This document discusses mechanisms of genetic recombination and antigenic variation. It begins by explaining the benefits of recombination, including separating favorable and unfavorable mutations and generating new gene combinations. It then describes several types of homologous recombination, including double-strand break repair and gene conversion. Specific proteins involved in initiating recombination, such as RecBCD and RecA, are also discussed. The document focuses on examples of antigenic variation in pathogenic protozoa, including Plasmodium falciparum and African trypanosomes. It describes how these organisms use large gene families and recombination-mediated switching of variant surface antigens to evade the immune system through clonal antigenic variation.
1. Bacterial genetics follows the same principles as other organisms, with bacteria reproducing asexually and passing genetic traits from parents to offspring.
2. DNA was discovered to be the genetic material through experiments like Griffith's, which showed that killed pneumococci could transfer genetic material to live pneumococci.
3. Bacteria have mechanisms for horizontal gene transfer including transformation, transduction, and conjugation. Conjugation involves direct contact between bacteria and transfer of plasmids which can carry antibiotic resistance or other genes.
Exchange of genes between two DNA molecules to form new combinations of genes on a chromosome
contributes to a population’s genetic diversity (source of variation in evolution)
Recombination is more likely than mutation to be beneficial
Less likely destroy a gene's function
May bring together combinations of genes
This document summarizes various structures and mechanisms in prokaryotic cells. It discusses biofilms, cell walls, membrane transport systems, secretion systems, flagella, pili, DNA transfer through transformation, transduction, and conjugation, as well as endospore formation. Bacterial adaptation is enabled by horizontal gene transfer including plasmids, transposons, and pathogenicity islands which facilitate the acquisition of virulence factors and antibiotic resistance.
Genome editing uses tools like CRISPR/Cas9 to make precise, targeted changes to DNA in crop plants. The document discusses using CRISPR to edit the SlMlo1 gene in tomato, conferring resistance to powdery mildew. Researchers generated CRISPR/Cas9 plasmids targeting SlMlo1, transformed tomato plants, and identified lines with 48 bp deletions in the gene. Resistant T1 plants lacking the transgene were obtained, named the Tomelo variety. Genome editing provides a faster way to introduce disease resistance than conventional breeding.
- Antibodies are Y-shaped proteins produced by B cells that recognize and bind to pathogens. They have great diversity and specificity that allows them to target a wide range of antigens.
- Antibodies are composed of two heavy chains and two light chains that form an antigen binding site. The variable regions of the heavy and light chains are responsible for binding to different antigens.
- Monoclonal antibodies are produced from a single clone of B cells and have identical antigen specificity, allowing them to be used as standardized reagents for research and medical purposes. They are produced by fusing B cells with myeloma cells to form immortal hybridomas.
Bacterial genetics involves three main mechanisms of horizontal gene transfer - transformation, transduction, and conjugation. These mechanisms allow bacteria to acquire new genetic material from other bacteria to help them survive in changing environments. Mutation also contributes to genetic variation in bacteria and usually involves changes to single genes, while gene transfer can involve simultaneous transfer of multiple genes.
The hereditary material of organisms is DNA, which contains genetic information in the form of a specific nucleotide sequence. This DNA is organized into chromosomes that make up an organism's genome. Gene expression involves transcription of DNA into RNA, which may undergo processing before being translated into proteins. The proteins then fold and are transported within the cell. Regulation of gene expression controls when and how much of gene products are made to allow cells to adapt. Gene expression can be measured to provide insight into cellular processes.
A short yet comprehensive presentation on bacterial genetics, an important microbiology topic for BDS 2nd, MBBS 2nd and MD/MS /MDS 1st . Made using CP Baveja's Textbook of Microbiology. Meant as an introduction and overview with stress on some key areas.
Topics covered: Basic Principles, Synthesis of Protein, Extra Chromosomal Genetic Material, Bacterial Variation , Gene Transfer, Genetic Mechanisms of Drug Resistance, Genetic Engineering, DNA Probes, Polymerase Chain Reaction, Genetically Modified Organisms and Gene Therapy.
1. Bacterial genetics follows the same principles as other organisms, with bacteria reproducing asexually and passing genetic traits from parents to offspring.
2. DNA was discovered to be the genetic material through experiments like Griffith's, which showed that killed pneumococci could transfer genetic material to live pneumococci.
3. Bacteria have mechanisms for horizontal gene transfer including transformation, transduction, and conjugation. Conjugation involves direct contact between bacteria and transfer of plasmids which can carry antibiotic resistance or other genes.
Exchange of genes between two DNA molecules to form new combinations of genes on a chromosome
contributes to a population’s genetic diversity (source of variation in evolution)
Recombination is more likely than mutation to be beneficial
Less likely destroy a gene's function
May bring together combinations of genes
This document summarizes various structures and mechanisms in prokaryotic cells. It discusses biofilms, cell walls, membrane transport systems, secretion systems, flagella, pili, DNA transfer through transformation, transduction, and conjugation, as well as endospore formation. Bacterial adaptation is enabled by horizontal gene transfer including plasmids, transposons, and pathogenicity islands which facilitate the acquisition of virulence factors and antibiotic resistance.
Genome editing uses tools like CRISPR/Cas9 to make precise, targeted changes to DNA in crop plants. The document discusses using CRISPR to edit the SlMlo1 gene in tomato, conferring resistance to powdery mildew. Researchers generated CRISPR/Cas9 plasmids targeting SlMlo1, transformed tomato plants, and identified lines with 48 bp deletions in the gene. Resistant T1 plants lacking the transgene were obtained, named the Tomelo variety. Genome editing provides a faster way to introduce disease resistance than conventional breeding.
- Antibodies are Y-shaped proteins produced by B cells that recognize and bind to pathogens. They have great diversity and specificity that allows them to target a wide range of antigens.
