil, garlic, onions, lentils, rice, yogurt, breads, and seafood.
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...ICARDA
CIMMYT has developed high-yielding, rust-resistant bread wheat germplasm through strategies that focus on durable resistance. Breeding efforts utilize race-nonspecific adult plant resistance conferred by combinations of minor genes with additive effects. A recent 5-year cycle developed lines with 12% higher yields and improved resistance to yellow rust. Of 728 advanced lines tested, over 40% had high yields and immunity/resistance to yellow rust. Testing also found that over 40% of lines had good resistance to stem rust race Ug99. CIMMYT's strategy is to deploy varieties with near-immune, durable resistance to provide long-term genetic control of rust diseases.
The document discusses several major fungal diseases that affect wheat crops:
1. Rusts, caused by fungi of the genus Puccinia, including stem rust, leaf rust, and stripe rust. They produce spores that can spread rapidly under wet conditions.
2. Loose smut and kernel bunt, caused by fungi that infect wheat flowers and seeds, resulting in powdery black or dark masses where healthy kernels should be.
3. Powdery mildew, caused by Erysiphe graminis, which produces white powdery growth on wheat leaves, stems, and flowers that later turns black and dries out plants.
4. Foot rot, caused by Pythium fungi in the soil
Turkish cuisine is rich and diverse due to Turkey's geographic location between Asia and Europe. It incorporates influences from surrounding cultures over centuries. Common dishes include soups, kebabs, pilafs, dolma stuffed vegetables, pastries like baklava, mezes like cacik yogurt dip, and salads like coban salad. Popular drinks are black tea, Turkish coffee, and ayran yogurt drink. Desserts include baklava, sutlac rice pudding, and Turkish delight. Special occasion foods prepared communally include elaborate wedding and Ramadan meals. Overall, Turkish cuisine showcases Turkey's cultural heritage and variety of regional influences.
What do women and men farmers want in their maize varietiesCIMMYT
Women farmers in Eastern Africa have different preferences than male farmers for traits in maize varieties. The document analyzes data from choice experiments conducted in Kenya to determine willingness to pay for various traits. Key findings include: Women do not prefer large grain size as much as men and value traits like storability and drought tolerance more. When socioeconomic factors are controlled for, men have a higher willingness to pay for closed tip ears. Women value drought tolerance and resistance to the striga weed twice as much as men. Men's willingness to pay for low nitrogen tolerance was much higher than women's. The top preferred traits overall were storability, drought tolerance, striga resistance, and lodging resistance.
Transforming Maize-legume Value Chains –A Business Case for Climate-Smart Ag...CIMMYT
CIMMYT Senior Cropping Systems Agronomist Christian Thierfelder presented on climate-smart agriculture in southern Africa in a webinar titled Climate Resilient Agriculture Success Stories – Making a Case for Scale Up.
Maize for Asian tropics: Chasing the moving targetCIMMYT
This document discusses challenges and opportunities for maize research and development in the Asian tropics. It notes the highly variable climate conditions maize faces, including drought, heat stress, excess moisture, and more frequent weather extremes due to climate change. It emphasizes the need for stress-resilient maize varieties and agronomic practices that can protect yields under both optimal and stressful conditions. The document outlines CIMMYT's efforts in stress-resilient maize breeding using new tools like high-throughput phenotyping, genomics, and doubled haploid technology integrated with conventional breeding methods. Close partnerships with various Asian countries and donors are highlighted as important for making progress on this "moving target" of maize improvement for the
Tropical maize genome: what do we know so far and how to use that informationCIMMYT
The document discusses tropical maize genomics, outlining what is currently known about tropical maize genomes from projects like the maize HapMaps. It describes how genomic information can be used to unlock genetic variation in tropical maize germplasm and drive molecular breeding efforts through approaches like genome-wide association studies, marker-assisted selection, and the development of multiple panels of SNP markers. The document also explores how plant breeding will increasingly be driven by big data and artificial intelligence.
Social inclusion of young people and site-specific nutrient management (SSNM)...CIMMYT
The document outlines the agenda for the 13th Asian Maize Conference held in Ludhiana, Punjab, India from 8-10 October 2018. It discusses maize production trends globally and in key countries like China, USA, and Brazil. It also summarizes maize production in Nepal, highlighting challenges like low productivity. The author presents results from an experiment comparing Nutrient Expert recommendations to farmer practices, finding a significant yield increase using the former approach. The conclusion is that Nutrient Expert can help address efficient nutrient management and increase yields and profits for farmers.