- Antibodies are composed of two heavy chains and two light chains that form an antigen binding site. The variable regions of the heavy and light chains are responsible for binding to different antigens.
- Monoclonal antibodies are produced from a single clone of B cells and have identical antigen specificity, allowing them to be used as standardized reagents for research and medical purposes. They are produced by fusing B cells with myeloma cells to form immortal hybridomas.
Bacterial genetics involves three main mechanisms of horizontal gene transfer - transformation, transduction, and conjugation. These mechanisms allow bacteria to acquire new genetic material from other bacteria to help them survive in changing environments. Mutation also contributes to genetic variation in bacteria and usually involves changes to single genes, while gene transfer can involve simultaneous transfer of multiple genes.
The hereditary material of organisms is DNA, which contains genetic information in the form of a specific nucleotide sequence. This DNA is organized into chromosomes that make up an organism's genome. Gene expression involves transcription of DNA into RNA, which may undergo processing before being translated into proteins. The proteins then fold and are transported within the cell. Regulation of gene expression controls when and how much of gene products are made to allow cells to adapt. Gene expression can be measured to provide insight into cellular processes.
A short yet comprehensive presentation on bacterial genetics, an important microbiology topic for BDS 2nd, MBBS 2nd and MD/MS /MDS 1st . Made using CP Baveja's Textbook of Microbiology. Meant as an introduction and overview with stress on some key areas.
Topics covered: Basic Principles, Synthesis of Protein, Extra Chromosomal Genetic Material, Bacterial Variation , Gene Transfer, Genetic Mechanisms of Drug Resistance, Genetic Engineering, DNA Probes, Polymerase Chain Reaction, Genetically Modified Organisms and Gene Therapy.
Genetic of microorganisms provides advantages for genetic research due to their simple genome structures, universal gene code, lack of diploid chromosomes and dominant genes, ease of cultivation, rapid reproduction, genetic population heterogeneity, and accessibility of modern genetic analysis methods. Bacteria like E. coli have smaller, supercoiled DNA compared to human cells. Bacterial genomes contain structural and regulatory genes organized into operons that control gene expression. The lac and arg operons demonstrate inducible and repressible gene regulation through repressor proteins and substrate/product binding. Mutation, recombination, and mobile genetic elements allow for genetic variation and horizontal gene transfer between microorganisms.
This document provides an overview of microbial genetics. It begins by defining key terms like genetics, gene, genome, and phenotype. It then discusses DNA structure and replication, explaining how DNA is copied semiconservatively. The processes of transcription and translation are described, showing how DNA is transcribed into mRNA and then translated into proteins. The document outlines gene regulation in bacteria through operons and repression and induction. It also covers mutations, mutagens, horizontal gene transfer through transformation, conjugation and transduction, and mobile genetic elements like plasmids and transposons.
Bacterial genetics involves the study of bacterial chromosomes, plasmids, transcription, translation, replication, and genetic variation. Bacteria store DNA in circular chromosomes and small plasmids. Transcription and translation allow genes to be expressed. Replication duplicates genetic material. Bacteria undergo genetic variation through mutation, transformation, conjugation, and transduction, allowing them to adapt. Genetic engineering uses bacteria to produce recombinant proteins for research and medical purposes like vaccines.
Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...Indian dental academy
The Indian Dental Academy is the Leader in continuing dental education , training dentists in all aspects of dentistry and offering a wide range of dental certified courses in different formats.
Indian dental academy provides dental crown & Bridge,rotary endodontics,fixed orthodontics,
Dental implants courses.for details pls visit www.indiandentalacademy.com ,or call
0091-9248678078
This document discusses DNA recombination, which is the process by which two DNA molecules exchange genetic information. There are two main types of recombination: homologous recombination, which occurs between similar or identical DNA sequences, and non-homologous recombination, which does not require sequence similarity. Homologous recombination is important for DNA repair and genetic diversity through generating new combinations of genes during meiosis. It is extensively studied in E. coli and involves many proteins like RecBCD and RecA. The Holliday model is commonly used to explain homologous recombination through the formation of Holliday junctions. Site-specific and gene conversion are other types of homologous recombination, while transposition involves non-hom
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...Pat (JS) Heslop-Harrison
An overview of plant molecular cytogenetics. The lecture Trude Schwarzacher presented to the ECA conference Strasbourg in July 2015 is http://www.slideshare.net/PatHeslopHarrison/trude-schwarzacher
I am Stacy T. I am a Microbiology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Microbiology, from Torrens University, Australia. I have been helping students with their assignments for the past 7 years. I solve assignments related to Microbiology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Microbiology Assignments.
Genetics is the science of heredity and variation in living organisms. Basic units of inheritance are called genes, which are segments of DNA that encode specific functions. Modern genetics studies not only inheritance but also gene functions and behaviors. Genetic epidemiology examines the roles of genes and their interactions with the environment in disease occurrence in human populations. Objectives include determining risks associated with gene variants, mapping genomic regions linked to disease susceptibility, and identifying susceptibility genes.
A comprehensive study of shuttle vector & binary vector and its rules of in ...PRABAL SINGH
Vector: A vector is a DNA molecule that has the ability to replicate autonomously in an appropriate host cell and into which the DNA fragment to be cloned is integrated for cloning
Genomics is impacting all areas of medicine. In transfusion medicine, DNA-based genotyping is being used as an alternative to serological antibody-based methods.
Single nucleotide changes (SNP's) in the respective genes are responsible for most antigenic polymorphisms.
Validated by comparison with antibody-based typing.
Provide the patient’s comprehensive extended blood group profile as part of their medical record by the growth of whole-genome sequencing (WGS).
- Monoclonal antibodies have been previously developed against proteins found on acute myeloid leukemia (AML) cells, including CD47, CD33, and CD13. These antibodies can elicit immune responses or carry toxins to kill cancer cells.
- The document describes novel monoclonal antibodies developed against the upregulated protein gC1qR found on AML cells. Studies on these antibodies aimed to tailor antibody-based therapies for AML.
- The antibodies were shown to effectively deplete the percentage of live cancer cells in viability assays, demonstrating their potential as a treatment for AML.
The document discusses several key concepts in bacterial genetics including:
- Bacterial DNA typically consists of a single circular chromosome, though some bacteria have two chromosomes. Genetic information is stored in DNA as codons.
- Bacteria can acquire new genetic traits through horizontal gene transfer mechanisms like transformation, transduction, and conjugation. Transformation involves uptake of naked DNA while transduction involves transfer via bacteriophages.
- Mutation, both spontaneous and induced, introduces random heritable changes in bacterial DNA and can affect traits like antibiotic resistance. Common mutagens include UV light and chemicals.
- Other genetic elements in bacteria include plasmids, which are extrachromosomal DNA, and transposons,
This document discusses bacterial genetics and related topics. It begins by defining genetics and genomics, and describing bacterial DNA structure. Key points include that bacteria typically have a single circular chromosome, and the ratio of A/T to G/C nucleotides is consistent within species. Genetic information is stored in codons, and there are 61 sense codons that code for 20 amino acids. Mutation, horizontal gene transfer through transformation, transduction, conjugation, and extrachromosomal elements such as plasmids are described. The lactose operon and mechanisms of antibiotic resistance and drug resistance are also summarized.
The document describes an expression technology called GPEx that produces genetically stable mammalian cell lines with single copies of transgenes inserted at multiple unique sites in the genome. This allows for high and consistent expression levels without the genetic instability issues seen in cell lines with multiple transgene copies arranged in arrays. The GPEx technology uses retroviral vectors to insert transgenes into various cell types and targets transcriptionally active regions of the genome. It can generate cell lines expressing single or multiple genes without the need for selection markers or amplification methods, shortening the cell line development timeline. Characterization of GPEx cell lines showed high genetic stability over many generations of culture.
This document discusses high-resolution views of the cancer genome using various technologies including DNA microarrays, comparative genomic hybridization, tiling arrays, next-generation sequencing, and DNAse-Seq. It describes how these technologies can be used to analyze gene expression, copy number variation, chromatin structure, and more to better understand cancer at the genomic level. Integrating data from all these sources presents challenges but may help improve individual health outcomes.
This document summarizes bacterial and viral chromosomes. It discusses the structure of bacterial chromosomes, using E. coli as an example. It notes that E. coli has a single circular chromosome containing all of its genes. It describes the sequencing and mapping of the E. coli chromosome, including its size, gene content, and organization. It also discusses horizontal gene transfer in E. coli and the insertion of genetic elements into its chromosome. The document then summarizes viral genomes, noting that viruses have either DNA or RNA and can be single or double stranded. It provides details on the genome of bacteriophage T4.
A transplastomic plant is a genetically modified plant in which the new genes have not been inserted in the nuclear DNA but in the DNA of the chloroplasts.
The document discusses recombinant DNA technology. It begins by explaining that recombinant DNA is formed by joining DNA molecules or fragments from different sources. This technology has proven valuable in medicine, agriculture, industry and more. Key techniques discussed include using restriction enzymes to cut DNA at specific sequences, generating sticky or blunt ends, and joining DNA fragments together with DNA ligase to form recombinant DNA. The document also summarizes cloning recombinant DNA in bacteria using vectors like plasmids or cloning in eukaryotic cells using yeast artificial chromosomes. It describes amplification of DNA by cloning in cells or by polymerase chain reaction (PCR).
The document discusses different host systems for producing recombinant proteins, including prokaryotic and eukaryotic systems. It focuses on the bacterial expression system Escherichia coli (E. coli) as a widely used prokaryotic host. While E. coli allows high levels of recombinant protein expression at low cost, it has limitations such as a lack of post-translational modifications and improper protein folding. Recent research has shown some success in secreting recombinant proteins from E. coli to circumvent some of these limitations. The document examines advantages and challenges of various host systems for recombinant protein production.
Genetic of microorganisms provides advantages for genetic research due to their simple genome structures, universal gene code, lack of diploid chromosomes and dominant genes, ease of cultivation, rapid reproduction, genetic population heterogeneity, and accessibility of modern genetic analysis methods. Bacteria like E. coli have smaller, supercoiled DNA compared to human cells. Bacterial genomes contain structural and regulatory genes organized into operons that control gene expression. The lac and arg operons demonstrate inducible and repressible gene regulation through repressor proteins and substrate/product binding. Mutation, recombination, and mobile genetic elements allow for genetic variation and horizontal gene transfer between microorganisms.
This document provides an overview of microbial genetics. It begins by defining key terms like genetics, gene, genome, and phenotype. It then discusses DNA structure and replication, explaining how DNA is copied semiconservatively. The processes of transcription and translation are described, showing how DNA is transcribed into mRNA and then translated into proteins. The document outlines gene regulation in bacteria through operons and repression and induction. It also covers mutations, mutagens, horizontal gene transfer through transformation, conjugation and transduction, and mobile genetic elements like plasmids and transposons.
Bacterial genetics involves the study of bacterial chromosomes, plasmids, transcription, translation, replication, and genetic variation. Bacteria store DNA in circular chromosomes and small plasmids. Transcription and translation allow genes to be expressed. Replication duplicates genetic material. Bacteria undergo genetic variation through mutation, transformation, conjugation, and transduction, allowing them to adapt. Genetic engineering uses bacteria to produce recombinant proteins for research and medical purposes like vaccines.
Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...Indian dental academy
The Indian Dental Academy is the Leader in continuing dental education , training dentists in all aspects of dentistry and offering a wide range of dental certified courses in different formats.