Identification of quantitative trait loci for resistance to shoot fly in maizeCIMMYT
This document discusses a study that identified quantitative trait loci (QTL) associated with resistance to shoot fly in maize. The researchers studied two maize inbred lines, CM143 and CM144, and their F2:3 progenies. They measured traits related to shoot fly resistance, such as egg count, leaf injury, and dead heart percentage, in the parents and progenies over time. Phenotypic correlations between traits were calculated. The progenies were genotyped using SSR markers and a genetic linkage map was constructed. QTL analysis identified several QTL associated with traits like leaf width, length, area, injury, and stem girth on different chromosomes. The QTL explained phenotypic variances ranging from 7-
Outbreak of Fusarium ear rot on Maize in ThailandCIMMYT
This study identified Fusarium verticillioides as the main causal agent of ear rot in maize in Thailand. Over two growing seasons, the fungus was isolated from fields in six locations, where disease incidence and severity varied. Sixty inbred maize lines were evaluated for resistance to F. verticillioides under artificial inoculation. Lines Ki30, Ki45 and Ki59 showed the lowest disease severity scores. Additionally, 20 pre-commercial and 3 commercial maize hybrids were evaluated for natural infection in field trials across locations. Variation in disease incidence and severity was observed among hybrids and locations.
Comparative Analysis of Biochemical & Physiological Responses of Maize Genoty...CIMMYT
This study compared the biochemical and physiological responses of six maize genotypes under waterlogging stress conditions. The genotypes differed in their canopy cover, chlorophyll content, membrane damage, and antioxidant enzyme activity when exposed to waterlogging over six days. CML 54 x CML 487, BIL 219 and CML 487 showed the best performance under stress, with higher antioxidant enzyme activities and less membrane damage and chlorophyll loss. CML 54 and CML 486 were the most susceptible. The tolerant genotypes will be targets for future breeding programs to develop waterlogging tolerance in maize.
1. CIMMYT genotyped its entire maize germplasm bank collection of 28,000 accessions to better understand genetic diversity and identify alleles of breeding value.
2. Genomic and environmental data is being used to conduct genome-wide association studies and environmental GWAS to find genetic variations associated with traits like drought tolerance.
3. Selected accessions are undergoing pre-breeding to transfer useful alleles to elite lines and develop populations with improved stress resistance and other traits for breeders.
4. Products like catalogues of tolerant accessions are being made available to breeders, researchers, and genebanks to facilitate use of genetic resources.
This document summarizes the objectives and methodology of a study evaluating the effects of char, a byproduct of coal burning, in nitrogen management of maize soils in a semi-arid region. The study aims to: 1) Measure nitrogen losses from loam and sandy loam soils amended with various rates of char, 2) Evaluate the effect of char on maize fertilized with urea and manure in fields, and 3) Test sensors to estimate maize nitrogen status throughout growth stages. The results are expected to optimize nitrogen fertilizer use, increase nitrogen use efficiency and maize yields, and provide a tool to help small-holder farmers.
Technologies to drive maize yield improvementCIMMYT
This document discusses technologies and strategies being used by Corteva Agriscience to improve maize yields. It highlights advanced phenotyping systems using drones and satellite imagery, genomic research including reference genomes, and the use of gene editing including CRISPR-Cas9 to develop new varieties with improved traits like disease resistance and drought tolerance. The first example product mentioned is a waxy corn variety developed using CRISPR-Cas9 that is expected to launch commercially in 2020.
How to Implement a Strategy: Transform Your Strategy with BSC Designer's Comp...Aleksey Savkin
The Strategy Implementation System offers a structured approach to translating stakeholder needs into actionable strategies using high-level and low-level scorecards. It involves stakeholder analysis, strategy decomposition, adoption of strategic frameworks like Balanced Scorecard or OKR, and alignment of goals, initiatives, and KPIs.
Key Components:
- Stakeholder Analysis
- Strategy Decomposition
- Adoption of Business Frameworks
- Goal Setting
- Initiatives and Action Plans
- KPIs and Performance Metrics
- Learning and Adaptation
- Alignment and Cascading of Scorecards
Benefits:
- Systematic strategy formulation and execution.
- Framework flexibility and automation.
- Enhanced alignment and strategic focus across the organization.
How to Implement a Real Estate CRM SoftwareSalesTown
To implement a CRM for real estate, set clear goals, choose a CRM with key real estate features, and customize it to your needs. Migrate your data, train your team, and use automation to save time. Monitor performance, ensure data security, and use the CRM to enhance marketing. Regularly check its effectiveness to improve your business.