Indian dental academy provides dental crown & Bridge,rotary endodontics,fixed orthodontics,
Dental implants courses.for details pls visit www.indiandentalacademy.com ,or call
0091-9248678078
This document discusses DNA recombination, which is the process by which two DNA molecules exchange genetic information. There are two main types of recombination: homologous recombination, which occurs between similar or identical DNA sequences, and non-homologous recombination, which does not require sequence similarity. Homologous recombination is important for DNA repair and genetic diversity through generating new combinations of genes during meiosis. It is extensively studied in E. coli and involves many proteins like RecBCD and RecA. The Holliday model is commonly used to explain homologous recombination through the formation of Holliday junctions. Site-specific and gene conversion are other types of homologous recombination, while transposition involves non-hom
Plant Chromosomes: European Cytogeneticists outline: Trude Schwarzacher and P...Pat (JS) Heslop-Harrison
An overview of plant molecular cytogenetics. The lecture Trude Schwarzacher presented to the ECA conference Strasbourg in July 2015 is http://www.slideshare.net/PatHeslopHarrison/trude-schwarzacher
I am Stacy T. I am a Microbiology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Microbiology, from Torrens University, Australia. I have been helping students with their assignments for the past 7 years. I solve assignments related to Microbiology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Microbiology Assignments.
Genetics is the science of heredity and variation in living organisms. Basic units of inheritance are called genes, which are segments of DNA that encode specific functions. Modern genetics studies not only inheritance but also gene functions and behaviors. Genetic epidemiology examines the roles of genes and their interactions with the environment in disease occurrence in human populations. Objectives include determining risks associated with gene variants, mapping genomic regions linked to disease susceptibility, and identifying susceptibility genes.
A comprehensive study of shuttle vector & binary vector and its rules of in ...PRABAL SINGH
Vector: A vector is a DNA molecule that has the ability to replicate autonomously in an appropriate host cell and into which the DNA fragment to be cloned is integrated for cloning
Genomics is impacting all areas of medicine. In transfusion medicine, DNA-based genotyping is being used as an alternative to serological antibody-based methods.
Single nucleotide changes (SNP's) in the respective genes are responsible for most antigenic polymorphisms.
Validated by comparison with antibody-based typing.
Provide the patient’s comprehensive extended blood group profile as part of their medical record by the growth of whole-genome sequencing (WGS).
- Monoclonal antibodies have been previously developed against proteins found on acute myeloid leukemia (AML) cells, including CD47, CD33, and CD13. These antibodies can elicit immune responses or carry toxins to kill cancer cells.
- The document describes novel monoclonal antibodies developed against the upregulated protein gC1qR found on AML cells. Studies on these antibodies aimed to tailor antibody-based therapies for AML.
- The antibodies were shown to effectively deplete the percentage of live cancer cells in viability assays, demonstrating their potential as a treatment for AML.
The document discusses several key concepts in bacterial genetics including:
- Bacterial DNA typically consists of a single circular chromosome, though some bacteria have two chromosomes. Genetic information is stored in DNA as codons.
- Bacteria can acquire new genetic traits through horizontal gene transfer mechanisms like transformation, transduction, and conjugation. Transformation involves uptake of naked DNA while transduction involves transfer via bacteriophages.
- Mutation, both spontaneous and induced, introduces random heritable changes in bacterial DNA and can affect traits like antibiotic resistance. Common mutagens include UV light and chemicals.
- Other genetic elements in bacteria include plasmids, which are extrachromosomal DNA, and transposons,
This document discusses bacterial genetics and related topics. It begins by defining genetics and genomics, and describing bacterial DNA structure. Key points include that bacteria typically have a single circular chromosome, and the ratio of A/T to G/C nucleotides is consistent within species. Genetic information is stored in codons, and there are 61 sense codons that code for 20 amino acids. Mutation, horizontal gene transfer through transformation, transduction, conjugation, and extrachromosomal elements such as plasmids are described. The lactose operon and mechanisms of antibiotic resistance and drug resistance are also summarized.
The document describes an expression technology called GPEx that produces genetically stable mammalian cell lines with single copies of transgenes inserted at multiple unique sites in the genome. This allows for high and consistent expression levels without the genetic instability issues seen in cell lines with multiple transgene copies arranged in arrays. The GPEx technology uses retroviral vectors to insert transgenes into various cell types and targets transcriptionally active regions of the genome. It can generate cell lines expressing single or multiple genes without the need for selection markers or amplification methods, shortening the cell line development timeline. Characterization of GPEx cell lines showed high genetic stability over many generations of culture.
This document discusses high-resolution views of the cancer genome using various technologies including DNA microarrays, comparative genomic hybridization, tiling arrays, next-generation sequencing, and DNAse-Seq. It describes how these technologies can be used to analyze gene expression, copy number variation, chromatin structure, and more to better understand cancer at the genomic level. Integrating data from all these sources presents challenges but may help improve individual health outcomes.
This document summarizes bacterial and viral chromosomes. It discusses the structure of bacterial chromosomes, using E. coli as an example. It notes that E. coli has a single circular chromosome containing all of its genes. It describes the sequencing and mapping of the E. coli chromosome, including its size, gene content, and organization. It also discusses horizontal gene transfer in E. coli and the insertion of genetic elements into its chromosome. The document then summarizes viral genomes, noting that viruses have either DNA or RNA and can be single or double stranded. It provides details on the genome of bacteriophage T4.
A transplastomic plant is a genetically modified plant in which the new genes have not been inserted in the nuclear DNA but in the DNA of the chloroplasts.
The document discusses recombinant DNA technology. It begins by explaining that recombinant DNA is formed by joining DNA molecules or fragments from different sources. This technology has proven valuable in medicine, agriculture, industry and more. Key techniques discussed include using restriction enzymes to cut DNA at specific sequences, generating sticky or blunt ends, and joining DNA fragments together with DNA ligase to form recombinant DNA. The document also summarizes cloning recombinant DNA in bacteria using vectors like plasmids or cloning in eukaryotic cells using yeast artificial chromosomes. It describes amplification of DNA by cloning in cells or by polymerase chain reaction (PCR).