Digital Marketing with a Focus on Sustainabilitysssourabhsharma
Digital Marketing best practices including influencer marketing, content creators, and omnichannel marketing for Sustainable Brands at the Sustainable Cosmetics Summit 2024 in New York
At Techbox Square, in Singapore, we're not just creative web designers and developers, we're the driving force behind your brand identity. Contact us today.
The 10 Most Influential Leaders Guiding Corporate Evolution, 2024.pdfthesiliconleaders
In the recent edition, The 10 Most Influential Leaders Guiding Corporate Evolution, 2024, The Silicon Leaders magazine gladly features Dejan Štancer, President of the Global Chamber of Business Leaders (GCBL), along with other leaders.
At Techbox Square, in Singapore, we're not just creative web designers and developers, we're the driving force behind your brand identity. Contact us today.
Unveiling the Dynamic Personalities, Key Dates, and Horoscope Insights: Gemin...my Pandit
Explore the fascinating world of the Gemini Zodiac Sign. Discover the unique personality traits, key dates, and horoscope insights of Gemini individuals. Learn how their sociable, communicative nature and boundless curiosity make them the dynamic explorers of the zodiac. Dive into the duality of the Gemini sign and understand their intellectual and adventurous spirit.
The Genesis of BriansClub.cm Famous Dark WEb PlatformSabaaSudozai
BriansClub.cm, a famous platform on the dark web, has become one of the most infamous carding marketplaces, specializing in the sale of stolen credit card data.
Navigating the world of forex trading can be challenging, especially for beginners. To help you make an informed decision, we have comprehensively compared the best forex brokers in India for 2024. This article, reviewed by Top Forex Brokers Review, will cover featured award winners, the best forex brokers, featured offers, the best copy trading platforms, the best forex brokers for beginners, the best MetaTrader brokers, and recently updated reviews. We will focus on FP Markets, Black Bull, EightCap, IC Markets, and Octa.
[To download this presentation, visit:
https://www.oeconsulting.com.sg/training-presentations]
This PowerPoint compilation offers a comprehensive overview of 20 leading innovation management frameworks and methodologies, selected for their broad applicability across various industries and organizational contexts. These frameworks are valuable resources for a wide range of users, including business professionals, educators, and consultants.
Each framework is presented with visually engaging diagrams and templates, ensuring the content is both informative and appealing. While this compilation is thorough, please note that the slides are intended as supplementary resources and may not be sufficient for standalone instructional purposes.
This compilation is ideal for anyone looking to enhance their understanding of innovation management and drive meaningful change within their organization. Whether you aim to improve product development processes, enhance customer experiences, or drive digital transformation, these frameworks offer valuable insights and tools to help you achieve your goals.
INCLUDED FRAMEWORKS/MODELS:
1. Stanford’s Design Thinking
2. IDEO’s Human-Centered Design
3. Strategyzer’s Business Model Innovation
4. Lean Startup Methodology
5. Agile Innovation Framework
6. Doblin’s Ten Types of Innovation
7. McKinsey’s Three Horizons of Growth
8. Customer Journey Map
9. Christensen’s Disruptive Innovation Theory
10. Blue Ocean Strategy
11. Strategyn’s Jobs-To-Be-Done (JTBD) Framework with Job Map
12. Design Sprint Framework
13. The Double Diamond
14. Lean Six Sigma DMAIC
15. TRIZ Problem-Solving Framework
16. Edward de Bono’s Six Thinking Hats
17. Stage-Gate Model
18. Toyota’s Six Steps of Kaizen
19. Microsoft’s Digital Transformation Framework
20. Design for Six Sigma (DFSS)
To download this presentation, visit:
https://www.oeconsulting.com.sg/training-presentations
Part 2 Deep Dive: Navigating the 2024 Slowdownjeffkluth1
Introduction
The global retail industry has weathered numerous storms, with the financial crisis of 2008 serving as a poignant reminder of the sector's resilience and adaptability. However, as we navigate the complex landscape of 2024, retailers face a unique set of challenges that demand innovative strategies and a fundamental shift in mindset. This white paper contrasts the impact of the 2008 recession on the retail sector with the current headwinds retailers are grappling with, while offering a comprehensive roadmap for success in this new paradigm.
Anny Serafina Love - Letter of Recommendation by Kellen Harkins, MS.AnnySerafinaLove
This letter, written by Kellen Harkins, Course Director at Full Sail University, commends Anny Love's exemplary performance in the Video Sharing Platforms class. It highlights her dedication, willingness to challenge herself, and exceptional skills in production, editing, and marketing across various video platforms like YouTube, TikTok, and Instagram.