The document discusses different host systems for producing recombinant proteins, including prokaryotic and eukaryotic systems. It focuses on the bacterial expression system Escherichia coli (E. coli) as a widely used prokaryotic host. While E. coli allows high levels of recombinant protein expression at low cost, it has limitations such as a lack of post-translational modifications and improper protein folding. Recent research has shown some success in secreting recombinant proteins from E. coli to circumvent some of these limitations. The document examines advantages and challenges of various host systems for recombinant protein production.
Similar to Lecture 7 - 10.12.09 - DNA Recombination.ppt (20)
Current Ms word generated power point presentation covers major details about the micronuclei test. It's significance and assays to conduct it. It is used to detect the micronuclei formation inside the cells of nearly every multicellular organism. It's formation takes place during chromosomal sepration at metaphase.
The technology uses reclaimed CO₂ as the dyeing medium in a closed loop process. When pressurized, CO₂ becomes supercritical (SC-CO₂). In this state CO₂ has a very high solvent power, allowing the dye to dissolve easily.
Phenomics assisted breeding in crop improvementIshaGoswami9
As the population is increasing and will reach about 9 billion upto 2050. Also due to climate change, it is difficult to meet the food requirement of such a large population. Facing the challenges presented by resource shortages, climate
change, and increasing global population, crop yield and quality need to be improved in a sustainable way over the coming decades. Genetic improvement by breeding is the best way to increase crop productivity. With the rapid progression of functional
genomics, an increasing number of crop genomes have been sequenced and dozens of genes influencing key agronomic traits have been identified. However, current genome sequence information has not been adequately exploited for understanding
the complex characteristics of multiple gene, owing to a lack of crop phenotypic data. Efficient, automatic, and accurate technologies and platforms that can capture phenotypic data that can
be linked to genomics information for crop improvement at all growth stages have become as important as genotyping. Thus,
high-throughput phenotyping has become the major bottleneck restricting crop breeding. Plant phenomics has been defined as the high-throughput, accurate acquisition and analysis of multi-dimensional phenotypes
during crop growing stages at the organism level, including the cell, tissue, organ, individual plant, plot, and field levels. With the rapid development of novel sensors, imaging technology,
and analysis methods, numerous infrastructure platforms have been developed for phenotyping.
Immersive Learning That Works: Research Grounding and Paths ForwardLeonel Morgado
We will metaverse into the essence of immersive learning, into its three dimensions and conceptual models. This approach encompasses elements from teaching methodologies to social involvement, through organizational concerns and technologies. Challenging the perception of learning as knowledge transfer, we introduce a 'Uses, Practices & Strategies' model operationalized by the 'Immersive Learning Brain' and ‘Immersion Cube’ frameworks. This approach offers a comprehensive guide through the intricacies of immersive educational experiences and spotlighting research frontiers, along the immersion dimensions of system, narrative, and agency. Our discourse extends to stakeholders beyond the academic sphere, addressing the interests of technologists, instructional designers, and policymakers. We span various contexts, from formal education to organizational transformation to the new horizon of an AI-pervasive society. This keynote aims to unite the iLRN community in a collaborative journey towards a future where immersive learning research and practice coalesce, paving the way for innovative educational research and practice landscapes.
hematic appreciation test is a psychological assessment tool used to measure an individual's appreciation and understanding of specific themes or topics. This test helps to evaluate an individual's ability to connect different ideas and concepts within a given theme, as well as their overall comprehension and interpretation skills. The results of the test can provide valuable insights into an individual's cognitive abilities, creativity, and critical thinking skills
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...Sérgio Sacani
Context. With a mass exceeding several 104 M⊙ and a rich and dense population of massive stars, supermassive young star clusters
represent the most massive star-forming environment that is dominated by the feedback from massive stars and gravitational interactions
among stars.
Aims. In this paper we present the Extended Westerlund 1 and 2 Open Clusters Survey (EWOCS) project, which aims to investigate
the influence of the starburst environment on the formation of stars and planets, and on the evolution of both low and high mass stars.
The primary targets of this project are Westerlund 1 and 2, the closest supermassive star clusters to the Sun.
Methods. The project is based primarily on recent observations conducted with the Chandra and JWST observatories. Specifically,
the Chandra survey of Westerlund 1 consists of 36 new ACIS-I observations, nearly co-pointed, for a total exposure time of 1 Msec.
Additionally, we included 8 archival Chandra/ACIS-S observations. This paper presents the resulting catalog of X-ray sources within
and around Westerlund 1. Sources were detected by combining various existing methods, and photon extraction and source validation
were carried out using the ACIS-Extract software.
Results. The EWOCS X-ray catalog comprises 5963 validated sources out of the 9420 initially provided to ACIS-Extract, reaching a
photon flux threshold of approximately 2 × 10−8 photons cm−2
s
−1
. The X-ray sources exhibit a highly concentrated spatial distribution,
with 1075 sources located within the central 1 arcmin. We have successfully detected X-ray emissions from 126 out of the 166 known
massive stars of the cluster, and we have collected over 71 000 photons from the magnetar CXO J164710.20-455217.
When I was asked to give a companion lecture in support of ‘The Philosophy of Science’ (https://shorturl.at/4pUXz) I decided not to walk through the detail of the many methodologies in order of use. Instead, I chose to employ a long standing, and ongoing, scientific development as an exemplar. And so, I chose the ever evolving story of Thermodynamics as a scientific investigation at its best.
Conducted over a period of >200 years, Thermodynamics R&D, and application, benefitted from the highest levels of professionalism, collaboration, and technical thoroughness. New layers of application, methodology, and practice were made possible by the progressive advance of technology. In turn, this has seen measurement and modelling accuracy continually improved at a micro and macro level.