How MJ Global Leads the Packaging Industry.pdfMJ Global
MJ Global's success in staying ahead of the curve in the packaging industry is a testament to its dedication to innovation, sustainability, and customer-centricity. By embracing technological advancements, leading in eco-friendly solutions, collaborating with industry leaders, and adapting to evolving consumer preferences, MJ Global continues to set new standards in the packaging sector.
SATTA MATKA SATTA FAST RESULT KALYAN TOP MATKA RESULT KALYAN SATTA MATKA FAST RESULT MILAN RATAN RAJDHANI MAIN BAZAR MATKA FAST TIPS RESULT MATKA CHART JODI CHART PANEL CHART FREE FIX GAME SATTAMATKA ! MATKA MOBI SATTA 143 spboss.in TOP NO1 RESULT FULL RATE MATKA ONLINE GAME PLAY BY APP SPBOSS
HOW TO START UP A COMPANY A STEP-BY-STEP GUIDE.pdf46adnanshahzad
How to Start Up a Company: A Step-by-Step Guide Starting a company is an exciting adventure that combines creativity, strategy, and hard work. It can seem overwhelming at first, but with the right guidance, anyone can transform a great idea into a successful business. Let's dive into how to start up a company, from the initial spark of an idea to securing funding and launching your startup.
Introduction
Have you ever dreamed of turning your innovative idea into a thriving business? Starting a company involves numerous steps and decisions, but don't worry—we're here to help. Whether you're exploring how to start a startup company or wondering how to start up a small business, this guide will walk you through the process, step by step.
B2B payments are rapidly changing. Find out the 5 key questions you need to be asking yourself to be sure you are mastering B2B payments today. Learn more at www.BlueSnap.com.
Wheat and lupin protein interaction at baking: modifying extractability from lupin-wheat bread
1. Wheat and lupin protein interaction at baking:
modifying extractability from lupin-wheat bread
Shahidul Islam, Guijun Yan, Rudi Appels, Wujun Ma
2. Nutritional status of lupin
Unique combination of
• High protein
• High dietary fibre
• Low oil
• Negligible starch content
• Low Glycaemic Index (G.I.)
Lupin has high lysine content
that is low in wheat
3. Health attributes of lupin-wheat bread
• Increases satiety and reduces energy intake
• Lowers cholesterol
• Decreases blood glucose level
• Lowers blood pressure
• Decreases the risk of cardiovascular diseases
• Hall, R. S., et al. (2005) Asia Pacific J. Clinical Nutrition 14: 91-97.
• Lee et. al. (2006) Am J Clin Nutr 84: 975– 80.
• Lee et. al. (2009) Am J Clin Nutr 89: 1-7
4. Lupin protein interaction with gluten network
The lupin flour introduces protein molecules into the gluten
network of lupin-wheat bread that are more compact
5. At the consumption of lupin-wheat bread two
complex systems interacting
first stage of
solubilisation
through
chewing and
action of saliva
subsequent
stages of
digestion
bread matrix
- multi-components
- varying degrees of cross-linking
6. We are now able to
Directly examine the proteins in the baked product:
• new quality assurance tools
• investigate attributes of wheat and lupin protein
regarding accessibility to the overall digestion process
Methodology used
Two dimensional gel electrophoresis followed by
MS/MS peptide sequencing
Direct MALDI-TOF mass spectrometry
7. Wheat flour Wheat bread Wheat bread
100
HMW glutenin
75
50
37
Gliadin
Gliadin Gliadin
25
20
15
10
with reducing extraction with reducing extraction without reducing extraction
Lupin-wheat bread Lupin-wheat bread
HMW
glutenin
Wheat protein’s
response to the
baking process Gliadin
8. Key points of wheat protein extractability
after baking
Most of the wheat proteins, including HMW glutenins are extractable.
LMW wheat proteins are even extractable at milder extraction buffer
(non-reducing and non-denaturing) while the HMW are not.
Some wheat proteins loose their extractability as interaction with lupin
proteins in baking.