Perhaps most importantly, Thermodynamics rapidly became a primary tool in the advance of applied science/engineering/technology, spanning micro-tech, to aerospace and cosmology. I can think of no better a story to illustrate the breadth of scientific methodologies and applications at their best.
The use of Nauplii and metanauplii artemia in aquaculture (brine shrimp).pptxMAGOTI ERNEST
Although Artemia has been known to man for centuries, its use as a food for the culture of larval organisms apparently began only in the 1930s, when several investigators found that it made an excellent food for newly hatched fish larvae (Litvinenko et al., 2023). As aquaculture developed in the 1960s and ‘70s, the use of Artemia also became more widespread, due both to its convenience and to its nutritional value for larval organisms (Arenas-Pardo et al., 2024). The fact that Artemia dormant cysts can be stored for long periods in cans, and then used as an off-the-shelf food requiring only 24 h of incubation makes them the most convenient, least labor-intensive, live food available for aquaculture (Sorgeloos & Roubach, 2021). The nutritional value of Artemia, especially for marine organisms, is not constant, but varies both geographically and temporally. During the last decade, however, both the causes of Artemia nutritional variability and methods to improve poorquality Artemia have been identified (Loufi et al., 2024).
Brine shrimp (Artemia spp.) are used in marine aquaculture worldwide. Annually, more than 2,000 metric tons of dry cysts are used for cultivation of fish, crustacean, and shellfish larva. Brine shrimp are important to aquaculture because newly hatched brine shrimp nauplii (larvae) provide a food source for many fish fry (Mozanzadeh et al., 2021). Culture and harvesting of brine shrimp eggs represents another aspect of the aquaculture industry. Nauplii and metanauplii of Artemia, commonly known as brine shrimp, play a crucial role in aquaculture due to their nutritional value and suitability as live feed for many aquatic species, particularly in larval stages (Sorgeloos & Roubach, 2021).
Unlocking the mysteries of reproduction: Exploring fecundity and gonadosomati...AbdullaAlAsif1
The pygmy halfbeak Dermogenys colletei, is known for its viviparous nature, this presents an intriguing case of relatively low fecundity, raising questions about potential compensatory reproductive strategies employed by this species. Our study delves into the examination of fecundity and the Gonadosomatic Index (GSI) in the Pygmy Halfbeak, D. colletei (Meisner, 2001), an intriguing viviparous fish indigenous to Sarawak, Borneo. We hypothesize that the Pygmy halfbeak, D. colletei, may exhibit unique reproductive adaptations to offset its low fecundity, thus enhancing its survival and fitness. To address this, we conducted a comprehensive study utilizing 28 mature female specimens of D. colletei, carefully measuring fecundity and GSI to shed light on the reproductive adaptations of this species. Our findings reveal that D. colletei indeed exhibits low fecundity, with a mean of 16.76 ± 2.01, and a mean GSI of 12.83 ± 1.27, providing crucial insights into the reproductive mechanisms at play in this species. These results underscore the existence of unique reproductive strategies in D. colletei, enabling its adaptation and persistence in Borneo's diverse aquatic ecosystems, and call for further ecological research to elucidate these mechanisms. This study lends to a better understanding of viviparous fish in Borneo and contributes to the broader field of aquatic ecology, enhancing our knowledge of species adaptations to unique ecological challenges.
The debris of the ‘last major merger’ is dynamically youngSérgio Sacani
The Milky Way’s (MW) inner stellar halo contains an [Fe/H]-rich component with highly eccentric orbits, often referred to as the
‘last major merger.’ Hypotheses for the origin of this component include Gaia-Sausage/Enceladus (GSE), where the progenitor
collided with the MW proto-disc 8–11 Gyr ago, and the Virgo Radial Merger (VRM), where the progenitor collided with the
MW disc within the last 3 Gyr. These two scenarios make different predictions about observable structure in local phase space,
because the morphology of debris depends on how long it has had to phase mix. The recently identified phase-space folds in Gaia
DR3 have positive caustic velocities, making them fundamentally different than the phase-mixed chevrons found in simulations
at late times. Roughly 20 per cent of the stars in the prograde local stellar halo are associated with the observed caustics. Based
on a simple phase-mixing model, the observed number of caustics are consistent with a merger that occurred 1–2 Gyr ago.
We also compare the observed phase-space distribution to FIRE-2 Latte simulations of GSE-like mergers, using a quantitative
measurement of phase mixing (2D causticality). The observed local phase-space distribution best matches the simulated data
1–2 Gyr after collision, and certainly not later than 3 Gyr. This is further evidence that the progenitor of the ‘last major merger’
did not collide with the MW proto-disc at early times, as is thought for the GSE, but instead collided with the MW disc within
the last few Gyr, consistent with the body of work surrounding the VRM.
Or: Beyond linear.
Abstract: Equivariant neural networks are neural networks that incorporate symmetries. The nonlinear activation functions in these networks result in interesting nonlinear equivariant maps between simple representations, and motivate the key player of this talk: piecewise linear representation theory.
Disclaimer: No one is perfect, so please mind that there might be mistakes and typos.
dtubbenhauer@gmail.com
Corrected slides: dtubbenhauer.com/talks.html
2. Why Recombination?
Two Broad Categories
Homologous (or general)
Site-specific (e.g. phage genomes into bacterial chromosomes)
Mutation happens - without recombination, mutation target
would increase from gene to entire chromosome
Recombination allows favorable and unfavorable mutations
to be separated
Provides a means of escape, to generate new combinations
of genes, and spreading of favorable alleles
3. Homologous Recombination
Required for DNA replication, repairs accidents at
replication fork
Repairs double strand DNA (dsDNA) breaks
Occurs at meiosis (cross-overs)
Happens at “four strand” stage of meiosis, involves
two of four strands
Occurs randomly between homologous sequences
Double strand break repair (DSBR) model
Allelic and non-allelic (ectopic recombination)
4. General Recombination often involves a
Holliday Junction
Proposed by Dr. Holliday (Holliday R. 1964. A mechanisms for gene conversion in fungi.
Genet. Res. 5:282-304)
Recombination intermediate, also called cross-strand
exchange
Between two pairs of strands, one crossing and one non-
crossing
Can resolve in two ways depending on second DNA cut
Patch recombinant - Original pair of crossing strands cut
Two recombinant chromosomes - Opposite pair of non-crossing strands cut
8. a a b b
A
B
A B
a+ b
a +B
Mechanisms of Gene
Conversion/Recombination
1) Double-strand break (DSB) repair
2) Synthesis-dependent strand annealing (SDSA)
Chen J et al. Nature Reviews Genetics. 2007. 8:762-775
9. Double-stranded (dsDNA) breaks
are not uncommon
Meiosis
Created by topoisomerase-like enzymes
Mitosis
Radiation
Mutagens (e.g. chemicals)
Stalled replication forks
Specialized endonucleases (eg site-specific HO endonuclease in
switching of yeast matting type (MAT) genes)
10. Recombination requires DNA binding
proteins
Extensively studied in model organisms, E. coli and yeast
Bacterial recombination enzymes identified by Rec - mutations
At least 25 proteins are involved in homologous recombination
in E. coli
Remember four; RecBCD and RecA
11. 3 member protein complex with endonuclease and
helicase activity
essential for 99% of recombination events
occurring at double-stranded breaks in bacteria
binds double stranded break
unwinds and degrades DNA
Pauses at chi sequence
Loads RecA on 3’ ssDNA extensions
RecBCD
13. RecA
Involved in SOS response; required for nearly ALL homologous
recombination in bacteria
Single-strand DNA binding protein, DNA dependent ATPase
Multiple DNA binding sites
Initiates the exchange of DNA between two recombining DNA
double helixes
RecA enables single stranded DNA
to invade DNA helix
Eukaryotes have multiple homologs of bacterial RecA
(Rad51 is best studied)
14. Chi site Χ
Recombination hotspot
Modifies RecBCD enzymatic activity
5’ GCTGGTGG 3’
1009 chi (Χ) sites in E. coli genome
Χ homologs in other bacteria
17. Gene Conversion
A special type of homologous recombination
Non-reciprocal transfer of genetic material from a ‘donor’
sequence to a highly homologous ‘acceptor’ sequence
Initiated by double strand DNA (dsDNA) breaks
5’ > 3’ exonucleases
3’ ssDNA tail strand invasion (RAD51 and others)
Outcome: portion of ‘donor’ sequence copied to ‘acceptor’
and original ‘donor’ copy unchanged
donor acceptor
gene
conversion
18. Gene Conversion is not uncommon
Yeast mating type switch (MAT) genes
Human repetitive sequence elements (Alu and LINE-1 sequences)*
Human gene families (e.g. MHC alleles, Rh blood group antigens,
olfactory receptor genes)
Chicken B cells Ig gene diversification
Pathogen clonal antigenic variation (e.g. African Trypanosomes
and Babesia bovis)
* Chen et al. 2007 Gene conversion: mechanisms, evolution and human disease Nature Reviews Genetics. 8: 762-775.
20. Variable Surface Antigens of Pathogenic Protozoa
Organism
Causative
Agent
Variable
Antigen
Structural Features Functions
Plasmodium
falciparum
Malaria
PfEMP1 (var
gene product)
200-350 kDA
transmembrane
protein at the surface
of IRBC
Infected erythrocyte surface,
adherence to host surface molecules
African
Trypanosom
es
African
Sleeping
sickness
VSG
~60 kDa protein
anchored by GPI-
linkage at the parasite
surface
Densely packed, variable surface
coat, immune evasion
Two Pathogens: Two Approaches
21. Large families of non-allelic genes (one gene ON, others OFF)
Antigens are highly immunogenic but poorly cross-reactive
Switching occurs at high but variable rate
Switching is frequently accomplished by duplicative gene conversion
into an expression site or DNA rearrangement
Recombination generates diversity in gene families
Means for survival and transmission
Common Themes of Clonally Variant Antigens
Kyes S. et al. Annu Rev. Microbiol. 2001. 55:673-707
22. African Trypanosomes
1000s of VSG gene/gene fragments
dedicated expression site
recombination mediated switching (RAD51-associated)
Plasmodium falciparum
~60 var genes
in situ expression (no dedicated expression site)
primarily non-recombinational switching
Variations on a Theme
24. Trypanosome antigen switching
At each wave, different VSGs are expressed
Switch rates - 10-2 to 10-6 per cell in blood
>100 VSGs expressed sequentially in one rabbit
Switch not induced by the immune system
Semi-programmed -- early VSGs are always early
25. Variant surface glycoproteins
Completely cover the blood-stage tryp in a tight coat (107 /cell)
except the flagellar pocket
Glycolipid anchor (released by phospholipase C)
VSG protein -- ~450 amino acids
C-term is more conserved (not exposed)
N-term highly variable sequence
3-D structures are very similar
26. VSG Proteins Have Diverse Sequence
but Related Structure
Blum M et al. Nature. 1993. 362: 603-9
• The crystal structure was
compared between two VSGs
• Despite low sequence
similarity the structures were
remarkably similar
Conclusion: Antigenic variation
in trypanosomes is
accomplished by sequence
variation and not by gross
structural alteration.