9. Lupin protein extractability from lupin-wheat bread
Under reducing and denaturing condition
4.0------------ -----------------------PI ---------------- -------------------9.0 4.0------------ -------------------------PI ---------------- -------------------9.0 4.0------------ -------------------------PI ---------------- -------------------9.0
100
75
50
37
Wheat flour
25
20
15
10
Lupin flour Lupin-wheat bread Wheat flour
The alpha conglutins are extractable
The beta, gamma and delta conglutins become intimately bound
within the bread matrix so that they are difficult to extract
Islam et. al. (2011) journal of agriculture and food chemistry 59:6696-6704
10. Lupin protein extractability from lupin-wheat bread
At milder extraction
Alpha conglutins are readily extractable from lupin-wheat bread even at
very mild condition such as 0.5 M NaCl
Lupin-wheat bread protein with Lupin-wheat bread protein with
0.5 M NaCl extraction 0.05 M NaCl extraction
High resolution study of proteins by direct MALDI-TOF also confirmed the
recovery of lupin protein from lupin-wheat bread under 0.5 M NaCl extraction
11. Key points of lupin protein extractability from
lupin-wheat bread
The conglutins (lupin proteins) fall into two very clear categories:
• the alpha group (both high and low molecular weight) which is
readily extracted even under mild conditions (0. 5M NaCl)
• the beta, delta and gamma groups that cannot be extracted, some
even under reducing/denaturing conditions
12. We postulate that this readily extracted class of lupin
protein (alpha-conglutins) are solubilised early in the
chewing process and may be significant in accounting
for some effects on health attributes (for example: blood
pressure regulation)
first stage of
solubilisation
through
chewing and
action of saliva
subsequent
stages of
digestion
13. Loosing extractability of beta conglutins apparently
indicates decrease of allergenic effect of lupin after baking
4.0------------ -----------------------PI ---------------- -------------------9.0
100
75
50
37
25 Goggin et. al. 2008: Proteomic analysis of lupin seed proteins to identify conglutin β
as an allergen, Lup an 1. Journal of Agricultural and Food Chemistry 56, 6370-
20 6377.
15
3
10 1 2 5
4 7 10 11 12
6
Lupin flour
13
9
Islam et. al. 2012. Comparative proteome analysis of seed storage and allergenic
proteins among four narrow-leafed lupin cultivars. Food Chemistry;
dx.doi.org/10.1016/j.foodchem.2012.05.081.
14. Why lupin proteins behave differently?
We believe the different lupin protein classes have varying degrees of
cross-linking with the gluten matrix.
The alpha-conglutins are generally a class of protein that is more
thermally stable than beta-conglutins and we consider that may help to
maintain their independent status during the baking process.
Sirtori, et al. Food Chemistry, 2010. 120: p. 496-504.
15. Conclusions
Lupin and wheat proteins in the baked products have been
surprisingly straight-forward to identify
Most of the wheat proteins, including HMW glutenins are
extractable after baking although some are not extractable after the
addition of lupin protein in the flour mix for baking
Lupin proteins (conglutins) are divided into two distinct groups in
terms of extractability from bread matrix
• The alpha conglutins are readily extracted
• The beta, delta and gamma conglutins cannot be extracted, in
some cases even under reducing/denaturing conditions
20. Progress in sequencing for alpha conglutins
Peptides of Spot 1 from Peptides of Spot 22 from
An approach to generate protein peptide sequencing by peptide sequencing by
sequence form identified peptides MS/MS MS/MS
AGPVR AGMPK
ASLKVGEEEEEEEAGDGR FYLAGNPEEEYPETQQQR
CAGQGR GDEGQEEEETTTTTEER
CGAKVEFK GGHEEEEVEEER
EQLATFR GGHEEEEVEEERGR
GISILRR GGKDH
1 IRNQEEFEQEIGR GKPSESGPFNLR
22 KPSSPK KYETTEQGR GSVVLSERGDGAAVPR
NKMSVIPYASAIGSIMYAMLCTR HTRGDEGQEEEETTTTTEER
XEEXR IVEFQSNPNTLILPK
KGKPSESGPFNLR
KITMPSSTQGFTY
LLGFGINANENQR
NFLAGSEDNVIR
NNILSGFDPQFLSQALNIDEDTVHK
NTLEATFNTR
NTLEATFNTRYEEIQR
QIIRVEEGLGVISPK
QRVDTYWDLLSPK
RFYLAGNPEEEYPETQQQR
RGQEQSYQDEGVIVR
Targeted two major protein spots of TNRLENLQNYR
alpha conglutins VEEGLGVISPK 20
YQAMKAGPDGEVVSLR
21. Progress in sequencing for alpha conglutins
Primer design based on the peptides
Forward primer
R F Y L A G N P E E E Y P E T Q Q Q R
Reverse translation
CGATTCTATCTAGCTGGTAACCCAGAAGAAGAATATCCGGAAACCCA
GCAGCAGCGT
Primer (5’-3’): ATTCTATCTAGCTGGTAACCC
Reverse primer
H T R G D E G Q E E E E T T T T T E E R
Reverse translation
CATACACGAGGAGATGAAGGACAAGAGGAGGAAGAAACAACAACA
ACAACCGAAGAGCG
Primer (5’-3’): CTCTTCGGTTGTTGTTGTTG
21