27. 7 6 5 4 8 3 2 1
VSG
70-bp
repeat
Telomeric
repeats
ESAGs
a-amanitin resistant
Pol I promoter
VSG Expression Occurs From Unique
Telomeric Expression Sites
• VSG are expressed in long polycistronic messages (>40kb)
• Expression site encodes multiple “expression site associated genes”
• There are approximately 20 bloodstream expression sites, only one is
active at a time
• There are two distinct types of expression sites
1. Bloodstream (above)
2. metacyclic
28. VSG
ESAGs
VSG
ESAGs
One VSG Expression Site is Active at a Time
Active Site
(one)
Inactive
‘silent’ site
(many)
Full-length transcript, high level
Partial transcripts, low level
70-bp
repeat
70-bp
repeat
Unable to “force” two expression sites to be simultaneously active
Chaves et al 1999. EMBO J 18:4846-55
29. Active VSG locus
tagged with
Lac operator and
Visualized with
Tagged lac
Repressor LacI-GFP
Nucleolus and
“Expression
Site Body (ESB)”
Labeled by
PolI antibody
ESB ESB
Nucleolus
Active VSG is Located in Subnuclear Compartment
“Expression Site Body”
Navarro M & Gull K. 2001. Nature 414:759-763.
30. Three Distinct Mechanisms of VSG switching
Duplicative Gene
Conversion
A
221
A
A
in situ
switch
221
221
C
C
Telomere
exchange
B
221
221
B
31. Location VSG
Size VSG pool
Silent subtelomeric
VSG arrays
Telomeric VSGs VSGs in bloodstream
expression sites
1250-1400 150-250 20
Megachromosomes and
intermediate chromosomes
Minichromosomes
~50-100kb
VSG Genome Organization
Taylor & Rudenko. Trends Genet 2006. 22:614-20
32. Gene conversion is likely to be a primary mechanism to
generate vsg gene diversity
Most vsg are pseudogenes
Limited number of functional genes, ~7% of 806 vsg
genes
A ‘reservoir’ of potential genetic change contained in non-
functional vsg pseudogenes
vsg Gene Diversification
33. Silent
VSG array
Active VSG
expression site
3’conserved
region
70-bp repeat
A B
B
C
70-bp repeat arrays
VSG Switching by Gene Conversion Frequently Relies on Homology
Upstream and Within the 3’ Conserved Region of Genes
Switch
34. L Miller et al, Nature 2002
Clonal Antigenic Variation in Plasmodium falciparum
36. ~60 genes per parasite haplotype (few pseudogenes)
One gene on, the others off
Similar A,B,C gene organization between parasite isolates
A’s are not under strong CD36 selection, others are
The A,B,Cs of var
Organization
37. PfEMP1 proteins have multiple receptor-like
domains
~60 proteins: Different protein forms Common adhesion trait
CD36 (blood vessels, immune cells)
Rarer
ICAM-1 (blood vessels, immune cells)
Rosetting with uninfected erythrocytes
Pregnancy restricted
CSA
Binding determines IE tropism
38. Multiple Layers of Gene Control
Layer 1: Gene structure and putative regulatory
elements
39. Var Genes are Expressed in situ
DBL CIDR DBL DBL ATS
TM
Sterile Transcripts
Exon 1
hypervariable
Exon 2
Conserved
• Monocistronic
• Only one var gene is expressed at a time
• No dedicated expression sites, genes are expressed in situ
• Transcription factors? Members of ApiAP2 family?
40. var Intron Promoter May Cooperate in Gene Silencing
luciferase
var upstream region
luciferase
var upstream region
luciferase
var upstream region
intron promoter
disabled intron promoter
Default var
promoter state
Active
Active
Silent
promoter pairing
Deitsch et al. Nature. 2001. 412:875-6
41. Note: others argue var promoter is
sufficient to silence genes
Voss et al. (2006) A var promoter controls allelic exclusion of virulence genes in
Plasmodium falciparum malaria
43. Silent and Active Chromatin Marks
Note: similar “marks” are found at many active and silent genes
44. SIR2 Regulates the Silencing of Some
Var Genes
• Silent information regulator (SIR) proteins
associate with the ends of chromosomes in
yeast and Plasmodium.
• Deacetylation of histones by SIR2 can initiate
the establishment of heterochromatin (silent
chromatin in which transcription is
repressed).
• ‘silent’ subtelomeric var genes are bound by
SIR2.
• SIR2 binding is lost when gene is activated.
• SIR2 gene disruption leads to activation of a
subset of var genes.
48. Pathogenic Neisseriae
Gram-negative bacteria
Two pathogens of importance to human health
N. Gonorrhoeae
sexually transmitted
causes cervical and urethral infections
Uses pili to attach to epithelial cells, invades, replicates
in basement membrane
N. Meningitidis
transmitted by saliva or respiratory secretions
cause of meningitis
Uses pili to attach to host cells
49. Small set of outer membrane protein (Opacity protein), up
to 7 genes (possibly adhesive proteins)
All copies are transcribed, control is at translation:
Signal sequences have variable # of coding
repeats (CTCTT)
Phase variation is RecA independent, thought due
to strand slippage changes
Very high frequency (>10-2 per division)
Opa ss
…CTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCCGCA…
7 x CTCTT = Stop
8 x CTCTT = Stop
9 X CTCTT = in frame
Phase variation in Neisseria opa genes
50. Antigenic Variation and Phase Variation
of Neisseria pili
Pathogen lifestyle: extracellular and within neutrophils
Variant antigen: type IV pilin protein
Protein location: Expressed at surface of bacteria
Protein function: Adhesion ligand
Gene copies: one expressed gene (pilE), several silent
pseudogenes (pilS)
Switch rate: as high as 4 X 10-3 per cell per generation
Role of recombination: Antigenic variation is RecA dependent
51. Mechanisms of Pili Variation
Antigenic variation: Occurs when silent pilin cassettes (pilS)
recombine with the sole expression site
(pilE)
a) intergenomic – take up DNA released by lysis from
neighboring Neisseria cells
b) intragenomic – recA dependent recombination with
silent copies
Phase variation: the reversible inter-conversion between
piliated (P+) and nonpiliated states (P-).
pilC is turned on or off.